Search Results

Search found 12793 results on 512 pages for 'format specifiers'.

Page 472/512 | < Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MATLAB image corner coordinates & referncing to cell arrays

    - by James
    Hi, I am having some problems comparing the elements in different cell arrays. The context of this problem is that I am using the bwboundaries function in MATLAB to trace the outline of an image. The image is of a structural cross section and I am trying to find if there is continuity throughout the section (i.e. there is only one outline produced by the bwboundaries command). Having done this and found where the is more than one section traced (i.e. it is not continuous), I have used the cornermetric command to find the corners of each section. The code I have is: %% Define the structural section as a binary matrix (Image is an I-section with the web broken) bw(20:40,50:150) = 1; bw(160:180,50:150) = 1; bw(20:60,95:105) = 1; bw(140:180,95:105) = 1; Trace = bw; [B] = bwboundaries(Trace,'noholes'); %Traces the outer boundary of each section L = length(B); % Finds number of boundaries if L > 1 disp('Multiple boundaries') % States whether more than one boundary found end %% Obtain perimeter coordinates for k=1:length(B) %For all the boundaries perim = B{k}; %Obtains perimeter coordinates (as a 2D matrix) from the cell array end %% Find the corner positions C = cornermetric(bw); Areacorners = find(C == max(max(C))) % Finds the corner coordinates of each boundary [rowindexcorners,colindexcorners] = ind2sub(size(Newgeometry),Areacorners) % Convert corner coordinate indexes into subcripts, to give x & y coordinates (i.e. the same format as B gives) %% Put these corner coordinates into a cell array Cornerscellarray = cell(length(rowindexcorners),1); % Initialises cell array of zeros for i =1:numel(rowindexcorners) Cornerscellarray(i) = {[rowindexcorners(i) colindexcorners(i)]}; %Assigns the corner indicies into the cell array %This is done so the cell arrays can be compared end for k=1:length(B) %For all the boundaries found perim = B{k}; %Obtains coordinates for each perimeter Z = perim; % Initialise the matrix containing the perimeter corners Sectioncellmatrix = cell(length(rowindexcorners),1); for i =1:length(perim) Sectioncellmatrix(i) = {[perim(i,1) perim(i,2)]}; end for i = 1:length(perim) if Sectioncellmatrix(i) ~= Cornerscellarray Sectioncellmatrix(i) = []; %Gets rid of the elements that are not corners, but keeps them associated with the relevent section end end end This creates an error in the last for loop. Is there a way I can check whether each cell of the array (containing an x and y coordinate) is equal to any pair of coordinates in cornercellarray? I know it is possible with matrices to compare whether a certain element matches any of the elements in another matrix. I want to be able to do the same here, but for the pair of coordinates within the cell array. The reason I don't just use the cornercellarray cell array itself, is because this lists all the corner coordinates and does not associate them with a specific traced boundary.

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Why do I get a WCF timeout even though my service call and callback are successful?

    - by KallDrexx
    I'm playing around with hooking up an in-game console to a WCF interface, so an external application can send console commands and receive console output. To accomplish this I created the following service contracts: public interface IConsoleNetworkCallbacks { [OperationContract(IsOneWay = true)] void NewOutput(IEnumerable<string> text, string category); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(IConsoleNetworkCallbacks))] public interface IConsoleInterface { [OperationContract] void ProcessInput(string input); [OperationContract] void ChangeCategory(string category); } On the server I implemented it with: public class ConsoleNetworkInterface : IConsoleInterface, IDisposable { public ConsoleNetworkInterface() { ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler); } public void Dispose() { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); } public void ProcessInput(string input) { ConsoleManager.Instance.ProcessInput(input); } public void ChangeCategory(string category) { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler, category); } protected void OutputHandler(IEnumerable<string> text, string category) { var callbacks = OperationContext.Current.GetCallbackChannel<IConsoleNetworkCallbacks>(); callbacks.NewOutput(text, category); } } On the client I implemented the callback with: public class Callbacks : IConsoleNetworkCallbacks { public void NewOutput(IEnumerable<string> text, string category) { MessageBox.Show(string.Format("{0} lines received for '{1}' category", text.Count(), category)); } } Finally, I establish the service host with the following class: public class ConsoleServiceHost : IDisposable { protected ServiceHost _host; public ConsoleServiceHost() { _host = new ServiceHost(typeof(ConsoleNetworkInterface), new Uri[] { new Uri("net.pipe://localhost") }); _host.AddServiceEndpoint(typeof(IConsoleInterface), new NetNamedPipeBinding(), "FrbConsolePipe"); _host.Open(); } public void Dispose() { _host.Close(); } } and use the following code on my client to establish the connection: protected Callbacks _callbacks; protected IConsoleInterface _proxy; protected void ConnectToConsoleServer() { _callbacks = new Callbacks(); var factory = new DuplexChannelFactory<IConsoleInterface>(_callbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/FrbConsolePipe")); _proxy = factory.CreateChannel(); _proxy.ProcessInput("Connected"); } So what happens is that my ConnectToConsoleServer() is called and then it gets all the way to _proxy.ProcessInput("Connected");. In my game (on the server) I immediately see the output caused by the ProcessInput call, but the client is still stalled on the _proxy.ProcessInput() call. After a minute my client gets a JIT TimeoutException however at the same time my MessageBox message appears. So obviously not only is my command being sent immediately, my callback is being correctly called. So why am I getting a timeout exception? Note: Even removing the MessageBox call, I still have this issue, so it's not an issue of the GUI blocking the callback response.

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • How can call a JQuery function when it in side the from view (asp.net control)?

    - by ricky roy
    Hi, All I have a Span in side the Form view. I wanted to Call a Jquery Fucntion when the from load how can i do this? Thanks Waiting for your reply here is my code <asp:FormView ID="FormView1" runat="server" OnItemCommand="FormView1_ItemCommand"> <ItemTemplate> <asp:HiddenField ID="hidProductID" Value='<%#Eval("ProductID") %>' runat="server" /> <asp:HiddenField ID="hidCustomerID" Value='<%#Eval("CustomerID") %>' runat="server" /> <a href='<%=WinToSave.SettingsConstants.SiteURL%>WintoSave/AuctionProduct.aspx?id=<%#Eval("ProductID") %>'> <%#Eval("ProductName")%> </a> <br /> <img src='<%#Eval("ImagePath")%>' alt="Image No available" /> <br /> <asp:Label ID="lblTime" runat="server" Text='<%#Convert.ToDateTime(Eval("ModifiedOn")).ToString("hh:mm:ss") %>'></asp:Label> <span id='Countdown_<%#Eval("ProductID") %>' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%>','Countdown_<%#Eval("ProductID") %>');"></span> <br /> <asp:Label ID="lblFinalPrice" runat="server" Text='<%#Convert.ToDouble(Eval("FinalPrice")).ToString("#.00")%>'></asp:Label> <br /> <asp:Label ID="lblFullName" runat="server" Text='<%#Eval("FullName") %>'></asp:Label> <br /> <asp:Button ID="btnAddbid" Text="Bid" CommandName="AddBid" CommandArgument='<%#Eval("ID")%>' runat="server" /> </ItemTemplate> </asp:FormView> and following is my jquery code function GetTimeOnLoad(shortly,DivID) { var dt = new Date(shortly); alert(dt); alert(shortly); alert(DivID); var ProductDivID = "#" +DivID; alert(ProductDivID); $(ProductDivID).countdown({ until: dt, onExpiry: liftOff, onTick: watchCountdown, format: 'HMS', layout: '{hnn}{sep}{mnn}{sep}{snn}' }); } function liftOff(){}; function watchCountdown(){}; In above code I Used ' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%','Countdown_<%#Eval("ProductID") %');" but is not working

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • ASP.Net / MySQL : Translating content into several languages

    - by philwilks
    I have an ASP.Net website which uses a MySQL database for the back end. The website is an English e-commerce system, and we are looking at the possibility of translating it into about five other languages (French, Spanish etc). We will be getting human translators to perform the translation - we've looked at automated services but these aren't good enough. The static text on the site (e.g. headings, buttons etc) can easily be served up in multiple languages via .Net's built in localization features (resx files etc). The thing that I'm not so sure about it how best to store and retrieve the multi-language content in the database. For example, there is a products table that includes these fields... productId (int) categoryId (int) title (varchar) summary (varchar) description (text) features (text) The title, summary, description and features text would need to be available in all the different languages. Here are the two options that I've come up with... Create additional field for each language For example we could have titleEn, titleFr, titleEs etc for all the languages, and repeat this for all text columns. We would then adapt our code to use the appropriate field depending on the language selected. This feels a bit hacky, and also would lead to some very large tables. Also, if we wanted to add additional languages in the future it would be time consuming to add even more columns. Use a lookup table We could create a new table with the following format... textId | languageId | content ------------------------------- 10 | EN | Car 10 | FR | Voiture 10 | ES | Coche 11 | EN | Bike 11 | FR | Vélo We'd then adapt our products table to reference the appropriate textId for the title, summary, description and features instead of having the text stored in the product table. This seems much more elegant, but I can't think of a simple way of getting this data out of the database and onto the page without using complex SQL statements. Of course adding new languages in the future would be very simple compared to the previous option. I'd be very grateful for any suggestions about the best way to achieve this! Is there any "best practice" guidance out there? Has anyone done this before?

    Read the article

  • populate CoreData data model from JSON files prior to app start

    - by johannes_d
    I am creating an iPad App that displays data I got from an API in JSON format. My Core Data model has several entities(Countries, Events, Talks, ...). For each entity I have one .json file that contains all instances of the entity and its attributes as well as its relationships. I would like to populate my Core Data data model with these entities before the start of the App (otherwise it takes about 15 minutes for the iPad to create all the instances of the entities from the several JSON files using factory methods). I am currently importing the data into CoreData like this: -(void)fetchDataIntoDocument:(UIManagedDocument *)document { dispatch_queue_t dataQ = dispatch_queue_create("Data import", NULL); dispatch_async(dataQ, ^{ //Fetching data from application bundle NSURL *tedxgroupsurl = [[NSBundle mainBundle] URLForResource:@"contries" withExtension:@"json"]; NSURL *tedxeventsurl = [[NSBundle mainBundle] URLForResource:@"events" withExtension:@"json"]; //converting the JSON files to NSDictionaries NSError *error = nil; NSDictionary *countries = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:countriesurl] options:kNilOptions error:&error]; countries = [countries objectForKey:@"countries"]; NSDictionary *events = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:eventsurl] options:kNilOptions error:&error]; events = [events objectForKey:@"events"]; //creating entities using factory methods in NSManagedObject Subclasses (Country / Event) [document.managedObjectContext performBlock:^{ NSLog(@"creating countries"); for (NSDictionary *country in countries) { [Country countryWithCountryInfo:country inManagedObjectContext:document.managedObjectContext]; //creating Country entities } NSLog(@"creating events"); for (NSDictionary *event in events) { [Event eventWithEventInfo:event inManagedObjectContext:document.managedObjectContext]; // creating Event entities } NSLog(@"done creating, saving document"); [document saveToURL:document.fileURL forSaveOperation:UIDocumentSaveForOverwriting completionHandler:NULL]; }]; }); dispatch_release(dataQ); } This combines the different JSON files into one UIManagedDocument which i can then perform fetchRequests on to populate tableViews, mapView, etc. I'm looking for a way to create this document outside my application & add it to the mainBundle. Then I could copy it once to the apps DocumentsDirectory and be able I use it (instead of creating the Document within the app from the original JSON files). Any help is appreciated!

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Converting a list into a select with jquery

    - by Davemof
    I'm trying to convert the following list into a select list so it can be submitted via a form - the element within the lists will become the value of each option: <ul class="selected connected-list ui-sortable" style="height: 279px;"> <li class="ui-helper-hidden-accessible" style=""></li> <li title="Owner Name 1 - " class="ui-state-default ui-element ui-draggable" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon-arrowthick-2-n-s ui-icon"></span>Owner Name 1 - <em class="thenumber">4.4796E+11</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> <li title="David Moffat - " class="ui-state-default ui-element" style="display: block; position: relative; top: 0px; left: 0px;"><span class="ui-icon ui-icon-arrowthick-2-n-s"></span>David Moffat - <em class="thenumber">07730423005</em><a class="action" href="#"><span class="ui-corner-all ui-icon ui-icon-minus"></span></a></li> </ul> This should convert to the following format: <select style="display:none" class="selectoption" name="p_num[]" multiple="multiple"> <option value="">4.4796E+11</option> <option value="">07730423007</option> </select> I have tried the following jquery code, but after many hours I'm pulling my hair out: $('a.sendform').click(function(){ $('ul.selected').each(function() { var $select = $('<select />'); $(this).find('li').each(function() { var $option = $('<option />'); $option.attr('value', $(this).('em')).html($(this).html()); $select.append($option); }); $(this).replaceWith($select); }); }); Any help might save my remaining hair. Many thanks David

    Read the article

  • Internet Explorer 8 + Deflate

    - by Andreas Bonini
    I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

    Read the article

  • How to put Google adsense in iPhone application?

    - by oksk
    Hi all. I have a question about adsense. I want to put Google adsense in my application to be developed. But after testing my code, It wasn't shown. this is my code self.webView.userInteractionEnabled = NO; NSMutableString *manageableHTML = [[[NSMutableString alloc] init] autorelease]; [manageableHTML appendFormat:@"<html><head></head>"]; [manageableHTML appendFormat:@"<body>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\"><!--"]; [manageableHTML appendFormat:@"window.googleAfmcRequest = {"]; [manageableHTML appendFormat:@"client: 'ca-mb-pub-7564235160823935',"]; [manageableHTML appendFormat:@"ad_type: 'text_image',"]; [manageableHTML appendFormat:@"output: 'html',"]; [manageableHTML appendFormat:@"channel: '2052458338',"]; [manageableHTML appendFormat:@"format: '320x50_mb',"]; [manageableHTML appendFormat:@"oe: 'utf8',"]; [manageableHTML appendFormat:@"color_border: '336699',"]; [manageableHTML appendFormat:@"color_bg: 'FFFFFF',"]; [manageableHTML appendFormat:@"color_link: '0000FF',"]; [manageableHTML appendFormat:@"color_text: '000000',"]; [manageableHTML appendFormat:@"color_url: '008000',"]; [manageableHTML appendFormat:@"};"]; [manageableHTML appendFormat:@"//--></script>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\" "]; [manageableHTML appendFormat:@"src=\"http://pagead2.googlesyndication.com/pagead/show_afmc_ads.js\"></script>"]; [manageableHTML appendFormat:@"</body></html>"]; [self.webView loadHTMLString:manageableHTML baseURL:nil]; [self.view addSubview:self.webView]; Bofore testing, this javascript code are well operated in my google blog. I found that this code work at only mobile device. and I checked it through safari of my ipod touch. (It works well.) But Checking in the application, I don't see adsense. what is something wrong?

    Read the article

  • What are the steps to convert this function to a model/controller in Zend Framework?

    - by Joel
    Hi guys, I'm learning Zend Framework MVC, and I have a website that is mainly static php pages. However one of the pages is using functions, etc, and I'm trying to figure out what the process is for converting this to an OOP setup. Within the <body> I have this function (and more, but this is the first function): function filterEventDetails($contentText) { $data = array(); foreach($contentText as $row) { if(strstr($row, 'When: ')) { ##cleaning "when" string to get date in the format "May 28, 2009"## $data['duration'] = str_replace('When: ','',$row); list($when, ) = explode(' to ',$data['duration']); $data['when'] = substr($when,4); if(strlen($data['when'])>13) $data['when'] = trim(str_replace(strrchr($data['when'], ' '),'',$data['when'])); $data['duration'] = substr($data['duration'], 0, strlen($data['duration'])-4); //trimming time zone identifier (UTC etc.) } if(strstr($row, 'Where: ')) { $data['where'] = str_replace('Where: ','',$row); //pr($row); //$where = strstr($row, 'Where: '); //pr($where); } if(strstr($row, 'Event Description: ')) { $event_desc = str_replace('Event Description: ','',$row); //$event_desc = strstr($row, 'Event Description: '); ## Filtering event description and extracting venue, ticket urls etc from it. //$event_desc = str_replace('Event Description: ','',$contentText[3]); $event_desc_array = explode('|',$event_desc); array_walk($event_desc_array,'get_desc_second_part'); //pr($event_desc_array); $data['venue_url'] = $event_desc_array[0]; $data['details'] = $event_desc_array[1]; $data['tickets_url'] = $event_desc_array[2]; $data['tickets_button'] = $event_desc_array[3]; $data['facebook_url'] = $event_desc_array[4]; $data['facebook_icon'] = $event_desc_array[5]; } } return $data; } ?> So right now I have this in my example.phtml view page. I understand this needs to be a model and acted on by the controller, but I'm really not sure where to start with this conversion? This is a function tht is taking info from a Google calendar and parsing it for the view. Thanks for any help!

    Read the article

  • Action Cache for root URL not working

    - by askegg
    Here's the setup. I have web site which is essentially a simple CMS. Here is the routes file: map.connect ':url', :controller => :pages, :action => :show map.root :controller => :pages, :action => :show, :url => "/" The page controller is thus: class PagesController < ApplicationController before_filter :verify_access, :except => [:show] # Cache show action if we are not logged in. caches_action :show, :layout => false, :unless => Proc.new { |controller| controller.logged_in? } def update @page = Page.find(params[:id]) respond_to do |format| expire_action :action => :show, :url => @page.url So when a visitor hits "/" it maps to :controller = "pages, :action = "show, :url = "/". This generates a cached version on first try, then returns the appropriate result there after. The log files show: Processing PagesController#show (for 127.0.0.1 at 2009-08-02 14:15:01) [GET] Parameters: {"action"=>"show", "url"=>"/", "controller"=>"pages"} Cached fragment hit: views/out.local// (0.1ms) Rendering template within layouts/application Filter chain halted as [#<ActionController::Filters::AroundFilter:0x23eb03c @identifier=nil, @method=#<Proc:0x01904858@/Library/Ruby/Gems/1.8/gems/actionpack-2.3.3/lib/action_controller/caching/actions.rb:64>, @kind=:filter, @options={:only=>#<Set: {"show"}>, :if=>nil, :unless=>#<Proc:0x025137ac@/Users/askegg/Sites/out/app/controllers/pages_controller.rb:6>}>] did_not_yield. Completed in 2ms (View: 1, DB: 0) | 200 OK [http://out.local/] OK - all good so far. When I update the page, it should expire the cache (see above). The logs show: Page Load (0.2ms) SELECT * FROM "pages" WHERE ("pages"."id" = 3) Page Load (0.1ms) SELECT "pages".id FROM "pages" WHERE ("pages"."url" = '/' AND "pages".domain_id = 1 AND "pages".id <> 3) LIMIT 1 Expired fragment: views/out.local/index (0.1ms) Redirected to http://out.local/pages/3 Completed in 9ms (DB: 0) | 302 Found [http://out.local/pages/3] See the problem? Rails is clearing the cache named "index", but it sets it as "/". Naturally this results in the cache NOT being cleared, so visitors are now seeing the old version.

    Read the article

  • Jquery Autocomplete after space press

    - by Limpep
    I am having an issue with my auto-complete feature such as when a user presses the space button the auto-complete doesn't show up again. Here is my code script type="text/javascript"> function lookup(inputString) { if(inputString.length == 0) { // Hide the suggestion box. $('#suggestions').hide(); } else { $.post("autocomplete.php", { queryString: ""+inputString+"" }, function(data){ if(data.length >0) { $('#suggestions').show(); $('#autoSuggestionsList').html(data); } }); } } // lookup function fill(thisValue) { $('#tag').val(thisValue); setTimeout("$('#suggestions').hide();", 200); } here my php code <?php require_once('config.php'); $db = new mysqli(DB_HOST, DB_USER, DB_PASSWORD,DB_DATABASE); if(!$db) { // Show error if we cannot connect. echo 'ERROR: Could not connect to the database.'; } else { // Is there a posted query string? if(isset($_POST['queryString'])) { $queryString = $db->real_escape_string($_POST['queryString']); // Is the string length greater than 0? if(strlen($queryString) >0) { // Run the query: We use LIKE '$queryString%' // The percentage sign is a wild-card, in my example of countries it works like this... // $queryString = 'Uni'; // Returned data = 'United States, United Kindom'; $query = $db->query("SELECT name FROM tag WHERE name LIKE '$queryString%' ORDER BY name LIMIT 10"); if($query) { // While there are results loop through them - fetching an Object (i like PHP5 btw!). while ($result = $query ->fetch_object()) { // Format the results, im using <li> for the list, you can change it. // The onClick function fills the textbox with the result. echo '<li onClick="fill(\''.$result->name.'\');">'.$result->name.'</li>'; } } else { echo 'ERROR: There was a problem with the query.'; } } else { // Dont do anything. } // There is a queryString. } else { echo 'There should be no direct access to this script!'; } } ? Any help would be great, thanks.

    Read the article

  • OpenGL ES Polygon with Normals rendering (Note the 'ES!')

    - by MarqueIV
    Ok... imagine I have a relatively simple solid that has six distinct normals but actually has close to 48 faces (8 faces per direction) and there are a LOT of shared vertices between faces. What's the most efficient way to render that in OpenGL? I know I can place the vertices in an array, then use an index array to render them, but I have to keep breaking my rendering steps down to change the normals (i.e. set normal 1... render 8 faces... set normal 2... render 8 faces, etc.) Because of that I have to maintain an array of index arrays... one for each normal! Not good! The other way I can do it is to use separate normal and vertex arrays (or even interleave them) but that means I need to have a one-to-one ratio for normals to vertices and that means the normals would be duplicated 8 times more than they need to be! On something with a spherical or even curved surface, every normal most likely is different, but for this, it really seems like a waste of memory. In a perfect world I'd like to have my vertex and normal arrays have different lengths, then when I go to draw my triangles or quads To specify the index to each array for that vertex. Now the OBJ file format lets you specify exactly that... a vertex array and a normal array of different lengths, then when you specify the face you are rendering, you specify a vertex and a normal index (as well as a UV coord if you are using textures too) which seems like the perfect solution! 48 vertices but only 8 normals, then pairs of indexes defining the shapes' faces. But I'm not sure how to render that in OpenGL ES (again, note the 'ES'.) Currently I have to 'denormalize' (sorry for the SQL pun there) the normals back to a 1-to-1 with the vertex array, then render. Just wastes memory to me. Anyone help? I hope I'm missing something very simple here. Mark

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • How do you programmatically set a Style on a View?

    - by Greg
    I would like to do something like this: <Button android:id="@+id/button" android:layout_width="wrap_content" android:layout_height="wrap_cotent" style="@style/SubmitButtonType" /> But in code The xml approach works fine provided that SubmitButtonType is defined. Now what I assume happens is that the appt parser runs through this xml, generates an AttributeSet. That AttributeSet when passed to context/theme#obtainStyledAttributes() will have the style ref mask anything that is not written inline in this tag. Great that's fine! Now how do we do this programmatically. Button, as well as other View types, has a constructor that has the form: <Widget>(Context context, AttributeSet set, int defStyle). So I thought this would work. Button button = new Button(context, null, R.style.SubmitButtonType); However, I am finding that defStyle is badly documented as it really should be written to be a resourceId to an attribute (from R.attrs) that will be passed to obtainStyledAttributes() as the attribute resource, and not the style resource. After looking at the code, all the view implementations seem to pass 0 as the styleRef. I don't see the harm in having it passed as both the attr and the style resource (more flexible and negligible overhead) However I might be approaching this all wrong. How do you do this in code then other than by setting each individual element of the style to the specific widget you want to style (only possible by looking a the code to see what param maps to which method or set of methods). The only way I have found to do this is: <declare-styleable> <attr name="totallyAdhoc_attribute_just_for_this_case" format="reference"> </declare-styleable> <style name="MyAlreadyExistantTheme" > ... ... <item name="totallyAdhoc_attribute_just_for_this_case">@style/SubmitButtonType</item> </style> And instead of passing R.style.SubmitButtonType as defStyle, I pass the new R.attr.totallyAdhoc_attribute_just_for_this_case. Button button = new Button(context, null, R.attr.totallyAdhoc_attribute_just_for_this_case); This works but sounds way too complicated.

    Read the article

  • Haskell data serialization of some data implementing a common type class

    - by Evan
    Let's start with the following data A = A String deriving Show data B = B String deriving Show class X a where spooge :: a -> Q [ Some implementations of X for A and B ] Now let's say we have custom implementations of show and read, named show' and read' respectively which utilize Show as a serialization mechanism. I want show' and read' to have types show' :: X a => a -> String read' :: X a => String -> a So I can do things like f :: String -> [Q] f d = map (\x -> spooge $ read' x) d Where data could have been [show' (A "foo"), show' (B "bar")] In summary, I wanna serialize stuff of various types which share a common typeclass so I can call their separate implementations on the deserialized stuff automatically. Now, I realize you could write some template haskell which would generate a wrapper type, like data XWrap = AWrap A | BWrap B deriving (Show) and serialize the wrapped type which would guarantee that the type info would be stored with it, and that we'd be able to get ourselves back at least an XWrap... but is there a better way using haskell ninja-ery? EDIT Okay I need to be more application specific. This is an API. Users will define their As, and Bs and fs as they see fit. I don't ever want them hacking through the rest of the code updating their XWraps, or switches or anything. The most i'm willing to compromise is one list somewhere of all the A, B, etc. in some format. Why? Here's the application. A is "Download a file from an FTP server." B is "convert from flac to mp3". A contains username, password, port, etc. information. B contains file path information. A and B are Xs, and Xs shall be called "Tickets." Q is IO (). Spooge is runTicket. I want to read the tickets off into their relevant data types and then write generic code that will runTicket on the stuff read' from the stuff on disk. At some point I have to jam type information into the serialized data.

    Read the article

< Previous Page | 468 469 470 471 472 473 474 475 476 477 478 479  | Next Page >