Search Results

Search found 31994 results on 1280 pages for 'input output'.

Page 431/1280 | < Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >

  • JavaScript return method

    - by user1314034
    I'am new in javascript. I can't understand why the function returns T1 object (not just string 'hi') in the following example. function T1(){ return 'hi'; } function T(){ return new T1(); } T(); output: T1 And returns function in the following example function T1(){ return function(){ return 'hi'; } } function T(){ return new T1(); } T(); output: function (){ return 'hi' } Please explain this rethult. Thank you)

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • PHP exec problem with s3-put

    - by schneck
    Hi there, I use the s3-bash-project to upload data to an S3-Bucket. My command looks like this: /mypath/s3_bash/s3-put -v -k '123456789' -s '/mypath/secret' -T '/mypath/upload/myuploadfile' '/my.bucket/mykeyname' I can run the command from the command line (Mac OS X), and it works well. Now I want to execute it from a PHP-Script: exec($command, $output); but in output, the "s3-put"-command only returns the command's help text. I log the command, and it works if I c&p it from the log the the command line, so there not a problem. It seems that PHP does not pass all the parameters to the command line, although I run escapeshellarg() over all the parameters. I'm using a local XAMPP-Test environment, safe_mode is off. Any ideas?

    Read the article

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • Unable to recieve file contents on server during upload

    - by Khushal
    Hello, I have a JSP page in which I have a file input field from which I browse a csv file and then upload it on server. I am using method = "POST" and ENCTYPE='multipart/form-data' in the form in which this file input field is present. On the servlet side(in the application's servlet) I am making use of apache's commom file upload API-ServletFileUpload API. After getting the FileItem list from the method parseRequest(request) of this API I am unable to get the file name and its content by using the methods getName(), getString() of FileItem API. Needed to know what am I doing wrong or any modifications in my approach that will make my application to work. Any pointers regarding this will be helpful. Thanks in advance!!

    Read the article

  • Need an efficient algorithm solve this kind of complex structure

    - by Rizvan
    Problem Statement is : Given 2 Dimensional array, print output for example If 4 rows and 6 columns, output would be: 1 2 3 4 5 6 16 17 18 19 20 7 15 24 23 22 21 8 14 13 12 11 10 9 I tried it is looking like square within square but when I attempted this problem, I put so many while and if loops but didn't got exact answer. If row and columns increases how to handle it? This is not homework. I was learning solving complex structure so I need to understand it by some guidance.

    Read the article

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • Writing out to a file in scheme

    - by Ceelos
    The goal of this is to check if the character taken into account is a number or operand and then output it into a list which will be written out to a txt file. I'm wondering which process would be more efficient, whether to do it as I stated above (writing it to a list and then writing that list out into a file) or being writing out into a txt file right from the procedure. I'm new with scheme so I apologize if I am not using the correct terminology (define input '("3" "+" "4")) (define check (if (number? (car input)) (write this out to a list or directly to a file) (check the rest of file))) Another question I had in mind, how can I make it so that the check process is recursive? I know it's a lot of asking but I've getting a little frustrated with checking out the methods that I have found on other sites. I really appreciate the help!

    Read the article

  • Is apparent NULL pointer dereference in C actually pointer arithmetic?

    - by karthik A
    hey ive got this piece of code. It dereferences a null pointer here. But then there is an and with unsigned int. I really dont understand the whole part. Can someone explain the output.?? struct hi { long a; int b; long c; }; int main() { struct hi ob={3,4,5}; struct hi *ptr=&ob; int num= (unsigned int) & (((struct hi *)0)->b); printf("%d",num); printf("%d",*(int *)((char *)ptr + (unsigned int) & (((struct hi *)0)->b))); } The output I get is 44. But how does it work?

    Read the article

  • jQuery/Javascript problem with IE

    - by Shadyn
    I have two radio buttons each with a unique ID. When one is clicked, I would like to add $10 to a total. When the other is clicked, we go back to the original total price. My jquery looks like this: function check_ceu() { var price = <%= conference_price %>; if($('#ceu_yes').is(':checked')){ $('#total').val(parseFloat(price) + 10) } else{ $('#total').val(price) } } I have this function bound to document.ready (for page refreshes) and also the onchange handler of the radio buttons. In FF and Chrome this works fine. In IE, when the radio button with ID of "ceu_yes" is checked nothing happens, then when clicking back to the other radio button, 10 is added. So in essence, IE has the checkbox functionality reversed. Below is my code for the buttons: <input type="radio" name="ceu" id="ceu_yes" value="1" onchange="check_ceu()" /> $10 <input type="radio" name="ceu" id="ceu_no" value="0" checked="checked" onchange="check_ceu()" /> No, thank you Any ideas on this?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • How to make a call to an executable from Python script?

    - by fx
    I need to execute this script from my Python script. Is it possible? The script generate some outputs with some files being written. How do I access these files? I have tried with subprocess call function but without success. fx@fx-ubuntu:~/Documents/projects/foo$ bin/bar -c somefile.xml -d text.txt -r aString -f anotherString >output The application "bar" also references to some libraries, it also creates some files besides the output. How do I get access to these files? Just by using open()? Thank you,

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • Form POST or sessions?

    - by eddienotizzard
    If you have an item where you allow users to add comments, how can you pass which item the user is replying too? I've though of using a hidden field in a form, however this can be easily changed using plugins such as firebug: <form method="post" action="blah"> <input type="hidden" name="item_id" value="<?php echo $item_id; ?>"> <!-- other form data here --> <input type="submit" name="submit"> </form> Or just simply using a session: $_SESSION['item_id'] = $item_id Is there a safe way to send the item data in a form?

    Read the article

  • How do I stop and empty tag in XML serializer?

    - by John
    I have an object like this, public class UserObj { public string First {get; set;} public string Last {get; set;} public addr Address {get; set;} } public class addr { public street {get; set;} public town {get; set;} } Now when I use XmlSerializer on it and street and town are empty I get this in the XML output, <Address /> Is there a way not to output this empty tag? Thanks

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

< Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >