Search Results

Search found 31994 results on 1280 pages for 'input output'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 429/1280 | < Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Most efficient method of generating PNG as HTTP response

    - by awj
    I've built an ASP.NET page whose output stream is a dynamically-generated PNG image containing only text on a transparent background. The text is based upon database IDs contained in the querystring. There will be a limited number of variations. Which one of the following would be the most efficient means of returning the image to the client? Store each variation upon the first generation, and thenceforth retrieve this from the drive. Simply generate the image each time. Cache the output response based upon the querystring.

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • jquery show hide div's with a href tag

    - by user1736794
    I have some jquery which reveals and hides new div's based on which button is pressed. Rather than buttons i would like to insert my own text/image and have them work in the same way, revealing and hiding the new windows. Here is the jquery: <script> $(document).ready(function(){ $(".buttons").click(function () { var divname= this.value; $("#"+divname).show("slow").siblings().hide("slow"); }); }); </script> Here is the code for one of the buttons which i would like changed to a a href tag. <input type="button" id="button1" class="buttons" value="div1"></input> Any help will be greatly appreciated. Thanks. Pia

    Read the article

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • jquery/javascript to disable button within a table cell

    - by user1831612
    I have a table cell with 2 buttons in it. <td align="left" > <input type="button" value="edit"/> <input type="button" value="save" disabled="disabled"/> </td> By default save button is disabled. On the click of edit button, save button button must be enabled. The problem is i cannot assign id's to buttons since the table is dynamically generated using struts2 s:iterator tag. If i do there will be 2 or more cells with the same id How can I achieve this?

    Read the article

  • program to determine number of duplicates in a sentence

    - by bhavna raghuvanshi
    public class duplicate { public static void main(String[] args)throws IOException { System.out.println("Enter words separated by spaces ('.' to quit):"); Set<String> s = new HashSet<String>(); Scanner input = new Scanner(System.in); while (true) { String token = input.next(); if (".".equals(token)) break; if (!s.add(token)) System.out.println("Duplicate detected: " + token); } System.out.println(s.size() + " distinct words:\n" + s); } } my program detects and prints duplicate words but i need to print the number of duplicate words also. pls help me do it.

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • autocomplete-like feature with a python dict

    - by tipu
    In PHP, I had this line matches = preg_grep('/^for/', array_keys($hash)); What it would do is it would grab the words: fork, form etc. that are in $hash. In Python, I have a dict with 400,000 words. It's keys are words I'd like to present in an auto-complete like feature (the values in this case are meaningless). How would I be able to return the keys from my dictionary that match the input? For example (as used earlier), if I have my_dic = t{"fork" : True, "form" : True, "fold" : True, "fame" : True} and I get some input "for", It'll return a list of "fork", "form", "fold"

    Read the article

  • Linux How to print all the files with the same prefix after searching for them?

    - by Alyx
    I need to search through a directory which contains many sub directories, each which contain files. The files read as follows question1234_01, where 1234 are random digits and the suffix _01 is the number of messages that contain the prefix, meaning they are apart of the same continuing thread. find . -name 'quest*' | cut -d_ -f1 | awk '{print $1}' | uniq -c | sort -n example output: 1 quest1234 10 quest1523 This searches for all the files then sorts them in order. What I want to do is print all the files which end up having the most occurrences, in my example the one with 10 matches. So it should only output quest1523_01 - 11

    Read the article

  • two scp and ssh processes with single authentication

    - by Tomek Wyderka
    I need to scp and then ssh to the same host. Is it possible to authenticate just one time? Is it possible to input password once, then scp file, then ssh on that host and work interactively? Update I get HOSTNAME and SSH_PASSWORD. I never log in on that machine before. I need to send some files (probably using scp) and then log in using ssh and work on that HOST interactively. I want to save time and input password just once. I have lots of such hosts...

    Read the article

  • Best practice: Define form field name in backend or the template

    - by AbcAeffchen
    If you designing a webpage you should separate the backend from the frontend. But if you use forms you have to name them. But where should you set this name? e.g. PHP: $fieldName = 'email'; $template->setVar('field_name', $fieldName) ... if(!empty($_POST)) validate($_POST[$fieldName]); Template: <input type="text" name="{$field_name}"> Or just PHP: if(!empty($_POST)) validate($_POST['email']); Template: <input type="text" name="email"> Or should I write a function that can be called from the template an converts an array of field data (name, type, value, id, class, ...) into html code? Is there a best practice where to define fieldnames (types,etc.)? Notice: I used php and smarty like pseudocode (and tags), but its a general question.

    Read the article

  • PHP exec problem with s3-put

    - by schneck
    Hi there, I use the s3-bash-project to upload data to an S3-Bucket. My command looks like this: /mypath/s3_bash/s3-put -v -k '123456789' -s '/mypath/secret' -T '/mypath/upload/myuploadfile' '/my.bucket/mykeyname' I can run the command from the command line (Mac OS X), and it works well. Now I want to execute it from a PHP-Script: exec($command, $output); but in output, the "s3-put"-command only returns the command's help text. I log the command, and it works if I c&p it from the log the the command line, so there not a problem. It seems that PHP does not pass all the parameters to the command line, although I run escapeshellarg() over all the parameters. I'm using a local XAMPP-Test environment, safe_mode is off. Any ideas?

    Read the article

  • simple GET validation

    - by Andrew
    I have GET[] input and would like to carry out their validation. The input data is always a number by. Schema. I want to make sure that the pass number and the appropriate amount - not to throw the sql query. at this moment I am using the procedures $cc = $_GET['cc']; if ($cc=='') $cc='9012';$find=array("..", "/", "\\"); $replace=array("", "", ""); $cc=str_replace($find, $replace, $cc); $eic = $_GET['eic']; .... ect. // where f.ex. 9012 is an real existing data (in dbase) to generate sucure sql question GET[] variable data schema $_GET[$cc] - always 4 digits $_GET[$eic] - always 4 digits $_GET[$iy] - always 4 digits $_GET[$ir] - always 1 digit Can you show me a better way to secure my GET?

    Read the article

  • Changing cell class on radio button change

    - by Nick
    Huge thanks for the help in this thread - Click td, select radio button in jQuery But now I'm having trouble that it won't change the class of the cell, even though I have binded the 'change' trigger in jQuery like so: $("td input[type=radio]").bind('change click', function () { $('td').removeClass('selected'); $(this).parent('td').addClass('selected'); }); $("td").click(function () { $('input:radio', this).attr('checked', true); }); Hope that makes sense. If you click the radio button, or move between them using the keyboard, the cell's class changes just fine. However if you trigger this by clicking the cell it doesn't change the class :( Thanks

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • How can I get the JSON array data from nsstring or byte in xcode 4.2?

    - by user1471568
    I'm trying to get values from nsdata class and doesn't work. here is my JSON data. { "count": 3, "item": [{ "id": "1", "latitude": "37.556811", "longitude": "126.922015", "imgUrl": "http://175.211.62.15/sample_res/1.jpg", "found": false }, { "id": "3", "latitude": "37.556203", "longitude": "126.922629", "imgUrl": "http://175.211.62.15/sample_res/3.jpg", "found": false }, { "id": "2", "latitude": "37.556985", "longitude": "126.92286", "imgUrl": "http://175.211.62.15/sample_res/2.jpg", "found": false }] } and here is my code -(NSDictionary *)getDataFromItemList { NSData *dataBody = [[NSData alloc] initWithBytes:buffer length:sizeof(buffer)]; NSDictionary *iTem = [[NSDictionary alloc]init]; iTem = [NSJSONSerialization JSONObjectWithData:dataBody options:NSJSONReadingMutableContainers error:nil]; NSLog(@"id = %@",[iTem objectForKey:@"id"]); //for Test output = [[NSString alloc] initWithBytes:buffer length:rangeHeader.length encoding:NSUTF8StringEncoding]; NSLog(@"%@",output); return iTem; } how can I access every value in the JSON? Please help me.

    Read the article

  • Couldn't match expected type - Haskell Code

    - by wvyar
    I'm trying to learn Haskell, but the small bit of sample code I tried to write is running into a fairly large amount of "Couldn't match expected type" errors. Can anyone give me some guidance as to what I'm doing wrong/how I should go about this? These are the errors, but I'm not really sure how I should be writing my code. toDoSchedulerSimple.hs:6:14: Couldn't match expected type `[t0]' with actual type `IO String' In the return type of a call of `readFile' In a stmt of a 'do' block: f <- readFile inFile In the expression: do { f <- readFile inFile; lines f } toDoSchedulerSimple.hs:27:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter task name: " In the expression: do { putStr "Enter task name: "; task <- getLine; return inFileArray : task } toDoSchedulerSimple.hs:34:9: Couldn't match expected type `IO ()' with actual type `[a0]' In a stmt of a 'do' block: putStrLn "Your task is: " ++ (inFileArray !! i) In the expression: do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } In an equation for `getTask': getTask inFileArray = do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } toDoSchedulerSimple.hs:41:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter the task you would like to end: " In the expression: do { putStr "Enter the task you would like to end: "; task <- getLine; filter (endTaskCheck task) inFileArray } toDoSchedulerSimple.hs:60:53: Couldn't match expected type `IO ()' with actual type `[String] -> IO ()' In a stmt of a 'do' block: schedulerSimpleMain In the expression: do { (getTask inFileArray); schedulerSimpleMain } In a case alternative: "get-task" -> do { (getTask inFileArray); schedulerSimpleMain } This is the code itself. I think it's fairly straightforward, but the idea is to run a loop, take input, and perform actions based off of it by calling other functions. import System.Random (randomRIO) import Data.List (lines) initializeFile :: [char] -> [String] initializeFile inFile = do f <- readFile inFile let parsedFile = lines f return parsedFile displayHelp :: IO() displayHelp = do putStrLn "Welcome to To Do Scheduler Simple, written in Haskell." putStrLn "Here are some commands you might find useful:" putStrLn " 'help' : Display this menu." putStrLn " 'quit' : Exit the program." putStrLn " 'new-task' : Create a new task." putStrLn " 'get-task' : Randomly select a task." putStrLn " 'end-task' : Mark a task as finished." putStrLn " 'view-tasks' : View all of your tasks." quit :: IO() quit = do putStrLn "We're very sad to see you go...:(" putStrLn "Come back soon!" createTask :: [String] -> [String] createTask inFileArray = do putStr "Enter task name: " task <- getLine return inFileArray:task getTask :: [String] -> IO() getTask inFileArray = do i <- randomRIO (0, (length inFileArray - 1)) putStrLn "Your task is: " ++ (inFileArray !! i) endTaskCheck :: String -> String -> Bool endTaskCheck str1 str2 = str1 /= str2 endTask :: [String] -> [String] endTask inFileArray = do putStr "Enter the task you would like to end: " task <- getLine return filter (endTaskCheck task) inFileArray viewTasks :: [String] -> IO() viewTasks inFileArray = case inFileArray of [] -> do putStrLn "\nEnd of tasks." _ -> do putStrLn (head inFileArray) viewTasks (tail inFileArray) schedulerSimpleMain :: [String] -> IO() schedulerSimpleMain inFileArray = do putStr "SchedulerSimple> " input <- getLine case input of "help" -> displayHelp "quit" -> quit "new-task" -> schedulerSimpleMain (createTask inFileArray) "get-task" -> do (getTask inFileArray); schedulerSimpleMain "end-task" -> schedulerSimpleMain (endTask inFileArray) "view-tasks" -> do (viewTasks inFileArray); schedulerSimpleMain _ -> do putStrLn "Invalid input."; schedulerSimpleMain main :: IO() main = do putStr "What is the name of the schedule? " sName <- getLine schedulerSimpleMain (initializeFile sName) Thanks, and apologies if this isn't the correct place to be asking such a question.

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • Getting the dynamic value of a checkbox in repeating region loop with Jquery

    - by John
    How do I get the values of a check box that is in a repeating region with its values dynamically generated from a recordset from the database.I want to retrieve the value when it is checked and after I click on a link.The problem is that it is retrieving only the first value of the recordset which is 1.This is the code: //jQuery $(document).ready(function(){ $("#clickbtn").click(function(){ $("input[type=checkbox][checked]").each(function(){ var value=$("#checkid").attr('value'); $("#textfield").attr('value',value); }); return false; }); }); //html <td width="22"><form id="form1" name="form1" method="post" action=""> <input type="checkbox" name="checkid" id="checkid" value="<?php echo $row_people['NameID']; ?>" /> </form></td> I would appreciate the help.

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >