Search Results

Search found 33940 results on 1358 pages for 'line numbers'.

Page 43/1358 | < Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • GNOME Desktop fonts problem debacle

    - by Diogenes Lantern
    I didn't get an answer but I wasn't doing anything and this is an interesting topic. In Ubuntu 12.04, opening a file in gedit or I am working on the command line, in dpkg, I get returned the error "locale not supported, falling back to default "C" libraries", and the one below, Gtk-WARNING **: Locale not supported by C library. Using the fallback 'C' locale. The locales were not set correctly, and locale LANG and LANGUAGE were the culprits. I picked my way through this. The answer, correct below.

    Read the article

  • Ubuntu partition won't display on screen

    - by Danny
    I installed ggobi on my MacBook Pro, and it wasn't working right. I looked up some information, and found this site: Gtk Warning: Cannot open display I followed the vague instructions, but I think I just typed export DISPLAY=:0 directly into my terminal (I'm still in my Mac partition at this point). Fast forward a few days, and I try to go into my Ubuntu partition. It only gives me command line options. I remember my reckless input from a few days back, and I'm certain that it is the issue. My problem is that I have no idea how to get my previous display settings back. My Mac partition seems unaffected, but it'd be nice to get back into my Ubuntu partition. My last resort is completely reverting my computer to my most recent backup before I changed it, but if anyone out there knows how to fix this, I'd greatly appreciate it. Thanks in advance.

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Effecient finding of long-range spotting targets

    - by nihohit
    I'm creating a top-down 2d strategy game, with a square grid map. So far, I've used Bresenham's line drawing algorithm in a circle to determine what's in LOS of each unit, and then targedt one of the targets in the circle. Now I find that this limits my units to shoot only at targets that they see. I want to extend my targeting algorithm to target any other unit in range of my weapon, even if they're out of sight range of this given unit, if they're "spotted" by another friendly unit. In other words, I want to enable usage of weapons with ranges longer than sight range. Is there a better way than iterating over all sighted units and computing range and LOSto each of them?

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • How to create a minimal installation in VMware Player for browsing?

    - by dbz_a
    I am trying to build a minimal vmware image to use for private browsing (also called a browser appliance). I have tried using images for other small linux distros, most of them are either too heavy (I do not want any other functionality than browsing and downloading) or outdated (DSL, various browser appliance images at vmware official site). I have downloaded the minimal Ubuntu install image (12MB) and was hoping to select only the needed pakcages while installing but it was not asking for my choices anywhere. I am new to the command line installation and I would be thankful if someone could point out how to install only needed packages, and what are the bare-minimum packages to browse internet (I plan to use only firefox and transmission)

    Read the article

  • Problem after last update

    - by bhappy
    I am having a problem after the last update, the booting to command line problem I even can't start in the graphic fail system "xfail": X: cannot stat /etc/X11/X (no such file or directory), aborting I found some one mentioning a solution which is installing ubuntu-dektop though apt-get but it failed due to this error: Unmet dependencies " the dependencies are xserver-xorg-video-all and xserver-xorg-input" Tried to install these first also another dependencies problem. Solutions I tried: removing and installing nvidia driver removing and installing xserver Tried different versions of nvidia including the latest one which is the one I had before the update Any ideas?

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • Passing a multi-line string as an argument to a script in Windows

    - by Zack Mulgrew
    I have a simple python script like so: import sys lines = sys.argv[1] for line in lines.splitlines(): print line I want to call it from the command line (or a .bat file) but the first argument may (and probably will) be a string with multiple lines in it. How does one do this? Of course, this works: import sys lines = """This is a string It has multiple lines there are three total""" for line in lines.splitlines(): print line But I need to be able to process an argument line-by-line. EDIT: This is probably more of a Windows command-line problem than a Python problem. EDIT 2: Thanks for all of the good suggestions. It doesn't look like it's possible. I can't use another shell because I'm actually trying to invoke the script from another program which seems to use the Windows command-line behind the scenes.

    Read the article

  • mysql questions for beginners

    - by ankhseeker
    ok, I have a few questions regarding mysql. I am currently running ubuntu 12.04.4 LTS command line version. I am looking for a database that I can use. I am confused at this point because I am uninformed. mysql is just one database that is on the server? or can it contain several or many databases What programs do I use to access it on the server or is it a vt-100 type access? I understand that mysql comes with lamp? or ubuntu. I am thinking that it is already installed but not sure how to access it, but that is another question for later. Outside of the man pages and the ubuntu manual, is there a site for its setup and use? Thanks!

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • how to get bash to stop escaping $ during tab-completion?

    - by keturn
    I have this on the command line: ln -sf $PWD/wine- and then I hit tab to complete the filename. In earlier versions of Ubuntu, this worked just fine to complete the wine- filename (and as a side-effect $PWD would be expanded at that time). But now it turns it in to ln -sf \$PWD/wine- which isn't what I meant at all and doesn't complete anything as the file does not literally start with $. How do I get completion back to the less broken behaviour? set tells me these are my current settings: BASHOPTS=checkwinsize:cmdhist:expand_aliases:extquote:force_fignore:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath SHELLOPTS=braceexpand:emacs:hashall:histexpand:history:interactive-comments:monitor

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • jQueryUI Tabs: how to keep them on a single line?

    - by Andi
    Hi all, Maybe my question is wired: is there a way to prevent jQueryUI tabs from floating if browser window is too small? Explanation: I have a simple horizontal tab using CSS only. The content is floating but not the tabs. Important: there is no width set manually, the current width is taken automatically. Here is the code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <style type="text/css"> #tabs ul { white-space: nowrap; } #tabs ul li { display: inline; white-space: nowrap; } </style> <title>Tabs-CSS</title> </head> <body> <div class="demo"> <div id="tabs"> <ul> <li><a href="#tabs-1">Preloaded</a></li> <li><a href="ajax/content1.html">Tab 1</a></li> <li><a href="ajax/content2.html">Tab 2</a></li> <li><a href="ajax/content3-slow.php">Tab 3 (slow)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> </ul> <div id="tabs-1"> <p>Proin elit arcu, rutrum commodo, vehicula tempus, commodo a, risus. Curabitur nec arcu. Donec sollicitudin mi sit amet mauris. Nam elementum quam ullamcorper ante. Etiam aliquet massa et lorem. Mauris dapibus lacus auctor risus. Aenean tempor ullamcorper leo. Vivamus sed magna quis ligula eleifend adipiscing. Duis orci. Aliquam sodales tortor vitae ipsum. Aliquam nulla. Duis aliquam molestie erat. Ut et mauris vel pede varius sollicitudin. Sed ut dolor nec orci tincidunt interdum. Phasellus ipsum. Nunc tristique tempus lectus.</p> </div> </div> </div> </body> </html> This is exactly what I want. Next step: add jQueryUI Tab as unobtrusive Javascript. For example like this: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js" type="text/javascript"></script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.1/jquery-ui.min.js"></script> <link type="text/css" href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/themes/ui-lightness/jquery-ui.css" rel="stylesheet"/> <style type="text/css"> #tabs ul { white-space: nowrap; } #tabs ul li { display: inline; white-space: nowrap; } </style> <title>Tabs-CSS</title> </head> <body> <div class="demo"> <div id="tabs"> <ul> <li><a href="#tabs-1">Preloaded</a></li> <li><a href="ajax/content1.html">Tab 1</a></li> <li><a href="ajax/content2.html">Tab 2</a></li> <li><a href="ajax/content3-slow.php">Tab 3 (slow)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> </ul> <div id="tabs-1"> <p>Proin elit arcu, rutrum commodo, vehicula tempus, commodo a, risus. Curabitur nec arcu. Donec sollicitudin mi sit amet mauris. Nam elementum quam ullamcorper ante. Etiam aliquet massa et lorem. Mauris dapibus lacus auctor risus. Aenean tempor ullamcorper leo. Vivamus sed magna quis ligula eleifend adipiscing. Duis orci. Aliquam sodales tortor vitae ipsum. Aliquam nulla. Duis aliquam molestie erat. Ut et mauris vel pede varius sollicitudin. Sed ut dolor nec orci tincidunt interdum. Phasellus ipsum. Nunc tristique tempus lectus.</p> </div> </div> </div> <script type="text/javascript"> //<![CDATA[ $(function() { $("#tabs").tabs({ ajaxOptions: { error: function(xhr, status, index, anchor) { $(anchor.hash).html("Couldn't load this tab. We'll try to fix this as soon as possible. If this wouldn't be a demo."); }, } }); }); $(function() { $("#innertabs").tabs({ ajaxOptions: { error: function(xhr, status, index, anchor) { $(anchor.hash).html("Couldn't load this tab. We'll try to fix this as soon as possible. If this wouldn't be a demo."); } } }); }); //]]> </script> </body> </html> Now I can see that the tabbar floats on minimizing the browser window. And there are some ugly effect with the tabs jumping around. My main questions is: can I avoid floating the tabbar and keep all tabs on one single line? Kind regards, Andi

    Read the article

  • jQueryUI Tabs: how too keep them on a single line?

    - by Andi
    Hi all, Maybe my question is wired: is there a way to prevent jQueryUI tabs from floating if browser window is too small? Explanation: I have a simple horizontal tab using CSS only. The content is floating but not the tabs. Important: there is no width set manually, the current width is taken automatically. Here is the code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <style type="text/css"> #tabs ul { white-space: nowrap; } #tabs ul li { display: inline; white-space: nowrap; } </style> <title>Tabs-CSS</title> </head> <body> <div class="demo"> <div id="tabs"> <ul> <li><a href="#tabs-1">Preloaded</a></li> <li><a href="ajax/content1.html">Tab 1</a></li> <li><a href="ajax/content2.html">Tab 2</a></li> <li><a href="ajax/content3-slow.php">Tab 3 (slow)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> </ul> <div id="tabs-1"> <p>Proin elit arcu, rutrum commodo, vehicula tempus, commodo a, risus. Curabitur nec arcu. Donec sollicitudin mi sit amet mauris. Nam elementum quam ullamcorper ante. Etiam aliquet massa et lorem. Mauris dapibus lacus auctor risus. Aenean tempor ullamcorper leo. Vivamus sed magna quis ligula eleifend adipiscing. Duis orci. Aliquam sodales tortor vitae ipsum. Aliquam nulla. Duis aliquam molestie erat. Ut et mauris vel pede varius sollicitudin. Sed ut dolor nec orci tincidunt interdum. Phasellus ipsum. Nunc tristique tempus lectus.</p> </div> </div> </div> </body> </html> This is exactly what I want. Next step: add jQueryUI Tab as unobtrusive Javascript. For example like this: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js" type="text/javascript"></script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.1/jquery-ui.min.js"></script> <link type="text/css" href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/themes/ui-lightness/jquery-ui.css" rel="stylesheet"/> <style type="text/css"> #tabs ul { white-space: nowrap; } #tabs ul li { display: inline; white-space: nowrap; } </style> <title>Tabs-CSS</title> </head> <body> <div class="demo"> <div id="tabs"> <ul> <li><a href="#tabs-1">Preloaded</a></li> <li><a href="ajax/content1.html">Tab 1</a></li> <li><a href="ajax/content2.html">Tab 2</a></li> <li><a href="ajax/content3-slow.php">Tab 3 (slow)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> <li><a href="ajax/content4-broken.php">Tab 4 (broken)</a></li> </ul> <div id="tabs-1"> <p>Proin elit arcu, rutrum commodo, vehicula tempus, commodo a, risus. Curabitur nec arcu. Donec sollicitudin mi sit amet mauris. Nam elementum quam ullamcorper ante. Etiam aliquet massa et lorem. Mauris dapibus lacus auctor risus. Aenean tempor ullamcorper leo. Vivamus sed magna quis ligula eleifend adipiscing. Duis orci. Aliquam sodales tortor vitae ipsum. Aliquam nulla. Duis aliquam molestie erat. Ut et mauris vel pede varius sollicitudin. Sed ut dolor nec orci tincidunt interdum. Phasellus ipsum. Nunc tristique tempus lectus.</p> </div> </div> </div> <script type="text/javascript"> //<![CDATA[ $(function() { $("#tabs").tabs({ ajaxOptions: { error: function(xhr, status, index, anchor) { $(anchor.hash).html("Couldn't load this tab. We'll try to fix this as soon as possible. If this wouldn't be a demo."); }, } }); }); $(function() { $("#innertabs").tabs({ ajaxOptions: { error: function(xhr, status, index, anchor) { $(anchor.hash).html("Couldn't load this tab. We'll try to fix this as soon as possible. If this wouldn't be a demo."); } } }); }); //]]> </script> </body> </html> Now I can see that the tabbar floats on minimizing the browser window. And there are some ugly effect with the tabs jumping around. My main questions is: can I avoid floating the tabbar and keep all tabs on one single line? Kind regards, Andi

    Read the article

  • TrueCrypt drive letter not available

    - by Tono Nam
    With c# or a batch file I mount a trueCrypt volume located at A:\volumeTrueCrypt.tc With c# I do: static void Main(string[] args) { var p = Process.Start( fileName:@"C:\Program Files\TrueCrypt\TrueCrypt.exe", arguments:@"/v a:\volumetruecrypt.tc /lw /a /p truecrypt" ); p.WaitForExit(); } the alternative is to run the command on the command line as: C:\Windows\system32>"C:\Program Files\TrueCrypt\TrueCrypt.exe" /v "a:\volumetruecrypt.tc" /lw /a /p truecrypt Either way I get the error: Why do I get that error? I was able to run that command the first time. The moment I dismounted the volume and tryied to mount it again I got that error. I know that drive letter W is available because it shows as an available letter on true crypt if I where to open it manually: If I where then click on the button mount and then type the password truecrypt (truecrypt is the password) then it will successfully mount on drive w. Why I am not able to mount it from the command line!? If I change the drive letter on the command line it works. I want to use the drive W though. In other words executing "C:\Program Files\TrueCrypt\TrueCrypt.exe" /v "a:\volumetruecrypt.tc" /lz /a /p truecrypt will successfully mount that volume on drive z but I do not want to mount it on drive z I want to mount it on drive w. The first time I ran the batch it ran fine. Also if I restart my computer I believe it should work. More info on how to use trueCrypt through the command line can be found at: http://www.truecrypt.org/docs/?s=command-line-usage Edit I was also investivating when does this error occures. In order to generate this error you need to follow this steps. 1) execute the command: (note the /q argument at the end for quiet) "C:\Program Files\TrueCrypt\TrueCrypt.exe" /v "a:\volumetruecrypt.tc" /ln /a /p truecrypt /q "C...TrueCrypt.exe" = location where trueCrypt is located /v "path" = location where volume is located /n = drive letter n /p truecrypt = password is "trueCrypt" /q = execute in quiet mode. do not show window note I am mounting to drive letter n 2) now volume should be mounted. 3) Open trueCrypt and manually dismount that volume (without using command line) 4) Attempt to run the same command line (without the /q so you see the error) "C:\Program Files\TrueCrypt\TrueCrypt.exe" /v "a:\volumetruecrypt.tc" /ln /a /p truecrypt 5) an error should show up So the problem ocures when I manually dismount the volume. If I dismount it from the command line I get no errors. But I think this is a bug from trueCrypt

    Read the article

  • How can I line up WPF items in a Horizontal WrapPanel so they line up based on an arbitrary vertical

    - by Scott Whitlock
    I'm trying to create a View in WPF and having a hard time figuring out how to set it up. Here's what I'm trying to build: My ViewModel exposes an IEnumerable property called Items Each item is an event on a timeline, and each one implements ITimelineItem The ViewModel for each item has it's own DataTemplate to to display it I want to display all the items on the timeline connected by a line. I'm thinking a WrapPanel inside of a ListView would work well for this. However, the height of each item will vary depending on the information it displays. Some items will have graphic objects right on the line (like a circle or a diamond, or whatever), and some have annotations above or below the line. So it seems complicated to me. It seems that each item on the timeline has to render its own segment of the line. That's fine. But the distance between the top of the item to the line (and the bottom of the item to the line) could vary. If one item has the line 50 px down from the top and the next item has the line 100 px down from the top, then the first item needs 50 px of padding so that the line segments add up. I think I could solve that problem, however, we only need to add padding if these two items are on the same line in the WrapPanel! Let's say there are 5 items and only room on the screen for 3 across... the WrapPanel will put the other two on the next line. That's ok, but that means only the first 3 need to pad together, and the last 2 need to pad together. This is what's giving me a headache. Is there another approach I could look at?

    Read the article

  • Strings exported from a module have changed line breaks

    - by Jesse Millikan
    In a DrScheme project, I'm using a MrEd editor-canvas% with text% and inserting a string from a literal in a Scheme file. This results in an extra blank line in the editor for each line of text I'm trying to insert. I've tracked this down to the apparent fact that string literals from outside modules are getting extra line breaks. Here's a full example. The editor is irrelevant at this point, but it displays the result. ; test-literals.ss (module test-literals scheme (provide (all-defined-out)) (define exported-string "From another module with some more line breaks. ")) ; editor-test.ss (module editor-test scheme (require mred "test-literals.ss") (define w (instantiate frame% ("Editor Test" #f) )) (define c (instantiate editor-canvas% (w) (line-count 12) (min-width 400))) (define editor (instantiate text% ())) (send c set-editor editor) (send w show #t) (send editor erase) (send editor insert "Some text with some line breaks. ") (send editor insert exported-string)) And the result in the editor is Some text with some line breaks. From another module with some more line breaks. I've traced in and figured out that it's changing Unix line breaks to Windows line breaks when strings are imported from another module, but these display as double line breaks. Why is this happening and is there a way to stop it other than changing every imported string?

    Read the article

< Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >