Search Results

Search found 31994 results on 1280 pages for 'input output'.

Page 431/1280 | < Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • How to do a for loop in windows command line?

    - by TheFoxx
    I was wondering if this was possible? I'm not familiar with using windows command line, but I have to use it for a project I'm working on. I have a a number of files, for which I need to perform a function for each. I'm used to working with python, but obviously this is a bit different, so I was hoping for some help. Basically I need the for loop to iterate through 17 files in a folder, perform a function on each (that's using the specific software I have here for the project) and then that will output a file with a unique name (the function normally requires me to state the output file name) I would suck it up and just do it by hand for each of the 17, but basically it's creating a database of a file, and then comparing it to each of the 17. It needs to be iterated through several hundred times though. Using a for loop could save me days of work. Suggestions?

    Read the article

  • A pointer member variable having different values

    - by Rohan Prabhu
    Ok, to begin with, this is my code: HyperSprite::HyperSprite() { _view = 0; } void HyperSprite::publish(QGraphicsView* view) { _view = view; } void HyperSprite::getKFrame() { if(_view != 0) { qDebug()<<(void*)_view; } } Now, if I call HyperSprite::getKFrame() from within main(), I get the output: 0xbf8ffb84 I have a TCP server, which requires this QGraphicsView* variable. So whenever a new connection is made, HyperSprite::getKFrame() is called. However, whenever I make a connection to my server, this is the output: 0x1e425ff I honestly don't understand this. Shouldn't the value of a member remain same throughout? Why is the pointer value changing? As is obvious, whenever I try to use the _view pointer to access any of its members, a Segmentation Fault occurs. I tried using QSharedPointer, but it also results in the same problem. The data of the QSharedPointer automatically changes. Why is this happening?

    Read the article

  • how to use OR in jquery

    - by user1493339
    1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Failed to sum splited text

    - by user1784753
    I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

    Read the article

  • move text from one div to another with javascript or mootools

    - by Ke
    Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Structure within union and bit field

    - by java
    #include <stdio.h> union u { struct st { int i : 4; int j : 4; int k : 4; int l; } st; int i; } u; int main() { u.i = 100; printf("%d, %d, %d", u.i, u.st.i, u.st.l); } I'm trying to figure out the output of program. The first outputs u.i = 100 but I can't understand the output for u.st.i and u.st.l. Please also explain bit fields.

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • How to make a call to an executable from Python script?

    - by fx
    I need to execute this script from my Python script. Is it possible? The script generate some outputs with some files being written. How do I access these files? I have tried with subprocess call function but without success. fx@fx-ubuntu:~/Documents/projects/foo$ bin/bar -c somefile.xml -d text.txt -r aString -f anotherString >output The application "bar" also references to some libraries, it also creates some files besides the output. How do I get access to these files? Just by using open()? Thank you,

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • Buttons created through jquery don't respond to clicks

    - by Atrus
    As I've come to understand using $('.whatever').click() only works for items created initially. Additional items won't respond in the correct fashion. I was then directed to using something like $('.whatever).on('click', myFunction()). However, I'm not detecting any difference, as newly created items are not called. Here is a JSFiddle demonstration my example code: http://jsfiddle.net/atrus6/zaKZN/ My initial input plus 'Kill' will work in the correct fashion, however any additional 'input + kill's will not not do anything. Am I incorrectly using .on() or is it something else?

    Read the article

  • Confused on the basics of AJAX

    - by Doug
    So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • Database that accesses a website.?

    - by Alec
    Hi Guys What application should I use that is able to automatically access a website to gather information? Basically I have a database that completes calculations for me; however I have to manually gather the parameters from a website and input these into my database. What I would like is have an application that will take my input say the name of a product, access the website, add this name into a search box on a website, complete the search and then extract the desired information from the web page returning the results to my application to complete the calculation thus presenting me with the result. This is a little out of my depth but I’m willing to learn no matter how complicated the software. Cheers for your help.

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • Change Modul popup every 30 sec Javascript

    - by SoftwareDeveloper
    I have a div id called modalpage and have css. I need a javascript function which can dynamically shows popup for 20 mins and change in every 30 secs right now i have the following javascript function. Can anybody help me please <script language="javascript" type="text/javascript"> function revealModal(divID) { window.onscroll = function () { document.getElementById(divID).style.top = document.body.scrollTop; }; document.getElementById(divID).style.display = "block"; document.getElementById(divID).style.top = document.body.scrollTop; } which is called by a input id button. <input id="Button1" type="button" value="Click here" onclick="revealModal('modalPage')" /> Thanks

    Read the article

  • What is the differance between those two Strings in Java

    - by user1816808
    why when we declare string in java we can't use == to compare this string and always will turn to false while if we initialize the string from the beginning it will be true . for example : import java.util.Scanner; public class MyString { /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Scanner input = new Scanner(System.in); String s = input.nextLine(); if(s=="Hello") system.out.println("Hello"); String d = "Hello"; if(d=="Hello") system.out.println("Hello"); } } I need an explanation please ??

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • Need an efficient algorithm solve this kind of complex structure

    - by Rizvan
    Problem Statement is : Given 2 Dimensional array, print output for example If 4 rows and 6 columns, output would be: 1 2 3 4 5 6 16 17 18 19 20 7 15 24 23 22 21 8 14 13 12 11 10 9 I tried it is looking like square within square but when I attempted this problem, I put so many while and if loops but didn't got exact answer. If row and columns increases how to handle it? This is not homework. I was learning solving complex structure so I need to understand it by some guidance.

    Read the article

  • the problem of redirecting stdout in c#

    - by Mher
    Could you please explain why the shell redirection doesn't work with System.Diagnostics.Process class? I am trying to redirect the output streams to file with the following snippet: Process p = new Process(); p.StartInfo = new ProcessStartInfo(); p.StartInfo.FileName = "java.exe"; p.StartInfo.Arguments = @"> c:\Temp\test.log 2>&1"; p.StartInfo.UseShellExecute = true; p.Start(); The similar code works without problems with Python. Reading the output streams programmatically doesn't seem a preferable solution in my case because there will be a bunch of processes launched by my application.

    Read the article

< Previous Page | 427 428 429 430 431 432 433 434 435 436 437 438  | Next Page >