Search Results

Search found 12793 results on 512 pages for 'format specifiers'.

Page 471/512 | < Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >

  • How can I create the XML::Simple data structure using a Perl XML SAX parser?

    - by DVK
    Summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog—due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. I'm looking for an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been. I don't care much what the interface of the new module is; e.g whether I need to call next_record() or give it a callback coderef accepting a record.

    Read the article

  • How do I return clean JSON from a WCF Service?

    - by user208662
    I am trying to return some JSON from a WCF service. This service simply returns some content from my database. I can get the data. However, I am concerned about the format of my JSON. Currently, the JSON that gets returned is formatted like this: {"d":"[{\"Age\":35,\"FirstName\":\"Peyton\",\"LastName\":\"Manning\"},{\"Age\":31,\"FirstName\":\"Drew\",\"LastName\":\"Brees\"},{\"Age\":29,\"FirstName\":\"Tony\",\"LastName\":\"Romo\"}]"} In reality, I would like my JSON to be formatted as cleanly as possible. I believe (I may be incorrect), that the same collection of results, represented in clean JSON, should look like so: [{"Age":35,"FirstName":"Peyton","LastName":"Manning"},{"Age":31,"FirstName":"Drew","LastName":"Brees"},{"Age":29,"FirstName":"Tony","LastName":"Romo"}] I have no idea where the “d” is coming from. I also have no clue why the escape characters are being inserted. My entity looks like the following: [DataContract] public class Person { [DataMember] public string FirstName { get; set; } [DataMember] public string LastName { get; set; } [DataMember] public int Age { get; set; } public Person(string firstName, string lastName, int age) { this.FirstName = firstName; this.LastName = lastName; this.Age = age; } } The service that is responsible for returning the content is defined as: [ServiceContract(Namespace = "")] [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.Allowed)] public class TestService { [OperationContract] [WebGet(ResponseFormat = WebMessageFormat.Json)] public string GetResults() { List<Person> results = new List<Person>(); results.Add(new Person("Peyton", "Manning", 35)); results.Add(new Person("Drew", "Brees", 31)); results.Add(new Person("Tony", "Romo", 29)); // Serialize the results as JSON DataContractJsonSerializer serializer = new DataContractJsonSerializer(results.GetType()); MemoryStream memoryStream = new MemoryStream(); serializer.WriteObject(memoryStream, results); // Return the results serialized as JSON string json = Encoding.Default.GetString(memoryStream.ToArray()); return json; } } How do I return “clean” JSON from a WCF service? Thank you!

    Read the article

  • Xpath expression to retrieve oldest/earliest node

    - by gkrogers
    I have an XML snippet, so: <STATES> <STATE> <NAME>Alabama</NAME> <ABBREVIATION>AL</ABBREVIATION> <CAPITAL>Montgomery</CAPITAL> <POPULATION>4661900</POPULATION> <AREA>52419</AREA> <DATEOFSTATEHOOD>14 December 1819</DATEOFSTATEHOOD> </STATE> <STATE> <NAME>Alaska</NAME> <ABBREVIATION>AK</ABBREVIATION> <CAPITAL>Juneau</CAPITAL> <POPULATION>698473</POPULATION> <AREA>663268</AREA> <DATEOFSTATEHOOD>1 January 1959</DATEOFSTATEHOOD> </STATE> <STATE> <NAME>Delaware</NAME> <ABBREVIATION>DE</ABBREVIATION> <CAPITAL>Dover</CAPITAL> <POPULATION>885122</POPULATION> <AREA>2490</AREA> <DATEOFSTATEHOOD>7 December 1787</DATEOFSTATEHOOD> </STATE> </STATES> <etc, etc.> I want to retrieve (for example) the capital of the oldest state (i.e. "Dover"). I have managed to get this far: //STATES/STATE[DATEOFSTATEHOOD='7 December 1787']/CAPITAL/text() but can't figure out how to say 'DATEOFSTATEHOOD={the earliest DATEOFSTATEHOOD}'. Can anybody point me in the right direction, please? SOLUTION: Matt's solution is more or less spot on. I had to reformat the dates (I used YYYYMMDDD) because, as was pointed out, Xpath 1.0 doesn't support the date format I was using. Also, Microsoft's XML library (4.0 and 6.0) returned the whole node list with Matt's expression. Reversing the test fixed that problem, making it return just the earliest node. So: //STATES/STATE[(DATEOFSTATEHOOD < //STATES/STATE/DATEOFSTATEHOOD)]/CAPITAL/text()

    Read the article

  • angular-ui-router : breadcrumps ok but view ko

    - by anakin59490
    this is my app.router.js : agentRouter.config([ '$stateProvider', '$urlRouterProvider', function($stateProvider, $urlRouterProvider) { var root = { name: 'root', abstract: true, url: '', title: 'home', views: { 'header': { templateUrl: 'views/headers/header.app.html', controller: 'HeaderCtrl' }, 'body': { templateUrl: "views/root.html" }, 'footer': { templateUrl: 'views/footers/footer.app.html' } } }; var agent = { name: 'root.agent', url: '/agent', title: 'agent', views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.container.html" } } }; var detail = { name: 'root.agent.detail', url: '/detail/:id', title: 'agentDetail', // use for breadcrumb views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.chantier.html" } } }; /.../ $stateProvider.state(root); $stateProvider.state(agent); $stateProvider.state(detail); } ]); and this is my root.html : <!--Breadcrumb content--> <ul class="row breadcrumb"> <i class="glyphicon glyphicon-home" style=""></i> <li ng-repeat="state in $state.$current.path"> <a ng-href="#{{state.url.format($stateParams)}}"><span ng-bind="state.title"></span></a> <span ng-hide="$last" class=""></span> </li> </ul> <!--Sidebar content--> <div ui-view="root.sidebar">default root.sidebar</div> <!--Container content--> <div style="background-color: #f9f9f9" ui-view="root.container">default root.container</div> I can access to my "agent" page (a list of person) and my breadcrumb is right : home / agent but when i click on an item of the list i got always the same page but my breadcrumb is right : home / agent / agentDetail but in app.router.js if change detail like this : var detail = { name: 'root.detail', // référence initiale + detail (fils) url: '/agent/detail/:id', // réference utilisée dans les fichiers HTML, attention c'est la suite de l'url précédente!!! title: 'agentDetail', // référence utilisée pour le breadcump views: { 'root.sidebar': { templateUrl: "views/main.sidebar.html" }, 'root.container': { templateUrl: "views/partials/agent/list.chantier.html" } } }; i got the right page (list.chantier.xml) but the breadcrumb is false : home / agentDetail instead of home / agent / agentDetail I would like to got the right breadcrumb (home / agent / agentDetail) with the right page (list.chantier.html) when i click on an item of the agent list page (list.container.html) Thank you in advance for your help

    Read the article

  • How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

    - by warvair
    I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

    Read the article

  • Why won't C# accept a (seemingly) perfectly good Sql Server CE Query?

    - by VoidKing
    By perfectly good sql query, I mean to say that, inside WebMatrix, if I execute the following query, it works to perfection: SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER('o'), ''))) / len('o') AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%o%' UNION SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER('o'), ''))) / len('o') AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%o%' UNION SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER('o'), ''))) / len('o') AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%o%' Here i am using 'o' as a static search string to search upon. No problem, but not exeactly very dynamic. Now, when I write this query as a string in C# and as I think it should be (and even as I have done before) I get a server-side error indicating that the string was not in the correct format. Here is a pic of that error: And (although I am only testing the output, should I get it to quit erring), here is the actual C# (i.e., the .cshtml) page that queries the database: @{ Layout = "~/Layouts/_secondaryMainLayout.cshtml"; var db = Database.Open("Content"); string searchText = Request.Unvalidated["searchText"]; string selectQueryString = "SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER(@0), ''))) / len(@0) AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%' + @0 + '%'"; @:beginning <br/> foreach (var row in db.Query(selectQueryString, searchText)) { @:entry @:@row.location &nbsp; @:@row.occurences &nbsp; @:@row.tableName <br/> } } Since it is erring on the foreach (var row in db.Query(selectQueryString, searchText)) line, that heavily suggests that something is wrong with my query, however, everything seems right to me about the syntax here and it even executes to perfection if I query the database (mind you, un-parameterized) directly. Logically, I would assume that I have erred somewhere with the syntax involved in parameterizing this query, however, my double and triple checking (as well as, my past experience at doing this) insists that everything looks fine here. Have I messed up the syntax involved with parameterizing this query, or is something else at play here that I am overlooking? I know I can tell you, for sure, as it has been previously tested, that the value I am getting from the query string is, indeed, what I would expect it to be, but as there really isn't much else on the .cshtml page yet, that is about all I can tell you.

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • iPhone Image Resources, ICO vs PNG, app bundle filesize

    - by Jasarien
    My application has a collection of around 1940 icons that are used throughout. They're currently in ICO and new images provided to me come in ICO format too. I have noticed that they contain a 16x16 and 32x32 representation of each icon in one file. Each file is roughly 4KB in filesize (as reported by finder, but ls reports that they vary from being ~1000 bytes to 5000 bytes) A very small number of these icons only contain the 32x32 representation, and as a result are only around 700 bytes in size. Currently I am bundling these icons with my application and they are inflating the size of the app a bit more than I would like. Altogether, the images total just about 25.5MB. Xcode must do some kind of compression because the resulting app bundle is about 12.4MB. Compressing this further into a ZIP (as it would be when submitted to the App Store), results in a final file of 5.8MB. I'm aware that the maximum limit for over the air App Store downloads has been raised to 20MB since the introduction of the iPad (I'm not sure if that extends to iPhone apps as well as iPad apps though, if not the limit would be 10MB). My worry is that new icons are going to be added (sometimes up to 10 icons per week), and will continue to inflate the app bundle over time. What is the best way to distribute these icons with my app? Things I've tried and not had much success with: Converting the icons from ICO to PNG: I tried this in the hopes that the pngcrush utility would help out with the filesize. But it appears that it doesn't make much of a difference between a normal PNG and a crushed png (I believe it just optimises the image for display on the iPhone's GPU rather than compress it's size). Also in going from ICO to PNG actually increased the size of the icon file... Zipping the images, and then uncompressing them on first run. While this did reduce the overall image sizes, I found that the effort needed to unzip them, copy them to the documents folder and ensure that duplication doesn't happen on upgrades was too much hassle to be worth the benefit. Also, on original and 3G iPhones unzipping and copying around 25MB of images takes too long and creates a bad experience... Things I've considered but not yet tried: Instead of distributing the icons within the app bundle, host them online, and download each icon on demand (it depends on the user's data as to which icons will actually be displayed and when). Issues with this is that bandwidth costs money, and image downloads will be bandwidth intensive. However, my app currently has a small userbase of around 5,500 users (of which I estimate around 1500 to be active based on Flurry stats), and I have a huge unused bandwidth allowance with my current hosting package. So I'm open to thoughts on how to solve this tricky issue.

    Read the article

  • Parallel Task Library WaitAny Design

    - by colithium
    I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • Parsing Data in XML and Storing to DB in Python

    - by Rakesh
    Hi Guys i have problem parsing an xml file and entering the data to sqlite, the format is like i need to enter the chracters before the token like 111,AAA,BBB etc <DOCUMENT> <PAGE width="544.252" height="634.961" number="1" id="p1"> <MEDIABOX x1="0" y1="0" x2="544.252" y2="634.961"/> <BLOCK id="p1_b1"> <TEXT width="37.7" height="74.124" id="p1_t1" x="51.1" y="20.8652"> <TOKEN sid="p1_s11" id="p1_w1" font-name="Verdanae" bold="yes" italic="no">111</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b3"> <TEXT width="151.267" height="10.725" id="p1_t6" x="24.099" y="572.096"> <TOKEN sid="p1_s35" id="p1_w22" font-name="Verdanae" bold="yes" italic="yes">AAA</TOKEN> <TOKEN sid="p1_s36" id="p1_w23" font-name="verdanae" bold="yes" italic="no">BBB</TOKEN> <TOKEN sid="p1_s37" id="p1_w24" font-name="verdanae" bold="yes" italic="no">CCC</TOKEN> </TEXT> </BLOCK> <BLOCK id="p1_b4"> <TEXT width="82.72" height="26" id="p1_t7" x="55.426" y="138.026"> <TOKEN sid="p1_s42" id="p1_w29" font-name="verdanae" bold="yes" italic="no">DDD</TOKEN> <TOKEN sid="p1_s43" id="p1_w30" font-name="verdanae" bold="yes" italic="no">EEE</TOKEN> </TEXT> <TEXT width="101.74" height="26" id="p1_t8" x="55.406" y="162.026"> <TOKEN sid="p1_s45" id="p1_w31" font-name="verdanae" bold="yes" italic="no">FFF</TOKEN> </TEXT> <TEXT width="152.96" height="26" id="p1_t9" x="55.406" y="186.026"> <TOKEN sid="p1_s47" id="p1_w32" font-name="verdanae" bold="yes" italic="no">GGG</TOKEN> <TOKEN sid="p1_s48" id="p1_w33" font-name="verdanae" bold="yes" italic="no">HHH</TOKEN> </TEXT> </BLOCK> </PAGE> </DOCUMENT> in .net it is done with 3 foreach loops 1. for "DOCUMENT/PAGE/BLOCK" 2."TEXT" 3. "TOKEN" and then it is entered into the DB i dont get how to do it in python and i am trying it with lxml module

    Read the article

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Running a graph returns E_FAIL

    - by Manish
    Hi, I have been struggling for a while now to get my filter graph to run .I am trying to crop a .wmv file into smaller duration .wmv files .It looks quite a simple task I dont know why its is getting so complicated.I follow this Source- SampleGrabber-WMA sf writer. Here is my code IBaseFilter* pASFWriter; ICaptureGraphBuilder2 * pBuilder=NULL; CoCreateInstance(CLSID_CaptureGraphBuilder2,NULL,CLSCTX_INPROC_SERVER,IID_ICaptureGraphBuilder2,(LPVOID*)&pBuilder); pBuilder-SetFiltergraph(pGraphBuilder); pBuilder-SetOutputFileName(&MEDIASUBTYPE_Asf,OUTFILE,&pASFWriter,NULL); IConfigAsfWriter *pConfig=NULL; HRESULT hr80 = pASFWriter-QueryInterface(IID_IConfigAsfWriter, (void**)&pConfig); if (SUCCEEDED(hr80)) { // Configure the ASF Writer filter. pConfig-Release(); } IBaseFilter *pSource=NULL; pGraphBuilder->AddSourceFilter(FILENAME,L"Source",&pSource); IBaseFilter *pGrabberF2=NULL; ISampleGrabber *pGrabber2=NULL; CoCreateInstance(CLSID_SampleGrabber,NULL,CLSCTX_INPROC_SERVER,IID_PPV_ARGS(&pGrabberF2)); pGraphBuilder->AddFilter(pGrabberF2,L"Sample Grabber2"); AM_MEDIA_TYPE mt1; ZeroMemory(&mt1,sizeof(mt1)); mt1.majortype=MEDIATYPE_Video; mt1.subtype=MEDIASUBTYPE_RGB24; pGrabberF2->QueryInterface(IID_ISampleGrabber,(void**)(&pGrabber2)); pGrabber2->SetBufferSamples(TRUE); pGrabber2->SetOneShot(FALSE); pGrabber->SetMediaType(&mt1); pSource->EnumPins(&pEnum2); pEnum2->Next(1,&pPin2,NULL); HRESULT hr108=ConnectFilters(pGraphBuilder,pPin2,pGrabberF2);//Source to Grabber pGrabberF2->EnumPins(&pEnum3); IEnumPins *pEnum4=NULL; pASFWriter->EnumPins(&pEnum4); IPin* pPin4=NULL; while (S_OK==pEnum3->Next(1,&pPin3,NULL)&& S_OK==pEnum4->Next(1,&pPin4,NULL)){ pGraphBuilder->Connect(pPin3,pPin4);//Grabber to FileWriter } pGraphBuilder->RenderFile(FILENAME,NULL);//FILENAME=INPUTFILENAME (.wmv format) pMediaPosition->put_CurrentPosition(start); pMediaPosition->put_StopTime(stop); HRESULT test1=pMediaControl->Run(); All of it runs fine(returns S_OK) .But test1 returns E_FAIL and no file is created.Can somebody help?

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

< Previous Page | 467 468 469 470 471 472 473 474 475 476 477 478  | Next Page >