Search Results

Search found 13788 results on 552 pages for 'instance'.

Page 466/552 | < Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >

• Is there really such a thing as "being good at math"?

  - by thezhaba

  Aside from gifted individuals able to perform complex calculations in their head, I'm wondering if proficiency in mathematics, namely calculus and algebra, has really got to do with one's natural inclination towards sciences, if you can put it that way. A number of students in my calculus course pick up material in seemingly no time whereas I, personally, have to spend time thinking about and understanding most concepts. Even then, if a question that requires a bit more 'imagination' comes up I don't always recognize the concepts behind it, as is the case with calculus proofs, for instance. Nevertheless, I refuse to believe that I'm simply not made for it. I do very well in programming and software engineering courses where a lot of students struggle. At first I could not grasp what they found to be so difficult, but eventually I realized that having previous programming experience is a great asset -- once I've seen and made practical use of the programming concepts learning about them in depth in an academic setting became much easier as I have then already seen their use "in the wild". I suppose I'm hoping that something similar happens with mathematics -- perhaps once the practical idea behind a concept (which authors of textbooks sure do a great job of concealing..) is evident, understanding the seemingly dry and symbolic ideas and proofs would be more obvious? I'm really not sure. All I'm sure of is I'd like to get better at calculus, but I don't yet understand why some of us pick it up easily while others have to spend considerable amounts of time on it and still not have complete understanding if an unusual problem is given.

  Read the article

• Object Design catalog and resources

  - by Tauren

  I'm looking for web sites, books, or other resources that provide a catalog of object designs used in common scenarios. I'm not looking for generic design patterns, but for samples of actual object designs that were used to solve real problems. For instance, I'm about to build an internal messaging system for a web application, similar to Facebook's messaging system. This system will allow administrators to send messages to all members, to selected groups of members, or to individuals. Members can send messages to other members or groups of members. Fairly common stuff and a feature that I'm sure thousands of web applications require. I know each situation is different and there are a million ways to design this solution. Although this scenario isn't really all that complex, I'm sure the basic design of the necessary objects and relationships for a system like this has already been done many times. It would be nice to review other similar designs before building my own. Is there a place where people can share their designs and others can browse/search through the catalog to review and provide feedback on them? StackOverflow could be used to a degree for this, but doesn't really provide a catalog of designs. Any other resources that would relate?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Inversion of control domain objects construction problem

  - by Andrey

  Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

  Read the article

• `enable_shared_from_this` has a non-virtual destructor

  - by Shtééf

  I have a pet project with which I experiment with new features of the upcoming C++0x standard. While I have experience with C, I'm fairly new to C++. To train myself into best practices, (besides reading a lot), I have enabled some strict compiler parameters (using GCC 4.4.1): -std=c++0x -Werror -Wall -Winline -Weffc++ -pedantic-errors This has worked fine for me. Until now, I have been able to resolve all obstacles. However, I have a need for enable_shared_from_this, and this is causing me problems. I get the following warning (error, in my case) when compiling my code (probably triggered by -Weffc++): base class ‘class std::enable_shared_from_this<Package>’ has a non-virtual destructor So basically, I'm a bit bugged by this implementation of enable_shared_from_this, because: A destructor of a class that is intended for subclassing should always be virtual, IMHO. The destructor is empty, why have it at all? I can't imagine anyone would want to delete their instance by reference to enable_shared_from_this. But I'm looking for ways to deal with this, so my question is really, is there a proper way to deal with this? And: am I correct in thinking that this destructor is bogus, or is there a real purpose to it?

  Read the article

• Why null reference exception in SetMolePublicInstance?

  - by OldGrantonian

  I get a "null reference" exception in the following line: MoleRuntime.SetMolePublicInstance(stub, receiverType, objReceiver, name, null); The program builds and compiles correctly. There are no complaints about any of the parameters to the method. Here's the specification of SetMolePublicInstance, from the object browser: SetMolePublicInstance(System.Delegate _stub, System.Type receiverType, object _receiver, string name, params System.Type[] parameterTypes) Here are the parameter values for "Locals": + stub {Method = {System.String <StaticMethodUnitTestWithDeq>b__0()}} System.Func<string> + receiverType {Name = "OrigValue" FullName = "OrigValueP.OrigValue"} System.Type {System.RuntimeType} objReceiver {OrigValueP.OrigValue} object {OrigValueP.OrigValue} name "TestString" string parameterTypes null object[] I know that TestString() takes no parameters and returns string, so as a starter to try to get things working, I specified "null" for the final parameter to SetMolePublicInstance. As already mentioned, this compiles OK. Here's the stack trace: Unhandled Exception: System.NullReferenceException: Object reference not set to an instance of an object. at Microsoft.ExtendedReflection.Collections.Indexable.ConvertAllToArray[TInput,TOutput](TInput[] array, Converter`2 converter) at Microsoft.Moles.Framework.Moles.MoleRuntime.SetMole(Delegate _stub, Type receiverType, Object _receiver, String name, MoleBindingFlags flags, Type[] parameterTypes) at Microsoft.Moles.Framework.Moles.MoleRuntime.SetMolePublicInstance(Delegate _stub, Type receiverType, Object _receiver, String name, Type[] parameterTypes) at DeqP.Deq.Replace[T](Func`1 stub, Type receiverType, Object objReceiver, String name) in C:\0VisProjects\DecP_04\DecP\DeqC.cs:line 38 at DeqPTest.DecCTest.StaticMethodUnitTestWithDeq() in C:\0VisProjects\DecP_04\DecPTest\DeqCTest.cs:line 28 at Starter.Start.Main(String[] args) in C:\0VisProjects\DecP_04\Starter\Starter.cs:line 14 Press any key to continue . . . To avoid the null parameter, I changed the final "null" to "parameterTypes" as in the following line: MoleRuntime.SetMolePublicInstance(stub, receiverType, objReceiver, name, parameterTypes); I then tried each of the following (before the line): int[] parameterTypes = null; // if this is null, I don't think the type will matter int[] parameterTypes = new int[0]; object[] parameterTypes = new object[0]; // this would allow for various parameter types All three attempts produce a red squiggly line under the entire line for SetMolePublicInstance Mouseover showed the following message: The best overloaded method match for 'Microsoft.Moles.Framework.Moles.MoleRuntime.SetMolePublicInstance(System.Delegate, System.Type, object, string, params System.Type[])' has some invalid arguments. I'm assuming that the first four arguments are OK, and that the problem is with the params array.

  Read the article

• a reusable query with modifications?

  - by fusion

  i'm using this mysql query alongwith php to search for multiple keywords: $query = "SELECT cQuotes, vAuthor, cArabic, vReference FROM ".$table." WHERE ("; $countFields = count($arrayFields); while ($a < $countFields) { while ($b < $countSearch) { $query = $query."$arrayFields[$a] LIKE '%$arraySearch[$b]%'"; $b++; if ($b < $countSearch) { $query = $query." AND "; } } $b = 0; $a++; if ($a < $countFields) { $query = $query.") OR ("; } } $query = $query.")"; $result = mysql_query($query, $conn) i'd like to reuse this query with a few modifications to it (for instance, the WHERE clause remains the same, while i query the number of rows using COUNT), but it doesn't seem practical to repeat the code again for a few additions. any suggestions?

  Read the article

• CREATE VIEW called multiple times not creating all views

  - by theninepoundhammer

  Noticing strange behavior in SQL 2005, both Express and Enterprise Edition: In my code I need to loop through a series of values (about five in a row), and for each value, I need to insert the value into a table and dynamically create a new view using that value as part of the where clause and the name of the view. The code runs pretty quickly, but what I'm noticing is that all the values are inserted into the table correctly but only the LAST view is being created. Every time. For example, if the values I'm using are X1, X2, X3, X4, and X5, I'll run the process, open up Mgmt Studio, and see five rows in the table with the correct five values, but only one view named MyView_x5 that has the correct WHERE clause. At first, I had this loop in an SSIS package as part of a larger data flow. When I started noticing this behavior, I created a stored proc that would create the CREATE VIEW statement dynamically after the insert and called EXECUTE to create the view. Same result. Finally, I created some C# code using the Enterprise Library DAAB, and did the insert and CREATE VIEW statements from my DLL. Same result every time. Most recently, I turned on Profiler while running against the Enterprise Edition and was able to verify that the Batch Started and Batch Completed events were being fired off for each instance of the view. However, like I said, only the last view is actually being created. Does anyone have any idea why this might be happening? Or any suggestions about what else to check or profile? I've profiled for error messages, exceptions, etc. but don't see any in my trace file. My express edition is 9.00.1399.06. Not sure about the Enterprise edition but think it is SP2.

  Read the article

• What happens when modifying Gemfile.lock directly?

  - by Mik378

  Since the second time of bundle install execution, dependencies are loaded from Gemfile.lock when Gemfile isn't changed. But I wonder how detection of changes is made between those two files. For instance, if I'm adding a new dependency directly into Gemfile.lock without adding it into Gemfile (as opposed to the best practice since Gemfile.lock is auto-generated from Gemfile), would a bundle install consider Gemfile as changed ? Indeed, does bundle install process compares the whole Gemfile and Gemfile.lock trees in order to detect changes? If it is, even if I'm adding a dependency directly to Gemfile.lock, Gemfile would be detected as changed (since different) and would re-erase Gemfile.lock (so losing the added dependency...) What is the process of bundle install since the launch for the second time ? To be more clear, my question is: Are changes based only from Gemfile ? That means bundler would keep a Gemfile snapshot of every bundle install execution number N and merely compares it to the bundle install execution N+1 ? Or none snapshot are created in bundler memory and bundler makes a comparison with Gemfile.lock each time to detect if Gemfile must be considered as changed.

  Read the article

• When should I implement globalization and localization in C#?

  - by Geo Ego

  I am cleaning up some code in a C# app that I wrote and really trying to focus on best practices and coding style. As such, I am running my assembly through FXCop and trying to research each message it gives me to decide what should and shouldn't be changed. What I am currently focusing on are locale settings. For instance, the two errors that I have currently are that I should be specifying the IFormatProvider parameter for Convert.ToString(int), and setting the Dataset and Datatable locale. This is something that I've never done, and never put much thought into. I've always just left that overload out. The current app that I am working on is an internal app for a small company that will very likely never need to run in another country. As such, it is my opinion that I do not need to set these at all. On the other hand, doing so would not be such a big deal, but it seems like it is unneccessary and could hinder readability to a degree. I understand that Microsoft's contention is to use it if it's there, period. Well, I'm technically supposed to call Dispose() on every object that implements IDisposable, but I don't bother doing that with Datasets and Datatables, so I wonder what the practice is "in the wild."

  Read the article

• Java constructor using generic types

  - by Beer Me

  I'm having a hard time wrapping my head around Java generic types. Here's a simple piece of code that in my mind should work, but I'm obviously doing something wrong. Eclipse reports this error in BreweryList.java: The method breweryMethod() is undefined for the type <T> The idea is to fill a Vector with instances of objects that are a subclass of the Brewery class, so the invocation would be something like: BreweryList breweryList = new BreweryList(BrewerySubClass.class, list); BreweryList.java package com.beerme.test; import java.util.Vector; public class BreweryList<T extends Brewery> extends Vector<T> { public BreweryList(Class<T> c, Object[] j) { super(); for (int i = 0; i < j.length; i++) { T item = c.newInstance(); // breweryMethod() is an instance method // of Brewery, of which <T> is a subclass (right?) c.breweryMethod(); // "The method breweryMethod() is undefined // for the type <T>" } } } Brewery.java package com.beerme.test; public class Brewery { public Brewery() { super(); } protected void breweryMethod() { } } BrewerySubClass.java package com.beerme.test; public class BrewerySubClass extends Brewery { public BrewerySubClass() { super(); } public void brewerySubClassMethod() { } } I'm sure this is a complete-generics-noob question, but I'm stuck. Thanks for any tips!

  Read the article

• How to check at runtime if a class implements certain interface?

  - by mare

  Let's say I have some content classes like Page, TabGroup, Tab, etc. Certain of those will be implementing my IWidgetContainer interface - it means they will geet an additional field named ContainedItems from the interface and some methods for manipulating this field. Now I need to reflect the fact that some class implements this interface by rendering out some special custom controls in my ASP.NET MVC Views (like jQuery Add/Remove/Move/Reorder buttons). For instance, TabGroup will implement IWidgetContainer because it will contain tabs but a tab will not implement it because it won't have the ability to contain anything. So I have to somehow check in my view, when I render my content objects (The problem is, I use my base class as strong type in my view not concrete classes), whether it implements IWidgetContainer. How is that possible or have I completely missed something? To rephrase the question, how do you reflect some special properties of a class (like interface implementation) in the UI in general (not necessarily ASP.NET MVC)? Here's my code so far: [DataContract] public class ContentClass { [DataMember] public string Slug; [DataMember] public string Title; [DataMember] protected ContentType Type; } [DataContract] public class Group : ContentClass, IWidgetContainer { public Group() { Type = ContentType.TabGroup; } public ContentList ContainedItems { get; set; } public void AddContent(ContentListItem toAdd) { throw new NotImplementedException(); } public void RemoveContent(ContentListItem toRemove) { throw new NotImplementedException(); } } [DataContract] public class GroupElement : ContentClass { public GroupElement() { Type = ContentType.Tab; } } Interface: interface IWidgetContainer { [DataMember] ContentList ContainedItems { get; set; } void AddContent(ContentListItem toAdd); void RemoveContent(ContentListItem toRemove); }

  Read the article

• Retrieving a unique result set with Core Data

  - by randombits

  I have a core data based app that manages a bunch of entities. I'm looking to be able to do the following. I have an entity "SomeEntity" with the attributes: name, type, rank, foo1, foo2. Now, SomeEntity has several rows if when we're speaking strictly in SQL terms. What I'm trying to accomplish is to retrieve only available types, even though each instance can have duplicate types. I also need them returned in order according to rank. So in SQL, what I'm looking for is the following: SELECT DISTINCT(type) ORDER BY rank ASC Here is the code I have so far that's breaking: NSError *error = NULL; NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; [fetchRequest setReturnsDistinctResults:YES]; [fetchRequest setPropertiesToFetch:[NSArray arrayWithObjects:@"type", @"rank", nil]]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SomeEntity" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // sort by rank NSSortDescriptor *rankDescriptor = [[NSSortDescriptor alloc] initWithKey:@"rank" ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:rankDescriptor,nil]; [fetchRequest setSortDescriptors:sortDescriptors]; [sortDescriptors release]; [rankDescriptor release]; NSArray *fetchResults = [managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; return fetchResults; Right now that is crashing with the following: Invalid keypath section passed to setPropertiesToFetch:

  Read the article

• How do you calculate div and mod of floating point numbers?

  - by boost

  In Perl, the % operator seems to assume integers. For instance: sub foo { my $n1 = shift; my $n2 = shift; print "perl's mod=" . $n1 % $n2, "\n"; my $res = $n1 / $n2; my $t = int($res); print "my div=$t", "\n"; $res = $res - $t; $res = $res * $n2; print "my mod=" . $res . "\n\n"; } foo( 3044.952963, 7.1 ); foo( 3044.952963, -7.1 ); foo( -3044.952963, 7.1 ); foo( -3044.952963, -7.1 ); gives perl's mod=6 my div=428 my mod=6.15296300000033 perl's mod=-1 my div=-428 my mod=6.15296300000033 perl's mod=1 my div=-428 my mod=-6.15296300000033 perl's mod=-6 my div=428 my mod=-6.15296300000033 Now as you can see, I've come up with a "solution" already for calculating div and mod. However, what I don't understand is what effect the sign of each argument should have on the result. Wouldn't the div always be positive, being the number of times n2 fits into n1? How's the arithmetic supposed to work in this situation?

  Read the article

• Returning JSON from JavaScript to Python

  - by Chris Lacy

  I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

  Read the article

• Java: Typecasting to Generics

  - by bguiz

  This method that uses method-level generics, that parses the values from a custom POJO, JXlistOfKeyValuePairs (which is exactly that). The only thing is that both the keys and values in JXlistOfKeyValuePairs are Strings. This method wants to taken in, in addition to the JXlistOfKeyValuePairs instance, a Class<T> that defines which data type to convert the values to (assume that only Boolean, Integer and Float are possible). It then outputs a HashMap with the specified type for the values in its entries. This is the code that I have got, and it is obviously broken. private <T extends Object> Map<String, T> fromListOfKeyValuePairs(JXlistOfKeyValuePairs jxval, Class<T> clasz) { Map<String, T> val = new HashMap<String, T>(); List<Entry> jxents = jxval.getEntry(); T value; String str; for (Entry jxent : jxents) { str = jxent.getValue(); value = null; if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } else if (clasz.isAssignableFrom(Float.class)) { value = (T)(Float.parseFloat(str)); } else { logger.warn("Unsupported value type encountered in key-value pairs, continuing anyway: " + clasz.getName()); } val.put(jxent.getKey(), value); } return val; } This is the bit that I want to solve: if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } I get: Inconvertible types required: T found: Boolean Also, if possible, I would like to be able to do this with more elegant code, avoiding Class#isAssignableFrom. Any suggestions? Sample method invocation: Map<String, Boolean> foo = fromListOfKeyValuePairs(bar, Boolean.class);

  Read the article

• Scalability 101: How can I design a scalable web application using PHP?

  - by Legend

  I am building a web-application and have a couple of quick questions. From what I learnt, one should not worry about scalability when initially building the app and should only start worrying when the traffic increases. However, this being my first web-application, I am not quite sure if I should take an approach where I design things in an ad-hoc manner and later "fix" them. I have been reading stories about how people start off with an app that gets millions of users in a week or two. Not that I will face the same situation but I can't help but wonder, how do these people do it? Currently, I bought a shared hosting account on Lunarpages and that got me started in building and testing the application. However, I am interested in learning how to build the same application in a scalable-manner using the cloud, for instance, Amazon's EC2. From my understanding, I can see a couple of components: There is a load balancer that first receives requests and then decides where to route each request This request is then handled by a server replica that then processes the request and updates (if required) the database and sends back the response to the client If a similar request comes in, then a caching mechanism like memcached kicks into picture and returns objects from the cache A blackbox that handles database replication Specifically, I am trying to do the following: Setting up a load balancer (my homework revealed that HAProxy is one such load balancer) Setting up replication so that databases can be synchronized Using memcached Configuring Apache to work with multiple web servers Partitioning application to use Amazon EC2 and Amazon S3 (my application is something that will need great deal of storage) Finally, how can I avoid burning myself when using Amazon services? Because this is just a learning phase, I can probably do with 2-3 servers with a simple load balancer and replication but until I want to avoid paying loads of money accidentally. I am able to find resources on individual topics but am unable to find something that starts off from the big picture. Can someone please help me get started?

  Read the article

• Using external SOAP service in Workflow service

  - by whirlwin

  I am using the .NET 4 framework and have made a WCF Workflow Service Application. I want to use a SOAP web service (.NET 3.5) I have running in another instance of VS. The only method that is exposed is the following: [WebMethod] public string Reverse(string input) { char[] chars = input.ToCharArray(); Array.Reverse(chars); return new string(chars); } I have used the following steps to add the service in my Workflow: Add Service Reference Provided the WSDL (the operation shows in the Operations box as expected) Clicked OK Build the solution to ensure that the service shows in my toolbox Drag the service from the toolbox into the workflow However, when I look at the properties of the service in the workflow, there is no way to specify the input argument or where to store the result of the invocation of the service. I only have the option of specifying some obscure parameters such as Body:InArgument<ReverseRequestBody and outBody:OutArgument<ReverseResponseBody (none of which are strings). Here is a screenshot depicting the properties of the service in the workflow: My question is therefore: Is it possible at all to use the SOAP service by specifying a string as the input argument (like it is meant to be used), and also assign the result to a workflow variable?

  Read the article

• How to handle window closed in the middle of a long running operation gracefully?

  - by Marek

  We have the following method called directly from the UI thread: void DoLengthyProcessing() { DoStuff(); var items = DoMoreStuff(); //do even more stuff - 200 lines of code trimmed this.someControl.PrepareForBigThing(); //someControl is a big user control //additional 100 lines of code that access this.someControl this.someControl.Finish(items); } Many of the called methods call Application.DoEvents() (and they do so many times) (do not ask me why, this is black magic written by black magic programmers and it can not be changed because everyone is scared what the impact would be) and there is also an operation running on a background thread involved in the processing. As a result, the window is not fully nonresponsive and can be closed manually during the processing. The Dispose method of the form "releases" the someControl variable by setting it to null. As a result, in case the user closes the window during the lengthy process, a null reference exception is thrown. How to handle this gracefully without just catching and logging the exception caused by disposal? Assigning the someControl instance to a temporary variable in the beginning of the method - but the control contains many subcontrols with similar disposal scheme - sets them to null and this causes null reference exceptions in other place put if (this.IsDisposed) return; calls before every access of the someControl variable. - making the already nasty long method even longer and unreadable. in Closing event, just indicate that we should close and only hide the window. Dispose it at the end of the lengthy operation. This is not very viable because there are many other methods involved (think 20K LOC for a single control) that would need to handle this mechanism as well. How to most effectively handle window disposal (by user action) in the middle of this kind of processing?

  Read the article

• c# template member functions

  - by user3730583

  How can I define a template member function in C# For instance I will fill any collection which supports an Add(...) member function, please check out the sample code below public class CInternalCollection { public static void ExternalCollectionTryOne<T<int>>(ref T<int> ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } public static void ExternalCollectionTryTwo<T>(ref T ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; } The ExternalCollectionTryOne<...(...) would be the preferred kind, because the int type can be explicit defined, but results in an error: Type parameter declaration must be an identifier not a type The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) The ExternalCollectionTryTwo<...(...) results in an error: 'T' does not contain a definition for 'Add' and no extension method 'Add' accepting a first argument of type 'T' could be found (are you missing a using directive or an assembly reference?)... I hope the problem is clear – any suggestions? ----------------------------- edit -------------------------- The answers with the interface ICollection<.. without a template member works fine and thanks all for this hint, but I still cannot define successfully a member template(generic) function So a more simpler example ... how can I define this public class CAddCollectionValues { public static void AddInt<T>(ref T number, int selection) { T new_T = new T(); //this line is just an easy demonstration to get a compile error with type T foreach (int i_value in m_int_col) { if (i_value > selection) number += i_value; //again the type T cannot be used } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; }

  Read the article

• SQL Server 2008 Stored Proc suddenly returns -1

  - by aaginor

  I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

  Read the article

• Injecting the application TransactionManager into a JPA EntityListener

  - by nodje

  I want to use the JPA EntityListener to support spring security ACLs. On @PostPersist events, I create a permission corresponding to the persisted entity. I need this operation to participate to the current Transaction. For this to happen I need to have a reference to the application TransactionManager in the EntityListener. The problem is, Spring can't manage the EntityListener as it is created automatically when EntityManagerFactory is instantiated. And in a classic Spring app, the EntityManagerFactory is itself created during the TransactioManager instantiation. <bean id="transactionManager" class="org.springframework.orm.jpa.JpaTransactionManager"> <property name="entityManagerFactory" ref="entityManagerFactory" /> </bean> So I have no way to inject the TransactionManager with the constructor, as it is not yet instantiated. Making the EntityManager a @Component create another instance of the EntityManager. Implementing InitiliazingBean and using afterPropertySet() doesn't work as it's not a Spring managed bean. Any idea would be helpful as I'm stuck and out of ideas.

  Read the article

• jqtouch - panels appear on page, class="back" not working in Safari

  - by user564816

  I'm trying to get a demo working that was used in J. Stark's webinar on Safari Books Online (still available for viewing). I think I've followed the code example correctly, but the class="back" objects used to return from the "blog", "contacts", "settings" and "about" panels do not work, though the correct address shows in the nav area at the base of the browser window when I hover the mouse over the respective link. The panels-- which should slide in and out when called by their respective class"arrow" elements-- appear on the main page, nor do they animate correctly. Browser is Safari 5.0.3(6533.19.4); jquery-1.3.2; jqtouch freshly downloaded from the jqt website. Obviously I'm missing something simple. I'd sincerely appreciate anyone's help who sees what I'm doing wrong. Thanks for considering my question. View the app and source code (use view source in your browser) here. Sat 8 January 2011: 1 48 AM UPDATE in response to JS's comments: Most humble thanks for your note. Didn't want to impose on your server, so the URL for jqtouch.min.css points to a version on my server @ fastermac.net. There's something further amiss, I believe. On load, page still shows the elements that should be invisible until called by clicking class="arrow" elements. Animations not yet wiggling. Did get them to wiggle at one point, but "flip," for instance, landed then on a black page-- not the targeted panel. Probably something obvious, but I'm missing it after some considerable due diligence. Again, thanks for your note. Any further illumination would be sincerely appreciated.

  Read the article

• WP7 - Cancelling ContextMenu click event propagation

  - by Praetorian

  I'm having a problem when the Silverlight toolkit's ContextMenu is clicked while it is over a UIElement that has registered a Tap event GestureListener. The context menu click propagates to the underlying element and fires its tap event. For instance, say I have a ListBox and each ListBoxItem within it has registered both a ContextMenu and a Tap GestureListener. Assume that clicking context menu item2 is supposed to take you to Page1.xaml, while tapping on any of ListBox items themselves is supposed to take you to Page2.xaml. If I open the context menu on item1 in the ListBox, then context menu item2 is on top of ListBox item2. When I click on context menu item2 I get weird behavior where the app navigates to Page1.xaml and then immediately to Page2.xaml because the click event also triggered the Tap gesture for ListBox item2. I've verified in the debugger that it is always the context menu that receives the click event first. How do I cancel the context menu item click's routed event propagation so it doesn't reach ListBox item2? Thanks for your help!

  Read the article

• NullReferenceExeption when reading from a file

  - by Whitey

  I need to read a file structured like this: 01000 00030 00500 03000 00020 And put it in an array like this: int[,] iMap = new int[iMapHeight, iMapWidth] { {0, 1, 0, 0, 0}, {0, 0, 0, 3, 0}, {0, 0, 5, 0, 0}, {0, 3, 0, 0, 0}, {0, 0, 0, 2, 0}, }; Hopefully you see what I'm trying to do here. I was confused how to do this so I asked here on SO, but the code I got from it gets this error: Object reference not set to an instance of an object. I'm pretty new to this so I have no idea how to fix it... I only barely know the code: protected void ReadMap(string mapPath) { using (var reader = new StreamReader(mapPath)) { for (int i = 0; i < iMapHeight; i++) { string line = reader.ReadLine(); for (int j = 0; j < iMapWidth; j++) { iMap[i, j] = (int)(line[j] - '0'); } } } } The line I get the error on is this: iMap[i, j] = (int)(line[j] - '0'); Can anyone provide a solution? Thank you. :)

  Read the article

< Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >