Search Results

Search found 20677 results on 828 pages for 'python team'.

Page 404/828 | < Previous Page | 400 401 402 403 404 405 406 407 408 409 410 411  | Next Page >

  • django test client trouble

    - by Anton Koval'
    I've got a problem... we're writing project using django, and i'm trying to use django.test.client with nose test-framework for tests. Our code is like this: from simplejson import loads from urlparse import urljoin from django.test.client import Client TEST_URL = "http://smakly.localhost:9090/" def test_register(): cln = Client() ref_data = {"email": "[email protected]", "name": "???????", "website": "http://hot.bear.com", "xhr": "true"} print urljoin(TEST_URL, "/accounts/register/") response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) print response["message"] and in nose output I catch: Traceback (most recent call last): File "/home/psih/work/svn/smakly/eggs/nose-0.11.1-py2.6.egg/nose/case.py", line 183, in runTest self.test(*self.arg) File "/home/psih/work/svn/smakly/src/smakly.tests/smakly/tests/frontend/test_profile.py", line 25, in test_register response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 313, in post response = self.request(**r) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 225, in request response = self.handler(environ) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 69, in __call__ response = self.get_response(request) File "/home/psih/work/svn/smakly/parts/django/django/core/handlers/base.py", line 78, in get_response urlconf = getattr(request, "urlconf", settings.ROOT_URLCONF) File "/home/psih/work/svn/smakly/parts/django/django/utils/functional.py", line 273, in __getattr__ return getattr(self._wrapped, name) AttributeError: 'Settings' object has no attribute 'ROOT_URLCONF' My settings.py file does have this attribute. If I get the data from the server with standard urllib2.urllopen().read() it works in the proper way. Any ideas how I can solve this case?

    Read the article

  • Numpy Matrix keeps giving me an Error,

    - by uberjumper
    Okay this is werid, i keep getting the error, randomly. ValueError: matrix must be 2-dimensional So i tracked it down, and cornered it to basically something like this: a_list = [[(1,100) for _ in range(32)] for _ in range(32)] numpy.matrix(a_list) Whats wrong with this? If i print a_list it is clearly a 2d matrix of tuples, however numpy does not believe so.

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Moving a turtle to the center of a circle.

    - by Maggie
    I've just started using the turtle graphics program, but I can't figure out how to move the turtle automatically to the center of a circle (no matter where the circle is located) without it drawing any lines. I thought I could use the goto.() function but it's too specific and I need something general.

    Read the article

  • Will this SQL screw up

    - by Joshua
    I'm sure everyone knows the joys of concurrency when it comes to threading. Imagine the following scenario on every page-load on a noobily set up MySQL db: UPDATE stats SET visits = (visits+1) If a thousand users load the page at same time, will the count screw up? is this that table locking/row locking crap? Which one mysql use.

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • How can you dispatch on request method in Django URLpatterns?

    - by rcampbell
    It's clear how to create a URLPattern which dispatches from a URL regex: (r'^books/$', books), where books can further dispatch on request method: def books(request): if request.method == 'POST': ... else ... I'd like to know if there is an idiomatic way to include the request method inside the URLPattern, keeping all dispatch/route information in a single location, such as: (r'^books/$', GET, retrieve-book), (r'^books/$', POST, update-books), (r'^books/$', PUT, create-books),

    Read the article

  • What can I use the Google App Engine for?

    - by Sergio Boombastic
    This question possibly doesn't belong here. We'll see how the answers pan out, if this doesn't belong here please move it to where it belongs. I'm following the getting started guide for Google App Engine, and I'm seeing what it can and can't do. Basically, I'm seeing it's very similar to an MVC pattern. You create your model, then create a View that uses that Model to display information. Not only that, but it uses a controller of some kind in this fashion: application = webapp.WSGIApplication( [('/', MainPage)], debug=True) My question is, why would you use this Google App Engine if it's the same as using a number of other MVC frameworks? Is the only benefit you gain the load balancing being handled by Google automagically? What is a good example of something you would need the App Engine for? I'm trying to learn, so thanks for the discussion.

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

  • Regular Expression Question

    - by zyq524
    I'm trying to use regular expression to extract the comments in the heading of a file. For example, the source code may look like: //This is an example file. //Please help me. #include "test.h" int main() //main function { ... } What I want to extract from the code are the first two lines, i.e. //This is an example file. //Please help me. Any idea?

    Read the article

  • Iterating dictionary indexes in django templates

    - by unclaimedbaggage
    Hi folks...I have a dictionary with embedded objects, which looks something like this: notes = { 2009: [<Note: Test note>, <Note: Another test note>], 2010: [<Note: Third test note>, <Note: Fourth test note>], } I'm trying to access each of the note objects inside a django template, and having a helluva time navigating to them. In short, I'm not sure how to extract by index in django templating. Current template code is: <h3>Notes</h3> {% for year in notes %} {{ year }} # Works fine {% for note in notes.year %} {{ note }} # Returns blank {% endfor %} {% endfor %} If I replace {% for note in notes.year %} with {% for note in notes.2010 %} things work fine, but I need that '2010' to be dynamic. Any suggestions much appreciated.

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • Django choking oddly on some static media

    - by Edan Maor
    My situation: I'm serving static media via Django on my dev machine. On some files that I try and load, I get back this error: Traceback: File "c:\Program Files\Python26\Lib\site-packages\django\core\handlers\base.py" in get_response 92. response = callback(request, *callback_args, **callback_kwargs) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\views.py" in userpage 71. so_user = site.user(userid) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in user 476. u, = self.users((nid,), **kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in users 481. return self._get(User, ids, 'users', kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in _get 471. return self.build(root, typ, coll, kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in build 448. json = self._request(url, kw) File "E:\Stack2Blog\src.hg\stack2blog\..\stack2blog\stack2blogapp\stackexchange.py" in _request 422. dump = json.load(data) File "c:\Program Files\Python26\lib\json\__init__.py" in load 264. return loads(fp.read(), Exception Type: AttributeError at /userpage/362498 Exception Value: 'str' object has no attribute 'read' I've traced it to specific files which don't work (by going to their specific urls). Here's the odd part: changing the filename of the files makes them suddenly work. For example, I had a file called 'post.jpg', which gave this error. I renamed it to 'pos.jpg' and it worked. Back to 'post.jpg' and it gives the same error.

    Read the article

  • Getting child elements that are related to a parent in same table

    - by Madawar
    I have the following database schema class posts(Base): __tablename__ = 'xposts' id = Column(Integer, primary_key=True) class Comments(Base): __tablename__ = 'comments' id = Column(Integer, primary_key=True) comment_parent_id=Column(Integer,unique=True) #comment_id fetches comment of a comment ie the comment_parent_id comment_id=Column(Integer,default=None) comment_text=Column(String(200)) Values in database are 1 12 NULL Hello First comment 2 NULL 12 First Sub comment I want to fetch all Comments and sub comments of a post using sqlalchemy and have this so far qry=session.query(Comments).filter(Comments.comment_parent_id!=None) print qry.count() Is there a way i can fetch the all the subcomments of a comment in a query i have tried outerjoin on the same table(comments) and it seemed stupid and it failed.

    Read the article

  • Creating form object for variable kind of form.

    - by Bunny Rabbit
    i want to create a form for users to submit questions in django ..so far the models i have created are class Question(models.Model): statement=models.CharField(max_length=100) class Choice(models.Model): statement=models.CharField(max_length=100) value=models.IntegerField() question=models.ForeignKey(Question) Now i want to write a Form class for creating a above form but the problem is the number of choices are variable,a user can decide how many choices a question must have .How do i do that in django?

    Read the article

  • How do I create a Status Icon / System Tray Icon with custom text and transparent background using P

    - by Raugturi
    Here is the code that I have so far to define the icon: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, w, h) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 0, 0, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) This works to get the png into the icon, but falls short in two areas. First, transparency is not working. If I use a 22x22 png with transparent background and the image centered, I end up with sections of other active icons showing up inside of mine, like this: http://i237.photobucket.com/albums/ff311/Raugturi/22x22_image_with_transparency.png The icon it choose to steal from is somewhat random. Sometimes it's part of the dropbox icon, others the NetworkManager Applet. If I instead use this code: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, 22, 22) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 3, 6, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) And an image that is only 16x11 with the transparent edges removed, what I end up with is this: Same URL but file is 16x11_image_positioned_in_middle.png So how do I end up with a transparent block like the 1st one that doesn't pull in stuff from other icons? As for the second problem, I need the ability to write on the image before converting it to the icon. I tried using draw_glyphs and it told me I should be using Pango layout/context instead. Unfortunately all the Pango tutorials I could find deal with actual windows, not the status icon. Is there a good tutorial out there for Pango that would apply to this issue (and also maybe have at least some explanation of how to tell it what font to use as all of them that I found seem to lack this and it won't write anything without it). Note: Sorry for the lack of actual images and only one working link, apparently this is a spam prevention feature due to my lack of reputation.

    Read the article

  • Unknown syntax error.

    - by matt1024
    Why do I get a syntax error running this code? If I remove the highlighted section (return cards[i]) I get the error highlighting the function call instead. Please help :) def dealcards(): for i in range(len(cards)): cards[i] = '' for j in range(8): cards[i] = cards[i].append(random.randint(0,9) return cards[i] print (dealcards())

    Read the article

  • slicing 2d numpy array

    - by MedicalMath
    I have a 2d numpy array called FilteredOutput that has 2 columns and 10001 rows, though the number of rows is a variable. I am trying to take the 2nd column of FilteredOutput and use it to populate a new 1d numpy array called timeSeriesArray using the following line of code: timeSeriesArray=p.array(FilteredOutput[:,0]) I got this syntax from the following link. But the problem is that I am getting the following error message: TypeError: list indices must be integers, not tuple Can anyone show me the proper syntax for populating the 1d array timeSeriesArray with the contents of the second column of the 2d array FilteredOutput?

    Read the article

  • Conditional row coloring in a PocketPyGUI table (PythonCE)

    - by PabloG
    I'm working on a an PythonCE application, using the PocketPyGUI toolkit. I'm using the gui.Table control to display a large list of choices (addresses, codes and data associated), and I want to assign a different color to the rows that have been completed. Is there any way to colorize the rows given certain conditions? TIA, Pablo

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

< Previous Page | 400 401 402 403 404 405 406 407 408 409 410 411  | Next Page >