Search Results

Search found 99 results on 4 pages for 'gene'.

Page 1/4 | 1 2 3 4  | Next Page >

  • Restore Gene : Automating SQL Server Database Restores

    Restore Gene is a simple 2-script framework, one PowerShell script and one SQL stored procedure, which will speed up the production of restore scripts for manual disaster recovery, as well help automate log shipping. FREE eBook – "45 Database Performance Tips for Developers"Improve your database performance with 45 tips from SQL Server MVPs and industry experts. Get the eBook here.

    Read the article

  • SQL Server 2008: Comparing similar records - Need to still display an ID for a record when the JOIN has no matches

    - by aleppke
    I'm writing a SQL Server 2008 report that will compare genetic test results for animals. A genetic test consists of an animalId, a gene and a result. Not all animals will have the same genes tested but I need to be able to display the results side-by-side for a given set of animals and only include the genes that are present for at least one of the selected animals. My TestResult table has the following data in it: animalId gene result 1 a CC 1 b CT 1 d TT 2 a CT 2 b CT 2 c TT 3 a CT 3 b TT 3 c CC 3 d CC 3 e TT I need to generate a result set that looks like the following. Note that Animal 3 is not being displayed (user doesn't want to see its results) and neither are results for Gene "e" since neither Animal 1 nor Animal 2 have a result for that gene: SireID SireResult CalfID CalfResult Gene 1 CC 2 CT a 1 CT 2 CT b 1 NULL 2 TT c 1 TT 2 NULL d But I can only manage to get this: SireID SireResult CalfID CalfResult Gene 1 CC 2 CT a 1 CT 2 CT b NULL NULL 2 TT c 1 TT NULL NULL d This is the query I'm using. SELECT sire.animalId AS 'SireID' ,sire.result AS 'SireResult' ,calf.animalId AS 'CalfID' ,calf.result AS 'CalfResult' ,sire.gene AS 'Gene' FROM (SELECT s.animalId ,s.result ,m1.gene FROM (SELECT [animalId ] ,result ,gene FROM TestResult WHERE animalId IN (1)) s FULL JOIN (SELECT DISTINCT gene FROM TestResult WHERE animalId IN (1, 2)) m1 ON s.marker = m1.marker) sire FULL JOIN (SELECT c.animalId ,c.result ,m2.gene FROM (SELECT animalId ,result ,gene FROM TestResult WHERE animalId IN (2)) c FULL JOIN (SELECT DISTINCT gene FROM TestResult WHERE animalId IN (1, 2)) m2 ON c.gene = m2.gene) calf ON sire.gene = calf.gene How do I get the SireIDs and CalfIDs to display their values when they don't have a record associated with a particular Gene? I was thinking of using COALESCE but I can't figure out how to specify the correct animalId to pass in. Any help would be appreciated.

    Read the article

  • Gene Hunt Says:

    - by BizTalk Visionary
    "She's as nervous as a very small nun at a penguin shoot"   "He's got fingers in more pies than a leper on a cookery course" "You so much as belch out of line and I'll have your scrotum on a barbed wire plate" "Let's go play slappyface" "your surrounded by armed barstewards" “Right, get out and find this murdering scum right now!” [pause] “Scratch that, we start 9am sharp tomorrow, it's beer-o-clock.” "So then Cartwright, you're such a good Detective.... Go and Detect me a packet of Garibaldies" "You're not the one who is going to have to knit himself a new arsehole after 25 years of aggressive male love in prison" “A dream for me is Diana Dors and a bottle of chip fat." “A dream for me is Diana Dors and a bottle of chip fat." “They reckon you've got concussion - but personally, I couldn't give a tart's furry cup if half your brains are falling out. Don't ever waltz into my kingdom playing king of the jungle.” “You great... soft... sissy... girlie... nancy... french... bender... Man-United supporting POOF!!” “Drugs eh? What's the point. They make you forget, make you talk funny, make you see things that aren't there. My old grandma got all of that for free when she had a stroke.” “He's Dead! It's quite serious!” “Fanny in the flat...Nice Work” “SoopaDoopa” “Tits in a Jumper!” “Drop your weapons! You are surrounded by armed bastards!” “It's 1973, almost dinnertime. I'm 'avin 'oops!” “Trust the Gene Genie!” “I wanna hump Britt Ekland...What're we gonna do...!” “Was that 'E' and you don't know the rest?! or you going 'Eeee, I Dunno'” “Good Girl! Prostate probe and no jelly. “ “Give over, it's nothing like Spain!” “I'll come over your houses and stamp on all your toys!” “The Wizard will sort it out. It's cos of the wonderful things he does” “Cartwright can jump up and down on his knackers!” “It's not a windup love, he really thinks like this!” “Women! You can't say two words to them” “I was thinking, maybe, a Berni Inn!” “If I wanted a bollocking for drinking too much...!” “Shhhh...hear that...that's the sound of this case being closed! “Chicken!? In a basket!?” “Seems a large quantity of cocaine...” “You probably thought he kept his cock in his keks!” “The tail-end of Rays demotion speech!” “Stephen Warren is gay!?” “You're a smart boy, use your initiative!” “Don't be such a Jessie!” “I find the idea of a bird brushing her teeth...!” “Never been tempted to the Magic talcum powder?” “Make sure she's got nice tits!” “You're more likely to find an ostrich with a plum up it's arse!” “Drink this lot under the table and have a pint on the way home!” “Never be a female Prime Minister!” “Pub? Pub! pub!.....Pub!” “Thou shalt not suck off rent boys!” “The number for the special clinic is on the notice board!” “If me uncle had tits, would he be me auntie!” “Got your vicars in a twist!” “We Done?!” “Your mates got balls...If they were any bigger he'd need a wheelbarrow!” “The Ending - from 'I want to go home' to the end music.”

    Read the article

  • Dolby Digital Live (DDL) on Asus Rampage II Gene (Creative X-Fi Extreme)

    - by kevyn
    Hi there, I have an Asus Rampage II Gene motherboard which has X-Fi extreme built in. I can get it to work with Windows 7 ok using the Creative drivers, however when I try and install the DDL/DTS add on pack from Creative I get the error message: "There are no supported audio device available. You need to close the application. Click OK to close the application now" I don't understand it because I have the Creative software installed ok and supporting the sound without any problems. In Device manager the audio device comes up as 'High definition audio device' and uses driver: 6.1.7600.16385 from Microsoft. I tried using the Creative drivers which show up as 'soundmax HD audio' however these do not allow any of the Creative products to run properly. Please can anyone offer any help? Or even just confirm that DDL can work with my onboard sound? Windows 7 Ultimate 64 bit 6GB DDR3 XFX GS8800 384mb Asus Rampage II Gene Intel i7 920 (2.66)

    Read the article

  • hierarchical clustering with gene expression matrix in python

    - by user248237
    how can I do a hierarchical clustering (in this case for gene expression data) in Python in a way that shows the matrix of gene expression values along with the dendrogram? What I mean is like the example here: http://www.mathworks.cn/access/helpdesk/help/toolbox/bioinfo/ug/a1060813239b1.html shown after bullet point 6 (Figure 1), where the dendrogram is plotted to the left of the gene expression matrix, where the rows have been reordered to reflect the clustering. How can I do this in Python using numpy/scipy or other tools? Also, is it computationally practical to do this with a matrix of about 11,000 genes, using euclidean distance as a metric? thanks.

    Read the article

  • IBM simule le cerveau d'un singe avec son supercalculateur Blue Gene/Q qui a émulé 530 milliards de neurones

    IBM simule le cerveau d'un singe avec son supercalculateur Blue Gene/Q qui a émulé 530 milliards de neurones IBM vient de réaliser de nouvelles prouesses dans le domaine de l'intelligence artificielle. La division de recherche de la société a simulé avec succès 530 milliards de neurones dans un réseau basé sur le modèle CoCoMac (connectivité structurelle dans le cerveau d'un singe). Le système est basé sur le supercalculateur IBM Blue Gene/Q du laboratoire de recherche Livermore Lawrence. Ce système comprend 1 024 « compute nodes » par armoire et 17 noyaux de processus par « compute nodes », reposant sur l'architecture IBM TrueNorth Cognitive Computing. Le...

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • How can I read a textfile into matlab and make it a list?

    - by Ben Fossen
    I have a textfile that has the format gene complement(22995..24539) /gene="ppp" /locus_tag="MRA_0020" CDS complement(22995..24539) /gene="ppp" /locus_tag="MRA_0020" /codon_start=1 /transl_table=11 /product="putative serine/threonine phosphatase Ppp" /protein_id="ABQ71738.1" /db_xref="GI:148503929" gene complement(24628..25095) /locus_tag="MRA_0021" CDS complement(24628..25095) /locus_tag="MRA_0021" /codon_start=1 /transl_table=11 /product="hypothetical protein" /protein_id="ABQ71739.1" /db_xref="GI:148503930" gene complement(25219..26802) /locus_tag="MRA_0022" CDS complement(25219..26802) /locus_tag="MRA_0022" /codon_start=1 /transl_table=11 /product="hypothetical protein" /protein_id="ABQ71740.1" /db_xref="GI:148503931" I would like to read the textfile into Matlab and make a list with the information from the line gene as the starting point for each item in the list. So for this example there will be 3 items in the list. I have tried a few things and cannot get this to work. Anyone have any ideas of what I can do?

    Read the article

  • "Undefined symbols" linker error with simple template class

    - by intregus
    Been away from C++ for a few years and am getting a linker error from the following code: Gene.h #ifndef GENE_H_INCLUDED #define GENE_H_INCLUDED template <typename T> class Gene { public: T getValue(); void setValue(T value); void setRange(T min, T max); private: T value; T minValue; T maxValue; }; #endif // GENE_H_INCLUDED Gene.cpp #include "Gene.h" template <typename T> T Gene<T>::getValue() { return this->value; } template <typename T> void Gene<T>::setValue(T value) { if(value >= this->minValue && value <= this->minValue) { this->value = value; } } template <typename T> void Gene<T>::setRange(T min, T max) { this->minValue = min; this->maxValue = max; } Using Code::Blocks and GCC if it matters to anyone. Also, clearly porting some GA stuff to C++ for fun and practice.

    Read the article

  • What is ltmain.sh, and why does automake say it is missing? What is a good auto (make/conf/etc) gene

    - by gersh
    I just want to develop a C app in linux with the auto(make/conf/...) stuff automatically generated. I tried generating it with ede and anjuta, but it doesn't seem to generate Makefile.am. So, I tried running automake, and it says "ltmain.sh" isn't found. Is there some easy to generate the basic build files for linux C/C++ apps. What is the standard practice? Do most people write these files themselves?

    Read the article

  • Is there any reasons to prefer SparkViewEngine over XSLT (or vice versa) for a standalone email gene

    - by Stephane
    I have a service that receives an object containing all the data needed to build a newsletter. I need to be able to generate the email using different templates. I don't want to involve the whole ASP.NET stack for that, so I want a separate templating engine. Reading a lot of opinions, I have found that XSLT was not getting very much love when it comes to templating engines. Why? SparkViewEngine is a "new cool toy", but it seems mature enough considering the number of projects that have been built with it. What do you think? Did you used those 2 engines? in which situation, and what strength/pain did you enjoy/endure

    Read the article

  • How can I extract paragaphs and selected lines with Perl?

    - by neversaint
    I have a text where I need to: to extract the whole paragraph under the section "Aceview summary" until the line that starts with "Please quote" (not to be included). to extract the line that starts with "The closest human gene". to store them into array with two elements. The text looks like this (also on pastebin): AceView: gene:1700049G17Rik, a comprehensive annotation of human, mouse and worm genes with mRNAs or ESTsAceView. <META NAME="title" CONTENT=" AceView: gene:1700049G17Rik a comprehensive annotation of human, mouse and worm genes with mRNAs or EST"> <META NAME="keywords" CONTENT=" AceView, genes, Acembly, AceDB, Homo sapiens, Human, nematode, Worm, Caenorhabditis elegans , WormGenes, WormBase, mouse, mammal, Arabidopsis, gene, alternative splicing variant, structure, sequence, DNA, EST, mRNA, cDNA clone, transcript, transcription, genome, transcriptome, proteome, peptide, GenBank accession, dbest, RefSeq, LocusLink, non-coding, coding, exon, intron, boundary, exon-intron junction, donor, acceptor, 3'UTR, 5'UTR, uORF, poly A, poly-A site, molecular function, protein annotation, isoform, gene family, Pfam, motif ,Blast, Psort, GO, taxonomy, homolog, cellular compartment, disease, illness, phenotype, RNA interference, RNAi, knock out mutant expression, regulation, protein interaction, genetic, map, antisense, trans-splicing, operon, chromosome, domain, selenocysteine, Start, Met, Stop, U12, RNA editing, bibliography"> <META NAME="Description" CONTENT= " AceView offers a comprehensive annotation of human, mouse and nematode genes reconstructed by co-alignment and clustering of all publicly available mRNAs and ESTs on the genome sequence. Our goals are to offer a reliable up-to-date resource on the genes, their functions, alternative variants, expression, regulation and interactions, in the hope to stimulate further validating experiments at the bench "> <meta name="author" content="Danielle Thierry-Mieg and Jean Thierry-Mieg, NCBI/NLM/NIH, [email protected]"> <!-- var myurl="av.cgi?db=mouse" ; var db="mouse" ; var doSwf="s" ; var classe="gene" ; //--> However I am stuck with the following script logic. What's the right way to achieve that? #!/usr/bin/perl -w my $INFILE_file_name = $file; # input file name open ( INFILE, '<', $INFILE_file_name ) or croak "$0 : failed to open input file $INFILE_file_name : $!\n"; my @allsum; while ( <INFILE> ) { chomp; my $line = $_; my @temp1 = (); if ( $line =~ /^ AceView summary/ ) { print "$line\n"; push @temp1, $line; } elsif( $line =~ /Please quote/) { push @allsum, [@temp1]; @temp1 = (); } elsif ($line =~ /The closest human gene/) { push @allsum, $line; } } close ( INFILE ); # close input file # Do something with @allsum There are many files like that I need to process.

    Read the article

  • Meta-licensing of applications

    - by Gene
    I'm currently evaluating license management solutions for our customized and project-based applications, which are supported by a single server in the intranet of the customer. The applications use common functionality provided by the server (session handling, data synchronization, management capabilities, etc) and are installed on mobile devices. We allow our customers to run the applications on X devices and want to check on the server, whether the customer sticks to this limit (based on the sessions). We don't want licensing software to be installed on the devices itself (for example providing X serials to the customer) nor do we want to host an additional server for licensing in the intranet of the customer. If a client connects, our server should load the license for the application running on the client and verify, that there are sessions left. The licensing managers I looked at (12 products so far) focus on the application itself and don't allow me to implement such a floating behavior as described above. For example, this software could easily be used to create a "Standard Edition" or a "Professional Edition" of our server software, which is not our intention. In XHEO DeployLX there is a "Session Limit", which allows to limit the license to the currently established sessions in ASP.NET, which comes very close to my needs. I'm currently thinking of implementing a custom solution, which allows me to load and enforce custom-defined licenses per application on the server-side and a simple editor to define such licenses (which would contain a type and the limit itself), but I would appreciate an existing, easy to integrate commercial solution. I think it could be possible to use DeployLX for this task, but I would spend a lot of money for implementing most of the solution myself (except for the editor). Thanks in advance for any suggestions or hints. Gene

    Read the article

  • R + Bioconductor : combining probesets in an ExpressionSet

    - by Mike Dewar
    Hi, First off, this may be the wrong Forum for this question, as it's pretty darn R+Bioconductor specific. Here's what I have: library('GEOquery') GDS = getGEO('GDS785') cd4T = GDS2eSet(GDS) cd4T <- cd4T[!fData(cd4T)$symbol == "",] Now cd4T is an ExpressionSet object which wraps a big matrix with 19794 rows (probesets) and 15 columns (samples). The final line gets rid of all probesets that do not have corresponding gene symbols. Now the trouble is that most genes in this set are assigned to more than one probeset. You can see this by doing gene_symbols = factor(fData(cd4T)$Gene.symbol) length(gene_symbols)-length(levels(gene_symbols)) [1] 6897 So only 6897 of my 19794 probesets have unique probeset - gene mappings. I'd like to somehow combine the expression levels of each probeset associated with each gene. I don't care much about the actual probe id for each probe. I'd like very much to end up with an ExpressionSet containing the merged information as all of my downstream analysis is designed to work with this class. I think I can write some code that will do this by hand, and make a new expression set from scratch. However, I'm assuming this can't be a new problem and that code exists to do it, using a statistically sound method to combine the gene expression levels. I'm guessing there's a proper name for this also but my googles aren't showing up much of use. Can anyone help?

    Read the article

  • Linux Versus E. coli

    <b>Discover:</b> "Linux bears an uncanny resemblance to the genes in a living cell. Many genes make proteins that act as switches for other genes. The proteins clamp onto DNA near a target gene, allowing the cell to read the gene and make a new protein."

    Read the article

  • Pull info from Excel Spreadsheet into C# Web Application

    - by Gene
    I want to show information from an excel spreadsheet in a web page. The xls will have maybe 5 columns, and as many rows as needed. The columns will be 'Name', 'Created Date', 'Expired Date', 'Owner', and maybe down the road maybe more. What I would like is for the C# to nightly read the xls, and display the information in a table on the website. If there is a PDF available for download I am going to link that as well. Thanks in advance, Gene

    Read the article

  • Display Computer Info on C# Web Application

    - by Gene
    I want to build a page for end users to visit (in our MPLS Network) and it show the following information in regards to them: Computer Name OS Disk Space Memory IP Address Active Directory User Name Password Expiration Time (As defined by Global Policy) Maybe a few other things such as Trend Micro Office current version vs. their version, # of MS Updates needed (we utilize WSUS), and a few other things in the future. My question is how would I pull this information from the user when they visit the page? What is the proper function for this? Anyone have examples they wish to share for me to learn by if possible? Thanks so much in advance, Gene

    Read the article

  • Oracle Cloud Solutions at Cloud Expo West

    - by Gene Eun
    Oracle is proud to be the Platinum Sponsor at next week's Cloud Expo West in Santa Clara (Nov 4-7).  This is the third consecutive year that Oracle has been sponsoring Cloud Expo and each year our involvement and presence at the conference has grown. This year, we have a great lineup of sessions which I've listed below. If you’re attending Cloud Expo West, we'd love to have you attend our sessions that will show our thought leadership and leading solutions in the cloud. You should also swing by Booth #130 to see some of our latest cloud offerings firsthand. Date  Time  Session Title  Track  Room  Monday, Nov 4  3:00 pm - 3:45 pm Ten Myths of Cloud Computing - General Session All Tracks Ballroom A-H  Monday, Nov 4  5:10 pm - 5:55 pm Driving Recurring Revenue Streams Through Cloud Billing Cloud Computing and Big Data M1  Monday, Nov 4  5:10 pm - 5:55 pm An Introduction to Oracle's Cloud Application Marketplace Cloud Bootcamp Great America Room J  Tuesday, Nov 5  6:25 pm - 7:05 pm Delivering Database as a Service with Oracle Database 12c Deploying the Cloud Great America Room 2  Wednesday, Nov 6  5:35 pm - 6:20 pm Accelerating Your Journey to Self-Service IT Enterprise Cloud Computing B2  Thursday, Nov 7  1:35 pm - 2:20 pm Oracle's Strategy for Public Cloud Platform and Infrastructure Services Infrastructure Management | Virtualization M2 At Cloud Expo West, you'll get to learn about and experience the latest in Cloud and Big Data. If you're in Silicon Valley or the Bay Area and don't have a pass to Cloud Expo, no problem. Oracle is giving away FREE VIP Gold Passes! We would love to have you be our VIP guest. Just go to Oracle's Cloud Expo 2013 event registration page and follow the instructions to get your complimentary pass. Stay tuned to this blog and follow us on Twitter (@OracleCloudZone) during and after Cloud Expo for more of our insight and observations about this year's conference.

    Read the article

  • The APEX of Business Value...or...the Business Value of APEX? Oracle Cloud Takes Oracle APEX to New Heights!

    - by Gene Eun
    The attraction of Oracle Application Express (APEX) has increased tremendously with the recent launch of the Oracle Cloud. APEX already supported departmental development and deployment of business applications with minimal involvement from the IT department. Positioned as the ideal replacement for MS Access, APEX probably has managed better to capture the eye of developers and was used for enterprise application development at least as much as for the kind of tactical applications that Oracle strategically positioned it for. With APEX as PaaS from the Oracle Cloud, a leap is made to a much higher level of business value. Now the IT department is not even needed to make infrastructure available with a database running  on it. All the business needs is a credit card. And the business application that is developed, managed and used from the cloud through a standard browser can now just as easily be accessed by users from around the world as by users from the business department itself. As a bonus – the development of the APEX application is also done in the cloud – with no special demands on the location or the enterprise access privileges of the developers. To sum it up: APEX from Oracle Cloud Database Service get the development environment up and running in minutes no involvement from the internal IT department required (not for infrastructure, platform, or development) superior availability and scalability is offered by Oracle users from anywhere in the world can be invited to access the application developers from anywhere in the world can participate in creating and maintaining the application In addition: because the Oracle Cloud platform is the same as the on-premise platform, you can still decide to move the APEX application between the cloud and the local environment – and back again. The REST-ful services that are available through APEX allow programmatic interaction with the database under the APEX application. That means that this database can be synchronized with on premise databases or data stores in (other) clouds. Through the Oracle Cloud Messaging Service, the APEX application can easily enter into asynchronous conversations with other APEX applications, Fusion Middleware applications (ADF, SOA, BPM) and any other type of REST-enabled application. In my opinion, now, for the first time perhaps, APEX offers the attraction to the business that has been suggested before: because of the cloud, all the business needs is  a credit card (a budget of $175 per month), an internet-connection and a browser. Not like before, with a PC hidden under a desk or a database running somewhere in the data center. No matter how unattended: equipment is needed, power is consumed, the database needs to be kept running and if Oracle Database XE does not suffice, software licenses are required as well. And this set up always has a security challenge associated with it. The cloud fee for the Oracle Cloud Database Service includes infrastructure, power, licenses, availability, platform upgrades, a collection of reusable application components and the development and runtime environments containing the APEX platform. Of course this not only means that business departments can move quickly without having to convince their IT colleagues to move along – it also means that small organizations that do not even have IT colleagues can do the same. Getting tailored applications or applications up and running to get in touch with users and customers all over the world is now within easy reach for small outfits – without any investment. My misunderstanding For a long time, I was under the impression that the essence of APEX was that the business could create applications themselves – meaning that business ‘people’ would actually go into APEX to create the application. To me APEX was too much of a developers’ tool to see that happen – apart from the odd business analyst who missed his or her calling as an IT developer. Having looked at various other cloud based development offerings – including Force.com, Mendix, WaveMaker, WorkXpress, OrangeScape, Caspio and Cordys- I have come to realize my mistake. All these platforms are positioned for 'the business' but require a fair amount of coding and technical expertise. However, they make the business happy nevertheless, because they allow the  business to completely circumvent the IT department. That is the essence. Not having to go through the red tape, not having to wait for IT staff who (justifiably) need weeks or months to provide an environment, not having to deal with administrators (again, justifiably) refusing to take on that 'strange environment'. Being able to think of an initiative and turn into action right away. The business does not have to build the application - it can easily hire some external developers or even that nerdy boy next door. They can get started, get an application up and running and invite users in – especially external users such as customers. They will worry later about upgrades and life cycle management and integration. To get applications up and running quickly and start turning ideas into action and results rightaway. That is the key selling point for all these cloud offerings, including APEX from the Cloud. And it is a compelling story. For APEX probably even more so than for the others. While I consider APEX a somewhat proprietary framework compared with ‘regular’ Java/JEE web development (or even .NET and PHP  development), it is still far more open than most cloud environments. APEX is SQL and PL/SQL based – nothing special about those languages – and can run just as easily on site as in the cloud. It has been around since 2004 (that is not including several predecessors that fed straight into APEX) so it can be considered pretty mature. Oracle as a company seems pretty stable – so investments in its technology are bound to last for some time to come. By the way: neither APEX nor the other Cloud DevaaS offerings are targeted at creating applications with enormous life times. They fit into a trend of agile development and rapid life cycle management, with fairly light weight user interfaces that quickly adapt to taste, technology trends and functional requirements and that are easily replaced. APEX and ADF – a match made in heaven?! (or at least in the sky) Note that using APEX only for cloud based database with REST-ful Services is also a perfectly viable scenario: any UI – mobile or browser based – capable of consuming REST-ful services can be created against such a business tier. Creating an ADF Mobile application for example that runs aginst REST-ful services is a best practice for mobile development. Such REST-ful services can be consumed from any service provider – including the Cloud based APEX powered REST-ful services running against the Oracle Cloud Database Service! The ADF Mobile architecture overview can easily be morphed to fit the APEX services in – allowing for a cloud based mobile app: Want to learn more about Oracle Database Cloud Service or Oracle Cloud, just visit cloud.oracle.com  or oracle.com/cloud. Repost of a blog entry by Rick Greenwald, Director of Product Management, Oracle Database Cloud Service.

    Read the article

  • Oracle and Microsoft Expand Choice and Flexibility in Deploying Oracle Software in the Cloud

    - by Gene Eun
    Oracle and Microsoft have entered into a new partnership that will help customers embrace cloud computing by providing greater choice and flexibility in how to deploy Oracle software.  Here are the key elements of the partnership: Effective today, our customers can run supported Oracle software on Windows Server Hyper-V and in Windows Azure Effective today, Oracle provides license mobility for customers who want to run Oracle software on Windows Azure Microsoft will add Infrastructure Services instances with popular configurations of Oracle software including Java, Oracle Database and Oracle WebLogic Server to the Windows Azure image gallery Microsoft will offer fully licensed and supported Java in Windows Azure Oracle will offer Oracle Linux, with a variety of Oracle software, as preconfigured instances on Windows Azure Oracle’s strategy and commitment is to support multiple platforms, and Microsoft Windows has long been an important supported platform.  Oracle is now extending that support to Windows Server Hyper-V and Window Azure by providing certification and support for Oracle applications, middleware, database, Java and Oracle Linux on Windows Server Hyper-V and Windows Azure. As of today, customers can deploy Oracle software on Microsoft private clouds and Windows Azure, as well as Oracle private and public clouds and other supported cloud environments. For information related to software licensing in Windows Azure, see Licensing Oracle Software in the Cloud Computing Environment. Also, Oracle Support policies as they apply to Oracle software running in Windows Azure or on Windows Server Hyper-V are covered in two My Oracle Support (MOS) notes which are shown below: MOS Note 1563794.1 Certified Software on Microsoft Windows Server 2012 Hyper-V - NEW MOS Note 417770.1 Oracle Linux Support Policies for Virtualization and Emulation - UPDATED

    Read the article

  • Oracle Cloud Solutions @ Cloud Expo East (June 10-12)

    - by Gene Eun
    Oracle is proud to be the Platinum Sponsor at next week's Cloud Expo East (June 10-12) at the Javits Center in New York City.  This is the fourth consecutive year Oracle has sponsored Cloud Expo. As in years past, Oracle has a full schedule of sessions shown below. We'd love to have you be our guest at Cloud Expo East and have you attend one of our sessions and hear more about our thought leadership and leading solutions in the Cloud and Big Data. We'll also have booth #207, so please stop by and see a demo of many of our cloud offerings. Date  Time  Session Title  Track  Room Tuesday, June 10 4:40 pm - 5:15 pm Top 5 Best Practices for your Application Platform As a Service Cloud Business and the API Economy | Deploying the Cloud TBD Wednesday, June 11 9:10 am - 10:10 am Cloud Odyssey:  A Hero’s Quest All Tracks (Keynote) Keynote Hall Wednesday, June 11 10:15 am - 10:45 am Big Data Management System: Smart SWL Processing Across Hadoop and Your Data Warehouse All Tracks (General Session) Keynote Hall Wednesday, June 11 2:50 pm - 3:25 pm Plug into the Cloud: Your Blueprint to Database as a Service Mobile | Hot Topics TBD Wednesday, June 11 2:50 pm - 3:25 pm From Supply-led to Demand-led: Lead Your IT to Better Serve Your Users Cloud Business and the API Economy | Deploying the Cloud TBD Thursday, June 12 2:50 pm - 3:25 pm Reduce Complexity and Accelerate Innovation with IaaS and PaaS Cloud Business and the API Economy | Deploying the Cloud TBD At Cloud Expo East, you'll get to learn about and experience the latest in Cloud and Big Data. If you don't have a pass to Cloud Expo, no problem. Oracle is giving away FREE VIP Gold Passes! We would love to have you attend Cloud Expo on us. Just go to Oracle's Cloud Expo 2014 event registration page and follow the instructions for a complimentary pass. Stay tuned to this blog and follow us on Twitter (@OracleCloudZone) during and after Cloud Expo for more insight and observations about this year's conference.

    Read the article

  • Two Cloudy Observations from Oracle OpenWorld

    - by Gene Eun
    Now that the dust has settled from another amazing Oracle OpenWorld, I wanted to reflect back on a couple of key observations I made during the event. First, it was pretty clear that Cloud was again a big deal at this year's conference. It was hard to not notice that Oracle continues to be "all-in" with respect to cloud computing. Just to give you an idea of the emphasis on Cloud, there were over 300 Cloud-related sessions at this year's OpenWorld. If you caught some of the demo booths in the Oracle Red Lounge, then you saw some of the great platform, application, and social services that are now part of Oracle Cloud, as well as numerous demos of private cloud products that Oracle offers. Second, during Thomas Kurian's keynote presentation on Oracle Cloud, he announced the Preview Availability of a new service called Oracle Developer Cloud Service. This new platform service will provide developers with instant access to environments to better manage the application development lifecycle in the cloud. It provides development project teams access to favorite tools like Hudson, Git, Github, wikis, and tasks to help make innovation faster, more collaborative, and more effective. There's also integration with IDEs like Eclipse, NetBeans, and JDeveloper. If you're a developer, it's an awesome addition to Oracle Cloud's platform services! Want more details about Oracle Developer Cloud Service? Click here.

    Read the article

  • Get Ready...Oracle CloudWorld is Coming to a City Near You in 2013

    - by Gene Eun
    Is your organization considering the cloud for deploying enterprise applications? Are mobile and social part of your cloud strategy? If you answered YES to either question, then you should plan to join us at an Oracle CloudWorld event, coming to a city near you in 2013. If you attend, you'll get an opportunity to learn firsthand about Oracle Cloud, talk to product experts, see live demos, and network with other industry professionals. By the way, did I mention that Oracle CloudWorld is a FREE event?Whether you're a C-level executive, line of business manager, or hardcore application developer, Oracle CloudWorld will have valuable information for you with keynotes, breakout sessions, demos, and dedicated tracks for: Sales and Marketing Customer Service and Support Finance and Operations Human Resources Application Developers Applications IT Click here to learn more about Oracle CloudWorld, including cities and dates. Hope to see you there!

    Read the article

1 2 3 4  | Next Page >