Search Results

Search found 11972 results on 479 pages for 'writing'.

Page 443/479 | < Previous Page | 439 440 441 442 443 444 445 446 447 448 449 450  | Next Page >

  • how to get $form_state outside of FAPI's functions?

    - by logii
    I'm writing a custom module and I'd like to use $form_state of the current form in another non-form api function - custom_facet_view_build(). any help is appreciated :) <?php /** * Implementation of hook_perm(). */ function custom_facet_perm() { return array( 'access foo content', 'access baz content', ); } /** * Implementation of hook_menu(). */ function custom_facet_menu() { $items['faceted-search'] = array( 'title' => 'Faceted Search', 'page callback' => 'drupal_get_form', 'access arguments' => array(), ); $items['facet-search-test'] = array( 'page callback' => 'drupal_get_form', 'page arguments' => array('custom_facet_form'), 'access callback' => TRUE, 'type' => MENU_CALLBACK, ); return $items; } /** * Form definition; ahah_helper_demo form. */ function custom_facet_form($form_state) { $form = array(); ahah_helper_register($form, $form_state); if (isset($form_state['storage']['categories'])) { $categories_default_value = $form_state['storage']['categories']["#value"]; } $form['facet_search_form'] = array( '#type' => 'fieldset', '#title' => t('Faceted Search'), '#prefix' => '<div id="billing-info-wrapper">', // This is our wrapper div. '#suffix' => '</div>', '#tree' => TRUE, // Don't forget to set #tree! ); $form['facet_search_form']['categories'] = array( '#type' => 'select', '#title' => t('Category'), '#options' => _custom_facet_taxonomy_query(1), '#multiple' => TRUE, '#default_value' => $categories_default_value, ); $form['save'] = array( '#type' => 'submit', '#value' => t('Save'), ); return $form; } /** * Validate callback for the form. */ function custom_facet_form_validate($form, &$form_state) { } /** * Submit callback for the form. */ function custom_facet_form_submit($form, &$form_state) { drupal_set_message('nothing done'); $form_state['storage']['categories'] = $form['facet_search_form']['categories']; // dpm($form_state); // There's a value returned in form_state['storage] within this function } /** * Implementation of hook_views_api(). */ function custom_facet_views_api() { return array( 'api' => 2, ); } function custom_facet_view_build(&$view) { dpm($form_state); // form_state['storage] remains NULL even though there's a value on previous submission }

    Read the article

  • infix operation to postfix using stacks

    - by Chris De La O
    We are writing a program that needs to convert an infix operation (4 5/3) to postfix (4 5 3 / ) using stacks. however my convert to postfix does not work as it doesnt not output the postFix array that is supposed to store the conversion from infix notation to postfix notation. here is the code for the convertToPostix fuction. //converts infix expression to postfix expression void ArithmeticExpression::convertToPostfix(char *const inFix, char *const postFix) { //create a stack2 object named cow Stack2<char> cow; cout<<postFix; char thing = '('; //push a left parenthesis onto the stack cow.push(thing); //append a right parenthesis to the end of inFix array strcat(inFix, ")"); int i = 0;//declare an int that will control posFix position //if the stack is not empty if (!cow.isEmpty()) { //loop to run until the last character in inFix array for (int x = 0; inFix[x]!= '\0'; x++ ) { //if the inFix element is a digit if (isdigit(inFix[x])) { postFix[i]=inFix[x];//it is assigned to the next element in postFix array i++;//move on to next element in postFix } //if the inFix element is a left parenthesis else if (inFix[x]=='(') { cow.push(inFix[x]);//push it unto the stack } //if the inFix element is an operator else if (isOperator(inFix[x])) { char oper2 = inFix[x];//char variable holds inFix operator if (isOperator(cow.stackTop()))//if the top node in the stack is an operator { while (isOperator(cow.stackTop()))//and while the top node in the stack is an operator { char oper1 = cow.stackTop();//char variable holds node operator if(precedence( oper1, oper2))//if the node operator has higher presedence than node operator { postFix[i] = cow.pop();//we pop such operator and insert it in postFix array's next element cow.push(inFix[x]);//and push inFix operator unto the stack i++;//move to the next element in posFix } } } //if the top node is not an operator //we push the current inFix operator unto the top of the stack else cow.push(inFix[x]); } //if the inFix element is a right parenthesis else if (inFix[x]==')') { //we pop everything in the stack and insert it in postFix //until we arrive at a left paranthesis while (cow.stackTop()!='(') { postFix[i] = cow.pop(); i++; } //we then pop and discard left parenthesis cow.pop(); } } postFix[i]='\0'; //print !!postFix array!! (not stack) print();//code for this is just cout<<postFix; }

    Read the article

  • How to efficently build an interpreter (lexer+parser) in C?

    - by Rizo
    I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

    Read the article

  • Poor man's "lexer" for C#

    - by Paul Hollingsworth
    I'm trying to write a very simple parser in C#. I need a lexer -- something that lets me associate regular expressions with tokens, so it reads in regexs and gives me back symbols. It seems like I ought to be able to use Regex to do the actual heavy lifting, but I can't see an easy way to do it. For one thing, Regex only seems to work on strings, not streams (why is that!?!?). Basically, I want an implementation of the following interface: interface ILexer : IDisposable { /// <summary> /// Return true if there are more tokens to read /// </summary> bool HasMoreTokens { get; } /// <summary> /// The actual contents that matched the token /// </summary> string TokenContents { get; } /// <summary> /// The particular token in "tokenDefinitions" that was matched (e.g. "STRING", "NUMBER", "OPEN PARENS", "CLOSE PARENS" /// </summary> object Token { get; } /// <summary> /// Move to the next token /// </summary> void Next(); } interface ILexerFactory { /// <summary> /// Create a Lexer for converting a stream of characters into tokens /// </summary> /// <param name="reader">TextReader that supplies the underlying stream</param> /// <param name="tokenDefinitions">A dictionary from regular expressions to their "token identifers"</param> /// <returns>The lexer</returns> ILexer CreateLexer(TextReader reader, IDictionary<string, object> tokenDefinitions); } So, pluz send the codz... No, seriously, I am about to start writing an implementation of the above interface yet I find it hard to believe that there isn't some simple way of doing this in .NET (2.0) already. So, any suggestions for a simple way to do the above? (Also, I don't want any "code generators". Performance is not important for this thing and I don't want to introduce any complexity into the build process.)

    Read the article

  • Set a specific stylesheet based on session variable in javascript

    - by user2371301
    I have an option for a user to select his/her own theme while logged into the system and this theme is set in a MYSQL Database and called each time the user logs in, this is called by: <?php $_SESSION['SESS_THEME_NAME']; ?> Now, I had this working in a PHP file but I need it to work in Javascript instead unfortunately. And I need some help. I looked at the code using the developers tools on Google Chrome and looks like the above code is not resolving within the javascript file. Which makes sense because you can't access session variables within a javascript file (as I found by searching Google.) The code is basically supposed to set the specific stylesheet based on the value extracted from the MYSQL database. So if the database says Default the script needs to tell the webpage to use the default.css file. And so on and so forth. My attempt at writing this is as follows: var themName="<?php $_SESSION['SESS_THEME_NAME']; ?>"; if (themeName == "Default") { document.write("<link re='stylesheet' type='text/css' href='css/mws-theme.css'>"); }; if (themeName == "Army") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-army.css'>"); }; if (themeName == "Rocky Mountains") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-rocky.css'>"); }; if (themeName == "Chinese Temple") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-chinese.css'>"); }; if (themeName == "Boutique") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-boutique.css'>"); }; if (themeName == "Toxic") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-toxic.css'>"); }; if (themeName == "Aquamarine") { document.write("<link rel='stylesheet' type='text/css' href='css/mws-theme-aquamarine.css'>"); }; Any help once so ever would be awesome and much much appreciated! I am reaching a deadline :/

    Read the article

  • How do I add Objective C code to a FireBreath Project?

    - by jmort253
    I am writing a browser plugin for Mac OS that will place a status bar icon in the status bar, which users can use to interface with the browser plugin. I've successfully built a FireBreath 1.6 project in XCode 4.4.1, and can install it in the browser. However, FireBreath uses C++, whereas a large majority of the existing libraries for Mac OS are written in Objective C. In the /Mac/projectDef.make file, I added the Cocoa Framework and Foundation Framework, as suggested here and in other resources I've found on the Internet: target_link_libraries(${PROJECT_NAME} ${PLUGIN_INTERNAL_DEPS} ${Cocoa.framework} # added line ${Foundation.framework} # added line ) I reran prepmac.sh, expecting a new project to be created in XCode with my .mm files, and .m files; however, it seems that they're being ignored. I only see the .cpp and .h files. I added rules for those in the projectDef.make file, but it doesn't seem to make a difference: file (GLOB PLATFORM RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} Mac/[^.]*.cpp Mac/[^.]*.h Mac/[^.]*.m #added by me Mac/[^.]*.mm #added by me Mac/[^.]*.cmake ) Even if I add the files in manually, I get a series of compilation errors. There are about 20 of them, all related to the file NSObjRuntime.h file: Parse Issue - Expected unqualified-id Parse Issue - Unknown type name 'NSString' Semantic Issue - Use of undeclared identifier 'NSString' Parse Issue - Unknown type name 'NSString' ... ... Semantic Issue - Use of undeclared identifier 'aSelectorName' ... ... Semantic Issue - Use of undeclared identifier 'aClassName' ... It continues like this for some time with similar errors... From what I've read, these errors appear because of dependencies on the Foundation Framework, which I believe I've included in the project. I also tried clicking the project in XCode I'm to the point now where I'm not sure what to try next. People say it's not hard to use Objective C in C/C++ code, but being new to XCode and Objective C might contribute to my confusion. This is only day 4 for me in this new platform. What do I need to do to get XCode to compile the Objective C code? Please remember that I'm a little new to this, so I'd appreciate it if you leave detailed answers as opposed to the vague one-liners that are common in the firebreath tag. I'm just a little in over my head, but if you can get me past this hurdle I'm certain I'll be good to go from there. UPDATE: I edited projects/MyPlugin/CMakeLists.txt and added in the .m and .mm rules there too. after running prepmac.sh, the files are included in the project, but I still get the same compile errors. I moved all the .h files and .mm files from the Obj C code to the MyPlugin root folder and reran the prepmac.sh file. Problem still exists. Same compile errors.

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • How to measure a canvas that has auto height and width

    - by Wymmeroo
    Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Parsing XML wont display all items.

    - by Nauman A
    I have this code but the toast wont display any message what is wrong with my code.. I can get the value from link, linknext but title wont bring out any value. ( I am not very bright with writing code so please suggest anything you may feel like. final Button button = (Button) findViewById(R.id.Button01); button.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { // Perform action on click try { URL url = new URL( "http://somelink.com=" + Link.setFirst_link); DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); Document doc = db.parse(new InputSource(url.openStream())); doc.getDocumentElement().normalize(); NodeList nodeList = doc.getElementsByTagName("item"); /** Assign textview array lenght by arraylist size */ for (int i = 0; i < nodeList.getLength(); i++) { Node node = nodeList.item(i); Element fstElmnt = (Element) node; NodeList nameList = fstElmnt.getElementsByTagName("link"); Element nameElement = (Element) nameList.item(0); nameList = nameElement.getChildNodes(); String img = (((Node) nameList.item(0)).getNodeValue()); NodeList websiteList = fstElmnt.getElementsByTagName("linknext"); Element websiteElement = (Element) websiteList.item(0); websiteList = websiteElement.getChildNodes(); String nextlink = (((Node) websiteList.item(0)).getNodeValue()); Link.setFirst_link = nextlink; Drawable drawable = LoadImageFromWebOperations(img); imgView.setImageDrawable(drawable); NodeList titleList = fstElmnt.getElementsByTagName("title"); Element titleElement = (Element) titleList.item(0); websiteList = titleElement.getChildNodes(); String title = (((Node) titleList.item(0)).getNodeValue()); Context context = getApplicationContext(); CharSequence text = title; int duration = Toast.LENGTH_SHORT; Toast toast = Toast.makeText(context, text, duration); toast.show(); } } catch (Exception e) { System.out.println("XML Pasing Excpetion = " + e); } } }); /** Set the layout view to display */ } Here is the xml file <?xml version="1.0"?> <maintag> <item> <link>http://image.com/357769.jpg?40</link> <linknext>http://www.image.com</linknext> <title>imagename</title> </item> </maintag>

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • Inserting checkbox values

    - by rabeea
    hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • B-trees, databases, sequential inputs, and speed.

    - by IanC
    I know from experience that b-trees have awful performance when data is added to them sequentially (regardless of the direction). However, when data is added randomly, best performance is obtained. This is easy to demonstrate with the likes of an RB-Tree. Sequential writes cause a maximum number of tree balances to be performed. I know very few databases use binary trees, but rather used n-order balanced trees. I logically assume they suffer a similar fate to binary trees when it comes to sequential inputs. This sparked my curiosity. If this is so, then one could deduce that writing sequential IDs (such as in IDENTITY(1,1)) would cause multiple re-balances of the tree to occur. I have seen many posts argue against GUIDs as "these will cause random writes". I never use GUIDs, but it struck me that this "bad" point was in fact a good point. So I decided to test it. Here is my code: SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[T1]( [ID] [int] NOT NULL CONSTRAINT [T1_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO CREATE TABLE [dbo].[T2]( [ID] [uniqueidentifier] NOT NULL CONSTRAINT [T2_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO declare @i int, @t1 datetime, @t2 datetime, @t3 datetime, @c char(300) set @t1 = GETDATE() set @i = 1 while @i < 2000 begin insert into T2 values (NEWID(), @c) set @i = @i + 1 end set @t2 = GETDATE() WAITFOR delay '0:0:10' set @t3 = GETDATE() set @i = 1 while @i < 2000 begin insert into T1 values (@i, @c) set @i = @i + 1 end select DATEDIFF(ms, @t1, @t2) AS [Int], DATEDIFF(ms, @t3, getdate()) AS [GUID] drop table T1 drop table T2 Note that I am not subtracting any time for the creation of the GUID nor for the considerably extra size of the row. The results on my machine were as follows: Int: 17,340 ms GUID: 6,746 ms This means that in this test, random inserts of 16 bytes was almost 3 times faster than sequential inserts of 4 bytes. Would anyone like to comment on this? Ps. I get that this isn't a question. It's an invite to discussion, and that is relevant to learning optimum programming.

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

< Previous Page | 439 440 441 442 443 444 445 446 447 448 449 450  | Next Page >