Search Results

Search found 1619 results on 65 pages for 'humble student'.

Page 54/65 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Apache / PHP Begins to Deny SQL Requests after about 2000

    - by Daniel Stern
    We have a web page on our server that we use to run administrative scripts. For example, we might run the script "unenrolStudents()" which runs 5,000 SQL SET commands one after another and sets 5000 student entries in an SQL database to unenrolled. However, we are finding that after running a few thousand queries (it is not totally consistent) we will be "locked out" by our server. SYMPTOMS OF LOCKING OUT: - unable to connect to server with winSCP - opening putty with that connection shows a blank screen (no login / pass) - clearing cookies / cache in chrome does NOT fix locking out - other computers in the office ALSO become locked out - locking out can be triggered with a high frequency of requests (10000 in 1 second) or by less over time (10000 in 500 seconds - this will still cause a lockout even though the frequency is much less) We believe this is a security feature of our own Apache. I know we are using Suhosin but I didn't configure it so I don't know. How can I disable this locking effect so that I can confidently run all my SQL requests and they will go through? Has anyone else dealt with this and found workarounds? Thanks DS

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    Hey, short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Windows Server 2008 R2 RAS VPN: access server on internal interface ip

    - by Mathias
    short question: I'm usually a linux admin but need to setup a Win2k8 R2 server for a student project. The server is running as VM on a root server and has a public internet IP assigned. Additionally I need a VPN server to access some services running on the server. I managed to set up a working VPN gateway via the Routing and RAS service which assigns clients an IP in the private subnet 192.168.88.0/24 with the Interface "Internal" listening on 192.168.88.1. Additionally I set up the external interface as NAT interface. So I can connect to the VPN server, get an IP assigned and the server additionally does NAT and I can access the internet over the VPN connection. The only thing I additionally need, is that I can access the server itself over that internal IP (e.g. client 192.168.88.2, server 192.168.88.1) as I want to access some services which I don't like to expose to the internet and restrict them to connected VPN clients. Does anybody have a hint, which configuration I'm missing here to be able to access the server over the VPN connection? EDIT: VPN clients get assigned the IP from the private subnet with subnetmask 255.255.255.255, I guess that might be the reason I can't access the server on the private IP address although it's in the same network range. Any ideas how to change this? I defined a static address pool in the Routing and RAS service, but I can't change the netmask there. EDIT2: I can't access the server from the client, but I can fully access the client from the server (ping, HTTP). I guess it has to do with firewall configuration. Thanks in advance, Mathias

    Read the article

  • Internet Radio Station for University

    - by ryan
    I am trying to help my University Student Radio station rethink the setup of the way they stream music, but I have some questions regarding the use of Ubuntu to stream music. Currently, the radio station uses two windows machines: one of which is used to stream the radio station and serve the website, and the other is used by rotating djs to select songs and create playlists. The computer used by djs feeds mono into the sound card of the server and the server streams the feed online. -Ideally I would like to maintain a two-computer setup: One computer as server, and another that is used to select and play music by rotating djs. -I would like to use Ubuntu for the server. -I would like to use Windows for the other machine. -The server should be able to stream song information. First, is there a way to somehow get the song information from an analog feed? Second, what is the best streaming server for radio? I have encountered shoutcast, icecast, and darwin, but I don't know where to begin in attempting to gauge them. Finally, if anyone has any tips or pointers about small internet radio station management/ setup they would be appreciated as this is my first radio station, and I am eager to hear of past experiences.

    Read the article

  • What was "The Next Big Thing" when you were just starting out in programming?

    - by Andrew
    I'm at the beginning of my career and there are lots of things which are being touted as "The Next Big Thing". For example: Dependency Injection (Spring, etc) MVC (Struts, ASP.NET MVC) ORMs (Linq To SQL, Hibernate) Agile Software Development These things have probably been around for some time, but I've only just started out. And don't get me wrong, I think these things are great! So, what was "The Next Big Thing" when you were starting out? When was it? Were people sceptical of it at first? Why? Did you think it would catch on? Did it pan out and become widely accepted/used? If not, why not? EDIT It's been nearly a week since I first posted this question and I can safely say that I did not expect such explosive interest. I asked the question so that I could gain a perspective of what kinds of innovations in programming people thought were most important when they were starting out. At the time of writing this I have read ~95% of all answers. To answer a few questions, the "Next Big Things" I listed are ones that I am currently really excited about and that I had not really been exposed to until I started working. I'm hoping to implement some or all of these in the near future at my current workplace. To many people they are probably old news. In regards to the "is this a real question" debate, I can see that obviously hasn't been settled yet. I feel bad whenever I read a comment saying that these kinds of questions take away from the real meaning of SO. I'm not wholly convinced that it doesn't. On the other hand, I have seen a lot of comments saying what a great question it is. Anyway, I have chosen "The Internet!" as my answer to this question. I don't think (in my very humble opinion, and, it seems many SOers opinions) that many things related to programming can compare. Nowadays every business and their dog has a website which can do anything from simply supplying information to purchasing goods halfway around the world to updating your blog. And of course, all these businesses need people like us. Thanks to everyone for all the great answers!

    Read the article

  • open source solution to a gateway for a network of a housing cooperative of 150 people

    - by SirDinosaur
    i just inherited a barely functioning network for a student housing cooperative of about 150 people. in it's current state, as i understand it from the previous person in charge of the network, we have working wireless access points and working ethernet cords going to working gigabit switches going to a barely functioning gateway (right now a simple home router) to one of three possible outbound connections. it is possible to connect to the network through the wireless or ethernet, but especially during peak hours, packets / connections are likely dropped or otherwise get no response. my intuition tells me to replace the gateway with something that can handle multiple outbound connections (WAN) and one inbound connection (LAN), while the rest of the network seems suitable for now. i'm somewhat knowledgable in Linux (been using Debian after first Arch Linux) and i want to use as much open source as possible, but i'm confused whether or not a simple server that i could easily understand will work for this situation. do i need specialized hardware to handle the switching more effectively? if so, what are my options? (i found this, thoughts?) or if a Debian server would work, anything else i should about the specs required for this type of server? also links to any useful information on using open source to maintain this type of network would be most appreciated. <3 P.S. crossposted http://redd.it/yybp2.

    Read the article

  • Software to automate website screenshot capture

    - by Leniel Macaferi
    Do you know any software that can automate the process of getting screenshots of every page of a website? It would act like a spider/crawler/robot. You name it... For example: I developed a website and now I'd like to get a screenshot of every page of the site. I of course could do it manually (a lot of work). For each module of the site (Student, Payment, etc) I have different pages (Create, Edit, Details, Delete, etc) forms. The thing I'm looking for is a software that can visit every link of the site and then capture the screen - a software that can automate the whole process. It would also be good if the software allowed the user to pass a list of URLs to capture screenshots allowing even more fine grained configuration. EDIT: I tried Selenium mentioned by Aaron in his answer but I managed to find an app that does exactly what I needed. It's called Paparazzi!. I wrote a blog post to showcase my attempt at Selenium and the findings regarding Paparazzi!'s batch capture functionality: Software to automate website screenshot capture

    Read the article

  • Cheap desktop computer in 19" rack-mountable form-factor?

    - by Alex Basson
    I'm a high school teacher at a small private school. As of this year, we have SMARTBoards in every classroom (though I've had one in the class I share for two years now). The classrooms themselves don't have computers in them, so we teachers bring our laptops to class and connect them to the boards. This has several disadvantages: This takes a few minutes while we wait for the board to boot up and then orient the board to our individual laptop -- we have to do this every time b/c different teachers have different laptops requiring different orientations. This isn't ideal because when you only have 43 minutes per class period, waiting five minutes just to get started is a real waste. Carrying your laptop to class doesn't sound so bad until you consider that we're also carrying textbooks and piles of student papers, and we're carrying it all through crowded high school hallways. More than one laptop has fallen THUNK to the floor, with dire consequences. We feel we could eliminate the need to use our laptops with the SMARTBoards if we had a dedicated computer in each classroom hooked up to the board at all times. Each board set-up is connected to a podium with a standard 19" rack in it, currently housing a power supply and DVD player. There're plenty of rack spaces available. So I'm thinking: maybe we could get some inexpensive computers in a 19" rack-mountable form factor, install them in the podiums, and connect them to the boards on a permanent basis. Any suggestions?

    Read the article

  • Word 2007 won't run, tries to reinstall, fails with error 1402.

    - by eidylon
    Okay, this problem has been plaguing this computer for a while now. We tried googling, and none of the answers found helped to solve the problem. So, I am now posting the answer here for posterity. Office 2007 Home/Student edition was installed on the computer, running Vista (32-bit). One day, Word just up and stopped working. All the other programs continued to operate as expected. But every time you would click the icon for Word, it would pop up an install dialog, with a message reading "Preparing to install...". After a few minutes of the little progress bar going and going, it errors out, and gives error 1402, something to the effect of unable to access registry key HKEY_Local_Machine\Software\Classes\.wll\.... Searching around, every answer i found had to do with reassigning the permissions on this key, giving full rights to SYSTEM or to Everyone, and propagating the changes down to all sub-keys. When ever this was attempted though, it would tell us that we were unable to access the key due to permissions, even though we had run regedit as Administrator and are logged on with an administrative account. We also tried uninstalling Office and reinstalling it, as well as doing a repair install. Both these attempts also threw the same 1402 error. Also of note was that the executable for Word (winword.exe) was MIA and no longer to be found in the Office install directory.

    Read the article

  • How does the rsync algorithm correctly identify repeating blocks?

    - by Kai
    I'm on a personal quest to learn how the rsync algorithm works. After some reading and thinking, I've come up with a situation where I think the algorithm fails. I'm trying to figure out how this is resolved in an actual implementation. Consider this example, where A is the receiver and B is the sender. A = abcde1234512345fghij B = abcde12345fghij As you can see, the only change is that 12345 has been removed. Now, to make this example interesting, let's choose a block size of 5 bytes (chars). Hashing the values on the sender's side using the weak checksum gives the following values list. abcde|12345|fghij abcde -> 495 12345 -> 255 fghij -> 520 values = [495, 255, 520] Next we check to see if any hash values differ in A. If there's a matching block we can skip to the end of that block for the next check. If there's a non-matching block then we've found a difference. I'll step through this process. Hash the first block. Does this hash exist in the values list? abcde -> 495 (yes, so skip) Hash the second block. Does this hash exist in the values list? 12345 -> 255 (yes, so skip) Hash the third block. Does this hash exist in the values list? 12345 -> 255 (yes, so skip) Hash the fourth block. Does this hash exist in the values list? fghij -> 520 (yes, so skip) No more data, we're done. Since every hash was found in the values list, we conclude that A and B are the same. Which, in my humble opinion, isn't true. It seems to me this will happen whenever there is more than one block that share the same hash. What am I missing?

    Read the article

  • Running Visual Studio 2010 in a University Campus

    - by Woondows
    We have just installed Windows 7 Enterprise x64 in one of our computer labs being used by students for programming. However, when we installed Visual Studio 2010 Ultimate on the machines, we found that to even launch the application (devenv.exe), required the student to enter the administrator password (the usual UAC prompt). Of course, we could just turn off UAC, but that would defeat the purpose of having it in Windows 7. On the other hand, we cannot really give the students local administrator privilege, as we are concerned that they will do some malicious stuff on the computers. Previously when we used Windows XP Professional running Visual Studio 2005, we had no problems. Kindly advise if there's any workaround for this. EDIT: Thanks for the answer guys. Mayank, your links may work for Visual Studio .Net, but it doesn't seem to work for Visual Studio 2010. Ryan, Tieson, I'm intrigued that you guys managed to get it working easily. FYI I don't manage the Group Policies, but I can get them changed if necessary. Any particular GP that I should be looking at? Suggestions to how to troubleshoot further why UAC is being invoked? At least now I know for sure that this is not supposed to be the default behaviour for Visual Studio 2010 so I'm going to keep digging for a solution. Will try running Procmon and see if i can find something..

    Read the article

  • Excel data representation: show me all people who did not pass the exam

    - by dreftymac
    Background I have an excel spreadsheet with the results of a pass/no-pass exam. Students are allowed to take the exam as often as they want until they either pass, or give up trying. student ;; result ;; date [email protected] ;; no-pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; no-pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-07 [email protected] ;; pass ;; 2000-06-08 [email protected] ;; no-pass ;; 2000-06-08 Question Using a pivot-table or something else, how can I get excel to show me a clean report or representation of this data on another sheet that answers the question: Who are all the people who took the exam, but never got a passing grade? In the above example it would just show me [email protected] ;; no-pass ;; with all the dates that delta took the exam. I know excel is not a database nor a reporting tool per-se, but it would be great if I could get it to do this.

    Read the article

  • Connecting to unsecured wireless network

    - by Sanchez
    I would like to know what information is public and can be intercepted in a non-open, but unsecured wireless network. Moreover, is there anything I can do to make it more "secure", other than using https connection whenever possible. In more details, I recently discovered (with surprise) that the wireless network in my school is actually unsecured. Although not everyone can connect to it (you need a student ID), I am told that certain softwares like Wireshark would be able to intercept the data. Since I have been using the network for all private purposes (email, facebook etc), I do feel quite insecure now and would like to understand the situation a bit better. I installed Wireshark and tried to play with it but all I can see are something alien to me. In any case, all I see seems to come directly/indirectly from my IP address, and I have long thought that usually different computers in the same wireless network would be assigned different addresses. Am I wrong? If not, then I feel very confused about what information is actually being captured (potentially by other users in the network, since I don't think I could capture activities of others in the same network anyway), and whether it's safe to use the network at all. (Gambling on others in the same network showing good behaviour is apparently not an option.) Thank you.

    Read the article

  • How to create a static IP on Windows Server 2008 R2 so I can access the server remotely

    - by Aesir
    I have just purchased a HP Proliant N40L which I am intending to use as a NAS, learning tool and just in general something to mess around with. As a student via the Microsoft dreamspark program I can get a free copy of Windows Server 2008 R2 which I am using as the OS. So that I can remote to the box from outside of my local network and so that I can stream media from it to my PS3, I have read that I need to create a static IP for the server and use port forwarding to forward to this IP so I can remote in. Is this correct? I am not really sure how to do this and if I need to make these changes on my router configuration, on the OS or both. I am a novice when it comes to networking however most resources for Windows server 2008 R2 seem to assume a fair amount of experience already. I realise that using this particular OS may seem like overkill for what I currently wish to do with it (stream content to other devices and backup) but as I can get a copy for free it seems sensible. Edit: From reading answers posted I feel I should give more information. I have now tried to add a static IP address using my router configuration settings. I have used the getmac command to get the mac address of the server. My ISP is Virgin Media and I have gone to the LAN IP section and I have added an IP address to the DHCP Reservation Lease Info. I can now use remote desktop connection internally to remote to the server (so I am assuming assigning this IP has worked). How do I configure this on the OS as well? I am also unsure on how I would remote to this machine outside of my local network?

    Read the article

  • Steps to deploy a custom routing protocol

    - by user134589
    I'm a Ph.D Student and I'm researching a Service Centric Networking architecture with resourceallocation on a large scale. What I'm looking to do is expand an existing routing protocol like OSPF with extra fields and some new message types that I need for communication between Nodes. I want to manipulate the cost of a network link and I want paths to be calculated like in OSPF V2/v3, but using the cost that my algorithms have calculated. What I have I have the source code of OSPF from Quagga. I am assuming I can edit this code how I want, including packet structures and creating new types. Yes, I am aware it won't be easy but this is a 6 years research project and I am eager to develop something new, to move forward. What I need I would like to know how I can deploy the edited OSPF source files I have (written in C) on any type of server. I have a large testbed environment available with hundreds of virtual nodes and pretty much any OS out there. So if I want to test my extended protocol, how do I make all the nodes in a network use this to communicate? I do not understand what parts of the kernel I need to edit here. I tried searching for days now and I am unable to find how to deploy a non-existing routing protocol, without the use of an application-level framework. If somebody could push me in the right direction that'd be awesome. note: I need this to be a routingprotocol and not an application, since I want this to work on op of the network layer for performance reasons. Thanks!

    Read the article

  • Creating a Logical network diagram

    - by user273284
    Im a student and I have been assigned the task of creating a logical network diagram for the following scenario There are 2 buildings, the first is the head office and the second is the branch. The data centre is in the head office, it contains domain controller, mail server, file server and a web server. it provides wired and wireless access to the staff. the branch building is new and it does not have a network. The two buildings must be connected using a VPN connection. The branch building will not have any servers but just network devices that will provide the connectivity, the users in the branch building will be connected to the head office over the VPN. I had created a diagram based on this scenario, but my teacher rejected it saying that it does not follow Cisco hierarchical Model and the servers were not placed correctly in the diagram. I just wanted some help in this matter so that I Can create my network diagram correctly. If anyone could upload a picture of how the logical diagram should be for this scenario will be helpful, any other resources would also be great.

    Read the article

  • Clean installation of RHEL 5.5 claims package "desktops" is missing

    - by TKguru42
    Hi all, I'm a student worker in the CS department of my university, so please forgive me for any unprofessional descriptions. Simplified explanations are appreciated. I recently replaced some bad graphics cards in a few public workstations. The machines are all the same model. Before putting them back on the network I did fresh installs of RHEL---first I tried 5.4, but yum update ran into all sorts of ugly dependency errors and if I tried to remove any of the problematic packages, the whole operating system FUBAR'd. Using RHEL 5.5 gave me the same errors during install saying that "java.1.5.1-sun*" and "desktops" were missing, but yum update didn't have any dependency problems. Now that I tried logging in through the GUI, I encounter no GUI past the standard RHEL login page. The desktop is a uniform light teal and there's no system tray. An xclock window and an xterm window are open, and Firefox opens automatically, but that's it. Nothing else. What's REALLY confusing is that the computer claims that gnome is already installed, except it clearly isn't working. Any help or advice is greatly appreciated. If it helps, our department uses kickstart to run our standard Linux installs. I can try to get the script if that would be of use. Thank you!

    Read the article

  • Am I safe on Windows if I continue like this?

    - by max
    Of all the available tons of anti-malware software for Windows all over the internet, I've never used any paid solution(I am a student, I have no money). Since the last 10 years, my computers running Windows have never been hacked/compromised or infected so badly that I had to reformat them(of course I did reformat them for other reasons). The only program I have for security is Avast Home Edition, which is free, installed on my computers. It has never caused any problems; always detected malware, updated automatically, has an option to sandbox programs and everything else I need. Even if I got infected, I just did a boot-time scan with it, downloaded and ran Malwarebytes, scanned Autoruns logs, checked running processes with Process Explorer and did some other things and made sure I cleaned my computer. I am quite experienced and I've always taken basic precautions like not clicking suspicious executables, not going to sites which are suspicious according to WOT, and all that blah. But recently I've been doing more and more online transactions and since its 2012 now, I'm doubtful whether I need more security or not. Have I been just lucky, or do my computing habits obviate the need to use any more(or paid) security software?

    Read the article

  • Microsoft Word 2008 on the Mac sometimes "Disappears" documents, really.

    - by Ross Charette
    This happens in a computer lab environment, has happened at least 3 times. We are running Microsoft Office 2008 for mac on Leopard, everything is updated. Our user's home directories are on a network drive, but the /Library/Cache folder is running locally. Typically a student will have a Word file that they have been working on, it's been saved before they even logged onto the computer that day. They log on, open the document, click the save icon (not go to File Save), sometimes even save multiple times, then close Word. The document is now gone. It's not hidden, there are no autosaves or anything in the Cache folder. Definitely not in the trash or trashes folder. It can't find it when you click on it in 'recent documents'. Searching meticulously though every folder in their home drive turns up nothing. They look using Finder, I look ssh'd as root into their home using ls -la. I look for similar files in case they renamed it by mistake. It's gone. Disappeared. Vaporized. It's happened to at least 3 different users in the past year. Much whining. Any idea?

    Read the article

  • Winodws server 2003 Setup

    - by Barracksbuilder
    I work at a university maintaining the computer science department server. I am looking for a more economical way to stream line the set up of student accounts. CS students are granted a Username and password an IIS virtual directory, FTP virtual directory, and a mysql database. Server is running windows server 2003R2 (Possibly migrating to 2008R2) The server is running a domain though no students physically log a terminal into it (No computers are part of my domain.) Creating the account is a manual process. I did right a PHP script to query the Universities AD and copy the information and write it to my AD. I then have to create basically the users home directory. I tried having AD do it but since the user never physically logs in it never creates the directory. Permissions on this folder are set to User - full, Instructors (group) - full, Users (group) - read, IUSER - read. Inside of the users folder their is a "Private" folder with permissions User - full, instructors (group) - full. Next step is IIS I create a virtual directory in the default web site pointed to the users home directory so they have a website. Same goes for FTP virtual directory in the default ftp configuration to allow the users to upload files to their website. Mysql I have to create a user and password then create a mysql scheme (database) full access for the user and full access to the instructors account to be able to access the students database. All of this is done manually and takes me a week to do. The closest description is maybe a shared hosting environment. Is there a better way to do this? Scripting wise, or better structure setup?

    Read the article

  • How to manage enterprise network of Linux machines?

    - by killy9999
    I work at the university. In my institute we have six computer laboratories used for teaching. Each lab has almost 20 computers, which gives over 100 machines total. Computers have either Windows XP or Windows 7 Eneterprise operating system. We use Symantec Ghost to manage all the computers. Each computer has a Ghost client installed, which allows to control computers over network. Every six months we restore a master image on one of the computers in a lab, update that image and distribute it over the network to all computers in a laboratory. Thanks to Ghost client this is done automatically with just a few clicks. Recently I suggested that it would be good to have Linux installed in the laboratories. The administrators were concerned that we would not be able to manage that many computers if each would have to be updated manually. The question is: how to manage such a huge network of Linux machines in an automated way? To make the description of our network more complete I'll add that all students have their accounts (about few thousand users) on a central server. These are accessed via LDAP. To use a computer in laboratory each student has to log in using his own account.

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

  • Finding a person in the forest

    - by PointsToShare
    © 2011 By: Dov Trietsch. All rights reserved finding a person in the forest or Limiting the AD result in SharePoint People Picker There are times when we need to limit the SharePoint audience of certain farms or servers or site collections to a particular audience. One of my experiences involved limiting access to US citizens, another to a particular location. Now, most of us – your humble servant included – are not Active Directory experts – but we must be able to handle the “audience restrictions” as required. So here is how it’s done in a nutshell. Important note. Not all could be done in PowerShell (at least not yet)! There are no Windows PowerShell commands to configure People Picker. The stsadm command is: stsadm -o setproperty -pn peoplepicker-searchadcustomquery -pv ADQuery –url http://somethingOrOther Note the long-hyphenated property name. Now to filling the ADQuery.   LDAP Query in a nutshell Syntax LDAP is no older than SQL and an LDAP query is actually a query against the LDAP Database. LDAP attributes are the equivalent of Database columns, so why do we have to learn a new query language? Beats me! But we must, so here it is. The syntax of an LDAP query string is made of individual statements with relational operators including: = Equal <= Lower than or equal >= Greater than or equal… and memberOf – a group membership. ! Not * Wildcard Equal and memberOf are the most commonly used. Checking for absence uses the ! – not and the * - wildcard Example: (SN=Grant) All whose last name – SurName – is Grant Example: (!(SN=Grant)) All except Grant Example: (!(SN=*)) all where there is no SurName i.e SurName is absent (probably Rappers). Example: (CN=MyGroup) Common Name is MyGroup.  Example: (GN=J*) all the Given Names that start with J (JJ, Jane, Jon, John, etc.) The cryptic SN, CN, GN, etc. are attributes and more about them later All the queries are enclosed in parentheses (Query). Complex queries are comprised of sets that are in AND or OR conditions. AND is denoted by the ampersand (&) and the OR is denoted by the vertical pipe (|). The general syntax is that of the Prefix polish notation where the operand precedes the variables. E.g +ab is the sum of a and b. In an LDAP query (&(A)(B)) will garner the objects for which both A and B are true. In an LDAP query (&(A)(B)(C)) will garner the objects for which A, B and C are true. There’s no limit to the number of conditions. In an LDAP query (|(A)(B)) will garner the objects for which either A or B are true. In an LDAP query (|(A)(B)(C)) will garner the objects for which at least one of A, B and C is true. There’s no limit to the number of conditions. More complex queries have both types of conditions and the parentheses determine the order of operations. Attributes Now let’s get into the SN, CN, GN, and other attributes of the query SN – is the SurName (last name) GN – is the Given Name (first name) CN – is the Common Name, usually GN followed by SN OU – is an Organization Unit such as division, department etc. DC – is a Domain Content in the AD forest l – lower case ‘L’ stands for location. Jerusalem anybody? Or Katmandu. UPN – User Principal Name, is usually the first part of an email address. By nature it is unique in the forest. Most systems set the UPN to be the first initial followed by the SN of the person involved. Some limit the total to 8 characters. If we have many ‘jsmith’ we have to somehow distinguish them from each other. DN – is the distinguished name – a name unique to AD forest in which it lives. Usually it’s a CN with some domain or group distinguishers. DN is important in conjunction with the memberOf relation. Groups have stricter requirement. Each group has to have a unique name - its CN and it has to be unique regardless of its place. See more below. All of the attributes are case insensitive. CN, cn, Cn, and cN are identical. objectCategory is an element that requires special consideration. AD contains many different object like computers, printers, and of course people and groups. In the queries below, we’re limiting our search to people (person). Putting it altogether Let’s get a list of all the Johns in the SPAdmin group of the Jerusalem that local domain. (&(objectCategory=person)(memberOf=cn=SPAdmin,ou=Jerusalem,dc=local)) The memberOf=cn=SPAdmin uses the cn (Common Name) of the SPAdmin group. This is how the memberOf relation is used. ‘SPAdmin’ is actually the DN of the group. Also the memberOf relation does not allow wild cards (*) in the group name. Also, you are limited to at most one ‘OU’ entry. Let’s add Marvin Minsky to the search above. |(&(objectCategory=person)(memberOf=cn=SPAdmin,ou=Jerusalem,dc=local))(CN=Marvin Minsky) Here I added the or pipeline at the beginning of the query and put the CN requirement for Minsky at the end. Note that if Marvin was already in the prior result, he’s not going to be listed twice. One last note: You may see a dryer but more complete list of attributes rules and examples in: http://www.tek-tips.com/faqs.cfm?fid=5667 And finally (thus negating the claim that my previous note was last), to the best of my knowledge there are 3 more ways to limit the audience. One is to use the peoplepicker-searchadcustomfilter property using the same ADQuery. This works only in SP1 and above. The second is to limit the search to users within this particular site collection – the property name is peoplepicker-onlysearchwithinsitecollection and the value is yes (-pv yes) And the third is –pn peoplepicker-serviceaccountdirectorypaths –pv “OU=ou1,DC=dc1…..” Again you are limited to at most one ‘OU’ phrase – no OU=ou1,OU=ou2… And now the real end. The main property discussed in this sprawling and seemingly endless monogram – peoplepicker-searchadcustomquery - is the most general way of getting the job done. Here are a few examples of command lines that worked and some that didn’t. Can you see why? C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (Title=David) Operation completed successfully. C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (!Title=David) Operation completed successfully. C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (OU=OURealName,OU=OUMid,OU=OUTop,DC=TopDC,DC=MidDC,DC=BottomDC) Command line error. Too many OUs C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (OU=OURealName) Operation completed successfully. C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (DC=TopDC,DC=MidDC,DC=BottomDC) Operation completed successfully. C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\BIN>stsa dm -o setproperty -url http://somethingOrOther -pn peoplepicker-searchadcustomfi lter -pv (OU=OURealName,DC=TopDC,DC=MidDC,DC=BottomDC) Operation completed successfully.   That’s all folks!

    Read the article

  • SQL Server Master class winner

    - by Testas
     The winner of the SQL Server MasterClass competition courtesy of the UK SQL Server User Group and SQL Server Magazine!    Steve Hindmarsh     There is still time to register for the seminar yourself at:  www.regonline.co.uk/kimtrippsql     More information about the seminar     Where: Radisson Edwardian Heathrow Hotel, London  When: Thursday 17th June 2010  This one-day MasterClass will focus on many of the top issues companies face when implementing and maintaining a SQL Server-based solution. In the case where a company has no dedicated DBA, IT managers sometimes struggle to keep the data tier performing well and the data available. This can be especially troublesome when the development team is unfamiliar with the affect application design choices have on database performance. The Microsoft SQL Server MasterClass 2010 is presented by Paul S. Randal and Kimberly L. Tripp, two of the most experienced and respected people in the SQL Server world. Together they have over 30 years combined experience working with SQL Server in the field, and on the SQL Server product team itself. This is a unique opportunity to hear them present at a UK event which will: Debunk many of the ingrained misconceptions around SQL Server's behaviour    Show you disaster recovery techniques critical to preserving your company's life-blood - the data    Explain how a common application design pattern can wreak havoc in the database Walk through the top-10 points to follow around operations and maintenance for a well-performing and available data tier! Please Note: Agenda may be subject to change  Sessions Abstracts  KEYNOTE: Bridging the Gap Between Development and Production    Applications are commonly developed with little regard for how design choices will affect performance in production. This is often because developers don't realize the implications of their design on how SQL Server will be able to handle a high workload (e.g. blocking, fragmentation) and/or because there's no full-time trained DBA that can recognize production problems and help educate developers. The keynote sets the stage for the rest of the day. Discussing some of the issues that can arise, explaining how some can be avoided and highlighting some of the features in SQL 2008 that can help developers and DBAs make better use of SQL Server, and troubleshoot when things go wrong.   SESSION ONE: SQL Server Mythbusters  It's amazing how many myths and misconceptions have sprung up and persisted over the years about SQL Server - after many years helping people out on forums, newsgroups, and customer engagements, Paul and Kimberly have heard it all. Are there really non-logged operations? Can interrupting shrinks or rebuilds cause corruption? Can you override the server's MAXDOP setting? Will the server always do a table-scan to get a row count? Many myths lead to poor design choices and inappropriate maintenance practices so these are just a few of many, many myths that Paul and Kimberly will debunk in this fast-paced session on how SQL Server operates and should be managed and maintained.   SESSION TWO: Database Recovery Techniques Demo-Fest  Even if a company has a disaster recovery strategy in place, they need to practice to make sure that the plan will work when a disaster does strike. In this fast-paced demo session Paul and Kimberly will repeatedly do nasty things to databases and then show how they are recovered - demonstrating many techniques that can be used in production for disaster recovery. Not for the faint-hearted!   SESSION THREE: GUIDs: Use, Abuse, and How To Move Forward   Since the addition of the GUID (Microsoft’s implementation of the UUID), my life as a consultant and "tuner" has been busy. I’ve seen databases designed with GUID keys run fairly well with small workloads but completely fall over and fail because they just cannot scale. And, I know why GUIDs are chosen - it simplifies the handling of parent/child rows in your batches so you can reduce round-trips or avoid dealing with identity values. And, yes, sometimes it's even for distributed databases and/or security that GUIDs are chosen. I'm not entirely against ever using a GUID but overusing and abusing GUIDs just has to be stopped! Please, please, please let me give you better solutions and explanations on how to deal with your parent/child rows, round-trips and clustering keys!   SESSION 4: Essential Database Maintenance  In this session, Paul and Kimberly will run you through their top-ten database maintenance recommendations, with a lot of tips and tricks along the way. These are distilled from almost 30 years combined experience working with SQL Server customers and are geared towards making your databases more performant, more available, and more easily managed (to save you time!). Everything in this session will be practical and applicable to a wide variety of databases. Topics covered include: backups, shrinks, fragmentation, statistics, and much more! Focus will be on 2005 but we'll explain some of the key differences for 2000 and 2008 as well. Speaker Biographies     Kimberley L. Tripp Paul and Kimberly are a husband-and-wife team who own and run SQLskills.com, a world-renowned SQL Server consulting and training company. They are both SQL Server MVPs and Microsoft Regional Directors, with over 30 years of combined experience on SQL Server. Paul worked on the SQL Server team for nine years in development and management roles, writing many of the DBCC commands, and ultimately with responsibility for core Storage Engine for SQL Server 2008. Paul writes extensively on his blog (SQLskills.com/blogs/Paul) and for TechNet Magazine, for which he is also a Contributing Editor. Kimberly worked on the SQL Server team in the early 1990s as a tester and writer before leaving to found SQLskills and embrace her passion for teaching and consulting. Kimberly has been a staple at worldwide conferences since she first presented at TechEd in 1996, and she blogs at SQLskills.com/blogs/Kimberly. They have written Microsoft whitepapers and books for SQL Server 2000, 2005 and 2008, and are regular, top-rated presenters worldwide on database maintenance, high availability, disaster recovery, performance tuning, and SQL Server internals. Together they teach the SQL MCM certification and throughout Microsoft.In their spare time, they like to find frogfish in remote corners of the world.   Speaker Testimonials  "To call them good trainers is an epic understatement. They know how to deliver technical material in ways that illustrate it well. I had to stop Paul at one point and ask him how long it took to build a particular slide because the animations were so good at conveying a hard-to-describe process." "These are not beginner presenters, and they put an extreme amount of preparation and attention to detail into everything that they do. Completely, utterly professional." "When it comes to the instructors themselves, Kimberly and Paul simply have no equal. Not only are they both ultimate authorities, but they have endless enthusiasm about the material, and spot on delivery. If either ever got tired they never showed it, even after going all day and all week. We witnessed countless demos over the course of the week, some extremely involved, multi-step processes, and I can’t recall one that didn’t go the way it was supposed to." "You might think that with this extreme level of skill comes extreme levels of egotism and lack of patience. Nothing could be further from the truth. ... They simply know how to teach, and are approachable, humble, and patient." "The experience Paul and Kimberly have had with real live customers yields a lot more information and things to watch out for than you'd ever get from documentation alone." “Kimberly, I just wanted to send you an email to let you know how awesome you are! I have applied some of your indexing strategies to our website’s homegrown CMS and we are experiencing a significant performance increase. WOW....amazing tips delivered in an exciting way!  Thanks again” 

    Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >