Search Results

Search found 15224 results on 609 pages for 'parallel python'.

Page 390/609 | < Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >

  • Pygame, sounds don't play

    - by terabytest
    I'm trying to play sound files (.wav) with pygame but when I start it I never hear anything. This is the code: import pygame pygame.init() pygame.mixer.init() sounda= pygame.mixer.Sound("desert_rustle.wav") sounda.play() I also tried using channels but the result is the same

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • How can I handle dynamic calculated attributes in a model in Django?

    - by bullfish
    In Django I calculate the breadcrumb (a list of fathers) for an geographical object. Since it is not going to change very often, I am thinking of pre calculating it once the object is saved or initialized. 1.) What would be better? Which solution would have a better performance? To calculate it at _init_ or to calculate it when the object is saved (the object takes about 500-2000 characters in the DB)? 2.) I tried to overwrite the _init_ or save() methods but I don't know how to use attributes of the just saved object. Accessing *args, **kwargs did not work. How can I access them? Do I have to save, access the father and then save again? 3.) If I decide to save the breadcrumb. Whats the best way to do it? I used http://www.djangosnippets.org/snippets/1694/ and have crumb = PickledObjectField(). Thats the method to calculate the attribute crumb() def _breadcrumb(self): breadcrumb = [ ] x = self while True: x = x.father try: if hasattr(x, 'country'): breadcrumb.append(x.country) elif hasattr(x, 'region'): breadcrumb.append(x.region) elif hasattr(x, 'city'): breadcrumb.append(x.city) else: break except: break breadcrumb.reverse() return breadcrumb Thats my save-Method: def save(self,*args, **kwargs): # how can I access the father ob the object? father = self.father # does obviously not work father = kwargs['father'] # does not work either # the breadcrumb gets calculated here self.crumb = self._breadcrumb(father) super(GeoObject, self).save(*args,**kwargs) Please help me out. I am working on this for days now. Thank you.

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Creating a new plugin for mpld3

    - by sjp14051
    Toward learning how to create a new mpld3 plugin, I took an existing example, LinkedDataPlugin (http://mpld3.github.io/examples/heart_path.html), and modified it slightly by deleting references to lines object. That is, I created the following: class DragPlugin(plugins.PluginBase): JAVASCRIPT = r""" mpld3.register_plugin("drag", DragPlugin); DragPlugin.prototype = Object.create(mpld3.Plugin.prototype); DragPlugin.prototype.constructor = DragPlugin; DragPlugin.prototype.requiredProps = ["idpts", "idpatch"]; DragPlugin.prototype.defaultProps = {} function DragPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; DragPlugin.prototype.draw = function(){ var patchobj = mpld3.get_element(this.props.idpatch, this.fig); var ptsobj = mpld3.get_element(this.props.idpts, this.fig); var drag = d3.behavior.drag() .origin(function(d) { return {x:ptsobj.ax.x(d[0]), y:ptsobj.ax.y(d[1])}; }) .on("dragstart", dragstarted) .on("drag", dragged) .on("dragend", dragended); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); patchobj.data = ptsobj.offsets; ptsobj.elements() .data(ptsobj.offsets) .style("cursor", "default") .call(drag); function dragstarted(d) { d3.event.sourceEvent.stopPropagation(); d3.select(this).classed("dragging", true); } function dragged(d, i) { d[0] = ptsobj.ax.x.invert(d3.event.x); d[1] = ptsobj.ax.y.invert(d3.event.y); d3.select(this) .attr("transform", "translate(" + [d3.event.x,d3.event.y] + ")"); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); } function dragended(d, i) { d3.select(this).classed("dragging", false); } } mpld3.register_plugin("drag", DragPlugin); """ def __init__(self, points, patch): print "Points ID : ", utils.get_id(points) self.dict_ = {"type": "drag", "idpts": utils.get_id(points), "idpatch": utils.get_id(patch)} However, when I try to link the plugin to a figure, as in plugins.connect(fig, DragPlugin(points[0], patch)) I get an error, 'module' is not callable, pointing to this line. What does this mean and why doesn't it work? Thanks. I'm adding additional code to show that linking more than one Plugin might be problematic. But this may be entirely due to some silly mistake on my part, or there is a way around it. The following code based on LinkedViewPlugin generates three panels, in which the top and the bottom panel are supposed to be identical. Mouseover in the middle panel was expected to control the display in the top and bottom panels, but updates occur in the bottom panel only. It would be nice to be able to figure out how to reflect the changes in multiple panels. Thanks. import matplotlib import matplotlib.pyplot as plt import numpy as np import mpld3 from mpld3 import plugins, utils class LinkedView(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin); LinkedViewPlugin.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin.prototype.constructor = LinkedViewPlugin; LinkedViewPlugin.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin.prototype.defaultProps = {} function LinkedViewPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} class LinkedView2(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin2); LinkedViewPlugin2.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin2.prototype.constructor = LinkedViewPlugin2; LinkedViewPlugin2.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin2.prototype.defaultProps = {} function LinkedViewPlugin2(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin2.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} fig, ax = plt.subplots(3) # scatter periods and amplitudes np.random.seed(0) P = 0.2 + np.random.random(size=20) A = np.random.random(size=20) x = np.linspace(0, 10, 100) data = np.array([[x, Ai * np.sin(x / Pi)] for (Ai, Pi) in zip(A, P)]) points = ax[1].scatter(P, A, c=P + A, s=200, alpha=0.5) ax[1].set_xlabel('Period') ax[1].set_ylabel('Amplitude') # create the line object lines = ax[0].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[0].set_ylim(-1, 1) ax[0].set_title("Hover over points to see lines") linedata = data.transpose(0, 2, 1).tolist() plugins.connect(fig, LinkedView(points, lines[0], linedata)) # second set of lines exactly the same but in a different panel lines2 = ax[2].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[2].set_ylim(-1, 1) ax[2].set_title("Hover over points to see lines #2") plugins.connect(fig, LinkedView2(points, lines2[0], linedata)) mpld3.show()

    Read the article

  • Help calling class from a class above.

    - by wtzolt
    Hello, How to call from class oneThread: back to class fun:? As in, address a class written below. Is it possible? class oneThread(threading.Thread): def __init__(self): threading.Thread.__init__(self) self.start() def run(self): print "1" time.sleep(1) print "2" time.sleep(1) print "3" self.wTree.get_widget("entryResult").set_text("Done with One.") # How to call from here back to class fun, which of course is below...? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "main.glade" ) self.wTree.signal_autoconnect( {"on_buttonOne" : self.one} ) gtk.main() def one(self, widget): oneThread(); gtk.gdk.threads_init() do=fun()

    Read the article

  • How to inject a key string to andoid device through ADB?

    - by Nandi
    Hi, Can somebody help me for the following. I want to select a perticular string in the list displayed in android phone. If i take example of phone book. i want to pass a person name to the device using adb interface and that name should get highlighted in the list. I tried all adb commands for this but could pass string and key events to the screen but not able to select the respective string. please help. Thanks in advance.

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • Clean Method for a ModelForm in a ModelFormSet made by modelformset_factory

    - by Salyangoz
    I was wondering if my approach is right or not. Assuming the Restaurant model has only a name. forms.py class BaseRestaurantOpinionForm(forms.ModelForm): opinion = forms.ChoiceField(choices=(('yes', 'yes'), ('no', 'no'), ('meh', 'meh')), required=False, )) class Meta: model = Restaurant fields = ['opinion'] views.py class RestaurantVoteListView(ListView): queryset = Restaurant.objects.all() template_name = "restaurants/list.html" def dispatch(self, request, *args, **kwargs): if request.POST: queryset = self.request.POST.dict() #clean here return HttpResponse(json.dumps(queryset), content_type="application/json") def get_context_data(self, **kwargs): context = super(EligibleRestaurantsListView, self).get_context_data(**kwargs) RestaurantFormSet = modelformset_factory( Restaurant,form=BaseRestaurantOpinionForm ) extra_context = { 'eligible_restaurants' : self.get_eligible_restaurants(), 'forms' : RestaurantFormSet(), } context.update(extra_context) return context Basically I'll be getting 3 voting buttons for each restaurant and then I want to read the votes. I was wondering from where/which clean function do I need to call to get something like: { ('3' : 'yes'), ('2' : 'no') } #{ 'restaurant_id' : 'vote' } This is my second/third question so tell me if I'm being unclear. Thanks.

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • Sqlalchemy layout with WSGI application

    - by TheDude
    I'm working on writing a small WSGI application using Bottle and SqlAlchemy and am confused on how the "layout" of my application should be in terms of SqlAlchemy. My confusion is with creating engines and sessions. My understanding is that I should only create one engine with the 'create_engine' method. Should I be creating an engine instance in the global namespace in some sort of singleton pattern and creating sessions based off of it? How have you done this in your projects? Any insight would be appreciated. The examples in the documentation dont seem to make this entirely clear (unless I'm missing something obvious). Any thoughts?

    Read the article

  • Decorator for determining HTTP response from a view

    - by polera
    I want to create a decorator that will allow me to return a raw or "string" representation of a view if a GET parameter "raw" equals "1". The concept works, but I'm stuck on how to pass context to my renderer. Here's what I have so far: from django.shortcuts import render_to_response from django.http import HttpResponse from django.template.loader import render_to_string def raw_response(template): def wrap(view): def response(request,*args,**kwargs): if request.method == "GET": try: if request.GET['raw'] == "1": render = HttpResponse(render_to_string(template,{}),content_type="text/plain") return render except Exception: render = render_to_response(template,{}) return render return response return wrap Currently, the {} is there just as a place holder. Ultimately, I'd like to be able to pass a dict like this: @raw_response('my_template_name.html') def view_name(request): render({"x":42}) Any assistance is appreciated.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

< Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >