Search Results

Search found 31994 results on 1280 pages for 'input output'.

Page 431/1280 | < Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >

  • Failed to sum splited text

    - by user1784753
    I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • Linux How to print all the files with the same prefix after searching for them?

    - by Alyx
    I need to search through a directory which contains many sub directories, each which contain files. The files read as follows question1234_01, where 1234 are random digits and the suffix _01 is the number of messages that contain the prefix, meaning they are apart of the same continuing thread. find . -name 'quest*' | cut -d_ -f1 | awk '{print $1}' | uniq -c | sort -n example output: 1 quest1234 10 quest1523 This searches for all the files then sorts them in order. What I want to do is print all the files which end up having the most occurrences, in my example the one with 10 matches. So it should only output quest1523_01 - 11

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • Buttons created through jquery don't respond to clicks

    - by Atrus
    As I've come to understand using $('.whatever').click() only works for items created initially. Additional items won't respond in the correct fashion. I was then directed to using something like $('.whatever).on('click', myFunction()). However, I'm not detecting any difference, as newly created items are not called. Here is a JSFiddle demonstration my example code: http://jsfiddle.net/atrus6/zaKZN/ My initial input plus 'Kill' will work in the correct fashion, however any additional 'input + kill's will not not do anything. Am I incorrectly using .on() or is it something else?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • move text from one div to another with javascript or mootools

    - by Ke
    Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

    Read the article

  • A pointer member variable having different values

    - by Rohan Prabhu
    Ok, to begin with, this is my code: HyperSprite::HyperSprite() { _view = 0; } void HyperSprite::publish(QGraphicsView* view) { _view = view; } void HyperSprite::getKFrame() { if(_view != 0) { qDebug()<<(void*)_view; } } Now, if I call HyperSprite::getKFrame() from within main(), I get the output: 0xbf8ffb84 I have a TCP server, which requires this QGraphicsView* variable. So whenever a new connection is made, HyperSprite::getKFrame() is called. However, whenever I make a connection to my server, this is the output: 0x1e425ff I honestly don't understand this. Shouldn't the value of a member remain same throughout? Why is the pointer value changing? As is obvious, whenever I try to use the _view pointer to access any of its members, a Segmentation Fault occurs. I tried using QSharedPointer, but it also results in the same problem. The data of the QSharedPointer automatically changes. Why is this happening?

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Need an efficient algorithm solve this kind of complex structure

    - by Rizvan
    Problem Statement is : Given 2 Dimensional array, print output for example If 4 rows and 6 columns, output would be: 1 2 3 4 5 6 16 17 18 19 20 7 15 24 23 22 21 8 14 13 12 11 10 9 I tried it is looking like square within square but when I attempted this problem, I put so many while and if loops but didn't got exact answer. If row and columns increases how to handle it? This is not homework. I was learning solving complex structure so I need to understand it by some guidance.

    Read the article

  • How to make a call to an executable from Python script?

    - by fx
    I need to execute this script from my Python script. Is it possible? The script generate some outputs with some files being written. How do I access these files? I have tried with subprocess call function but without success. fx@fx-ubuntu:~/Documents/projects/foo$ bin/bar -c somefile.xml -d text.txt -r aString -f anotherString >output The application "bar" also references to some libraries, it also creates some files besides the output. How do I get access to these files? Just by using open()? Thank you,

    Read the article

  • Change Modul popup every 30 sec Javascript

    - by SoftwareDeveloper
    I have a div id called modalpage and have css. I need a javascript function which can dynamically shows popup for 20 mins and change in every 30 secs right now i have the following javascript function. Can anybody help me please <script language="javascript" type="text/javascript"> function revealModal(divID) { window.onscroll = function () { document.getElementById(divID).style.top = document.body.scrollTop; }; document.getElementById(divID).style.display = "block"; document.getElementById(divID).style.top = document.body.scrollTop; } which is called by a input id button. <input id="Button1" type="button" value="Click here" onclick="revealModal('modalPage')" /> Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • What is the differance between those two Strings in Java

    - by user1816808
    why when we declare string in java we can't use == to compare this string and always will turn to false while if we initialize the string from the beginning it will be true . for example : import java.util.Scanner; public class MyString { /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Scanner input = new Scanner(System.in); String s = input.nextLine(); if(s=="Hello") system.out.println("Hello"); String d = "Hello"; if(d=="Hello") system.out.println("Hello"); } } I need an explanation please ??

    Read the article

  • Color getAlpha() not working as intended

    - by Arvy
    I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

    Read the article

  • Confused on the basics of AJAX

    - by Doug
    So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

    Read the article

  • Form POST or sessions?

    - by eddienotizzard
    If you have an item where you allow users to add comments, how can you pass which item the user is replying too? I've though of using a hidden field in a form, however this can be easily changed using plugins such as firebug: <form method="post" action="blah"> <input type="hidden" name="item_id" value="<?php echo $item_id; ?>"> <!-- other form data here --> <input type="submit" name="submit"> </form> Or just simply using a session: $_SESSION['item_id'] = $item_id Is there a safe way to send the item data in a form?

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • HTTP download not working on Rails 3

    - by Test Test
    I have this in my Rails controller: def download_clip send_file "public/output.mp4", :type=>"video/mp4", :filename => "output.mp4", :disposition => 'attachment' end and in my HTML code I have this: <a href="download_clip/"></a> Now could somebody tell me why Firefox's download window will NOT pou up, but chrome downloads the file fine? Instead firefox opens a new window and starts playing the file. I WANT THE DOWNLOAD BOX to POPUP. I have spend too much time on it

    Read the article

  • Best use of Jquery sliders and PHP

    - by Coronier
    Hello there, I have two questions: What's the best way to send sliders' values to a PHP page ? I'm associating each slider (several per page) with an hidden form so far, but I wonder if there's a "cleaner" way to do this. Related to the 1st question; I've some trouble with the script: var score = $(this).slider( "option", "value" ); $(this).closest("input[type=='hidden']").val(score); It doesn't set the value of the hidden input. Can somebody tells me what's wrong ? Thanks

    Read the article

  • the problem of redirecting stdout in c#

    - by Mher
    Could you please explain why the shell redirection doesn't work with System.Diagnostics.Process class? I am trying to redirect the output streams to file with the following snippet: Process p = new Process(); p.StartInfo = new ProcessStartInfo(); p.StartInfo.FileName = "java.exe"; p.StartInfo.Arguments = @"> c:\Temp\test.log 2>&1"; p.StartInfo.UseShellExecute = true; p.Start(); The similar code works without problems with Python. Reading the output streams programmatically doesn't seem a preferable solution in my case because there will be a bunch of processes launched by my application.

    Read the article

< Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >