Search Results

Search found 7729 results on 310 pages for 'raphael js'.

Page 45/310 | < Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >

  • HTML/JS: open other website without associated coockies

    - by Tim
    I have a web shop which sends my customers to a pretty popular website to redeem their just purchased product (at my site). However, I keep getting complaints that the product has been redeemed at the wrong account. Because the other website is that popular, it often appears that when the customers computer is shared by others the wrong account was logged in (automatically by a coockie). Now I'm wondering which steps I can take to prevent this from happening, since I don't have control over the other website (which does not make clear enough who's logged in). Is there some way to open another website without its coockies?

    Read the article

  • js function to get filename from url

    - by Blankman
    Hi, I have a url like http://www.example.com/blah/th.html I need a javascript function to give me the 'th' value from that. All my urls have the same format (2 letter filenames, with .html extension). I want it to be a safe function, so if someone passes in an empty url it doesn't break. I know how to check for length, but I should be checking for null to right?

    Read the article

  • passing dynamic values in callback method

    - by swastican
    is there a way to pass dynamic values to callback function in js or jquery or nodejs. for(var i = 0; i < 10; i++) { filename = 'file'+i+'.html'; request(url, function(error, response, body) { test(error, response, body, filename); }); function test(error, response, body, filename) { console.log('file name ' + filename); if(response.statusCode == 200){ console.log('done'); } } I refered this so article for passing values to callback function. link: [JavaScript: Passing parameters to a callback function the output always seems to be 9 How can i pass values dynamically? The callback function always refers the last value of filename.

    Read the article

  • getting the names of elements in JS/jQuery

    - by Mala
    I have some checkbox inputs like so: <input type="checkbox" name="1" class="filter"/> <input type="checkbox" name="2" class="filter"/> ...etc... I'm trying to write a function where any time a checkbox is selected, it generates a string with all the names concatenated. Here's what I have so far: $('.filter').click(function(event){ var filters = $('.filter').toArray(); var fstr = ""; for (f in filters) { fstr = fstr+","+f.name; } alert(fstr); }); The names keep coming up as 'undefined', though (i.e. the alert returns ,undefined,undefined,undefined,undefined,undefined,undefined). How do I access the names?

    Read the article

  • Query parameter using JS framework ?

    - by Maxim Veksler
    Hi, I seem to not be able to find implementation from the common Ajax libraries (JQuery, mootools, prototypejs...) that would allow the operation of parsing the window.location.href for request parameter. I would expect something like: $P{"param1"} == "param1_value" Am I missing something? p.s. The web does contains implementation examples for such operations

    Read the article

  • JS variable scope missunderstanding

    - by meo
    I have a little problem: slideHelpers.total = 4 for (i=1;i <= slideHelpers.total; i++) { $('<a href="#">' + i + '</a>').bind('click', function(){ alert('go to the ' + i + ' slide')}).appendTo('.slideaccess') } the alert gives out 5 what is logic, because when the function click triggers i is actually 5. But i would like to have the same i as in my <a> tag. What is the best way to handle this? I could put i in the data() of the <a> tag for example but i am sure there is a easier way.

    Read the article

  • Calling As function from js problem

    - by Gene
    I have a swf file that is not controlled by me. The swf expects a javascript call to set some variables after initialization. The swf is embedded using the swfobject and I'm trying to call the as function right after the embed. This appears to be too soon because I get an error. Everything else should be fine since calling the as function manually via firebug does not produce the error. So the question is how do I call the function when the embed is complete?

    Read the article

  • Issue pushing object into an array JS

    - by Javacadabra
    I'm having an issue placing an object into my array in javascript. This is the code: $('.confirmBtn').click(function(){ //Get reference to the Value in the Text area var comment = $("#comments").val(); //Create Object var orderComment = { 'comment' : comment }; //Add Object to the Array productArray.push(orderComment); //update cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); }); However when I print the array this is the output: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] => TEST TEST ) I would like it to look like this: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] Array( [comment] => TEST TEST ) I added products to the array in a similar way and it worked fine: var productArray = []; // Will hold order Items $(".orderBtn").click(function(event){ //Check to ensure quantity > 0 if(quantity == 0){ console.log("Quantity must be greater than 0") }else{//It is so continue //Show the order Box $(".order-alert").show(); event.preventDefault(); //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); //Order Item (contains stockCode and Quantity) - Can add whatever data I like here var orderItem = { 'stockCode' : stockCode, 'quantity' : quantity }; //Check if cookie exists if($.cookie('order_cookie') === undefined){ console.log("Creating new cookie"); //Add object to the Array productArray.push(orderItem);

    Read the article

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • Alligator tags(<% %>) inside js string?

    - by bangoker
    I am trying to redirect a page reading the url from the config file. However, when I try this: <script type="text/javascript"> <%string redirectUrl = System.Web.Configuration.WebConfigurationManager.AppSettings["RedirectURL"];%> window.parent.location.replace("<%=redirectUrl%>"); </script> the alligator tags <% % are Not being highlighted, and when I run I get the following error in the yellow screen: the controls collection cannot be modified because the control contains code blocks (i.e. <% ... %>). What am I doing wrong?? Thanks!

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • JS Split ( ) to check if substring exists in Array

    - by Javacadabra
    I have an array of products that are stored as Strings in this format productname:quantity. The issue I am running into is that if a user adds one product with a quantity of x it is inserted into the array as it should. However, if they then decide to add more of a particular product a new entry is made into the array instead of checking if the product already exists and adjusting the quantity to the new value. oldQty + newQty. For example this is my array: ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1"] If I add another PALLET CARDS product it creates a new entry rather than updating the quantity of the existing item to 2. New array ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1","PALLET CARDS:1"] I would like the array to end up like this: - updating the quantity ["CBL202659/A:1","OUTER9:1","PALLET CARDS:2"] Currently this is my code: I use the split() method to seperate the String where a colon occurs and store the product name and quantity in two seperate variables. $(".orderBtn").click(function(event){ //Show the order Box $(".order-alert").show(); event.preventDefault(); //Create the Array var productArray = []; //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); var item = stockCode + ":" + quantity; var itemCheck = stockCode + ":"; if(quantity == 0){ console.log("Quantity must be greater than 0") }else{ //If no Cookie exists, create one and add the Array if ($.cookie('order_cookie') === undefined) { console.log("CREATE NEW COOKIE"); //Add items to Array productArray.push(item); //Add Array to Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); //If the Cookie already exists do this } else { productArray = JSON.parse($.cookie('order_cookie'));//get ref to array if(productArray.indexOf(itemCheck)!= -1){//It exists so update qty console.log("EXISTS... updating item: " + itemCheck); //var index = productArray.indexOf(item); //var update = productArray[index].split(":"); //var name = update[0]; //var oldQty = update[1]; //console.log(name + ":" + oldQty); //productArray[index] = item; }else{//It does not exist, so add to array console.log("Does not exist... adding new item: " + item); //Append items onto the Array productArray.push(item); } //Update the Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); console.log($.cookie('order_cookie')); } //Display the number of items in the Array in the Order Box $('#order_counter').html(productArray.length); } }); I suppose the real question I am asking here, is if it is possible to search the array for a subString - containing productname: ??

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • require.js - How can I set a version on required modules as part of the URL?

    - by Ovesh
    I am using require.js to require JS modules in my application. I need a way to bust client cache on new JS modules, by way of a different requested URL. i.e., if the file hello/there.js has already been cached on the client, I can change the file name to force the browser to get the new file. In other words, for the module hello/there, I'd like require.js to request the url hello/there___v1234___.js (the file name can look different, it's just an example), according to a version string which is accessible on the client. What is the best way to achieve that?

    Read the article

< Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >