Search Results

Search found 4962 results on 199 pages for 'parse'.

Page 54/199 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

  • DocuSign Connect xsd [on hold]

    - by Brian
    I'm trying to parse xml inbound to our system from the DocuSign Connect service (which publishes status updates to a given web service). I typiclly use jaxb to process xml but as far as I know I need xsd's in order to generate the jaxb. I don't have (or can't find) xsd's from DocuSign in order to do this. I could use other java classes/libraries to parse the xml but without xsd's I'd have to guess at types, restrictions and formats. Is there a way to generate jaxb without having xsd's?

    Read the article

  • Improving performance on data pasting 2000 rows with validations

    - by Lohit
    I have N rows (which could be nothing less than 1000) on an excel spreadsheet. And in this sheet our project has 150 columns like this: Now, our application needs data to be copied (using normal Ctrl+C) and pasted (using Ctrl+V) from the excel file sheet on our GUI sheet. Copy pasting 1000 records takes around 5-6 seconds which is okay for our requirement, but the problem is when we need to make sure the data entered is valid. So we have to validate data in each row generate appropriate error messages and format the data as per requirement. So we need to at runtime parse and evaluate data in each row. Now all the formatting of data and validations come from the back-end database and we have it in a data-table (dtValidateAndFormatConditions). The conditions would be around 50. So you can see how slow this whole process becomes since N X 150 X 50 operations are required to complete this whole process. Initially it took approximately 2-3 minutes but now i have reduced it to 20 - 30 seconds. However i have increased the speed by making an expression parser of my own - and not by any algorithm, is there any other way i can improve performance, by using Divide and Conquer or some other mechanism. Currently i am not really sure how to go about this. Here is what part of my code looks like: public virtual void ValidateAndFormatOnCopyPaste(DataTable DtCopied, int CurRow) { foreach (DataRow dRow in dtValidateAndFormatConditions.Rows) { string Condition = dRow["Condition"]; string FormatValue = Value = dRow["Value"]; GetValidatedFormattedData(DtCopied,ref Condition, ref FormatValue ,iRowIndex); Condition = Parse(Condition); dRow["Condition"] = Condition; FormatValue = Parse(FormatValue ); dRow["Value"] = FormatValue; } } The above code gets called row-wise like this: public override void ValidateAndFormat(DataTable dtChangedRecords, CellRange cr) { int iRowStart = cr.Row, iRowEnd = cr.Row + cr.RowCount; for (int iRow = iRowStart; iRow < iRowEnd; iRow++) { ValidateAndFormatOnCopyPaste(dtChangedRecords,iRow); } } Please know my question needs a more algorithmic solution than code optimization, however any answers containing code related optimizations will be appreciated as well. (Tagged Linq because although not seen i have been using linq in some parts of my code).

    Read the article

  • FLVParser problem

    - by mujer-esponja
    Hi! I am using apache tika 7.0, one of the classes, called FLVParser, which is used to extrac metadata from videos. But, when i try to use one of the methos in the class, i get this error in Eclipse: Multiple markers at this line Syntax error on token "parse", Identifier expected after this token Syntax error on token(s), misplaced construct(s) I don't know exactly the meaning of this, and i don't know how to continue. I add the poiece of code also: FLVParser VideoParser = new FLVParser(); VideoParser.parse(); //Here is the error message Any ideas, please?? I made the imports in the right way and the mave dependencies are right aswell. Thanks in advance!

    Read the article

  • Error "E_UNEXPECTED(0x8000FFFF)" when using CDec/CInt/IsNumeric

    - by Marc vB
    I have encountered a strange problem, which I could solve but don't understand why it did occur. I have build a DLL with COM enabled. In this DLL I have classes that did use the functions CInt, CDec and IsNumeric. If I test these classes from a .NET application then it works ok. But when I called/run these classes from a Win32 application (with COM) then I did get an "E_UNEXPECTED(0x8000FFFF)" error. After some debugging I found out that the problem would go away if I: - replaced IsNumeric with Integer.TryParse or Decimal.TryParse - replaced CInt with Integer.Parse - replaced CDec with Decimal.Parse Can anyone explain this? Again, I could solve it by doing this but I would like to know why.

    Read the article

  • code throws std::bad_alloc, not enough memory or can it be a bug?

    - by Andreas
    I am parsing using a pretty large grammar (1.1 GB, it's data-oriented parsing). The parser I use (bitpar) is said to be optimized for highly ambiguous grammars. I'm getting this error: 1terminate called after throwing an instance of 'std::bad_alloc' what(): St9bad_alloc dotest.sh: line 11: 16686 Aborted bitpar -p -b 1 -s top -u unknownwordsm -w pos.dfsa /tmp/gsyntax.pcfg /tmp/gsyntax.lex arbobanko.test arbobanko.results Is there hope? Does it mean that it has ran out of memory? It uses about 15 GB before it crashes. The machine I'm using has 32 GB of RAM, plus swap as well. It crashes before outputting a single parse tree. The parser is an efficient CYK chart parser using bit vector representations; I presume it is already near the limit of memory efficiency. If it really requires too much memory I could sample from the grammar rules, but this will decrease parse accuracy of course.

    Read the article

  • How do I add Objective C code to a FireBreath Project?

    - by jmort253
    I am writing a browser plugin for Mac OS that will place a status bar icon in the status bar, which users can use to interface with the browser plugin. I've successfully built a FireBreath 1.6 project in XCode 4.4.1, and can install it in the browser. However, FireBreath uses C++, whereas a large majority of the existing libraries for Mac OS are written in Objective C. In the /Mac/projectDef.make file, I added the Cocoa Framework and Foundation Framework, as suggested here and in other resources I've found on the Internet: target_link_libraries(${PROJECT_NAME} ${PLUGIN_INTERNAL_DEPS} ${Cocoa.framework} # added line ${Foundation.framework} # added line ) I reran prepmac.sh, expecting a new project to be created in XCode with my .mm files, and .m files; however, it seems that they're being ignored. I only see the .cpp and .h files. I added rules for those in the projectDef.make file, but it doesn't seem to make a difference: file (GLOB PLATFORM RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} Mac/[^.]*.cpp Mac/[^.]*.h Mac/[^.]*.m #added by me Mac/[^.]*.mm #added by me Mac/[^.]*.cmake ) Even if I add the files in manually, I get a series of compilation errors. There are about 20 of them, all related to the file NSObjRuntime.h file: Parse Issue - Expected unqualified-id Parse Issue - Unknown type name 'NSString' Semantic Issue - Use of undeclared identifier 'NSString' Parse Issue - Unknown type name 'NSString' ... ... Semantic Issue - Use of undeclared identifier 'aSelectorName' ... ... Semantic Issue - Use of undeclared identifier 'aClassName' ... It continues like this for some time with similar errors... From what I've read, these errors appear because of dependencies on the Foundation Framework, which I believe I've included in the project. I also tried clicking the project in XCode I'm to the point now where I'm not sure what to try next. People say it's not hard to use Objective C in C/C++ code, but being new to XCode and Objective C might contribute to my confusion. This is only day 4 for me in this new platform. What do I need to do to get XCode to compile the Objective C code? Please remember that I'm a little new to this, so I'd appreciate it if you leave detailed answers as opposed to the vague one-liners that are common in the firebreath tag. I'm just a little in over my head, but if you can get me past this hurdle I'm certain I'll be good to go from there. UPDATE: I edited projects/MyPlugin/CMakeLists.txt and added in the .m and .mm rules there too. after running prepmac.sh, the files are included in the project, but I still get the same compile errors. I moved all the .h files and .mm files from the Obj C code to the MyPlugin root folder and reran the prepmac.sh file. Problem still exists. Same compile errors.

    Read the article

  • MVC2 IModelBinder and parsing a string to an object - How do I do it?

    - by burnt_hand
    I have an object called Time public class Time{ public int Hour {get;set;} public int Minute {get;set;} public static Time Parse(string timeString){ //reads the ToString()'s previous output and returns a Time object } override protected string ToString(){ //puts out something like 14:50 (as in 2:50PM) } } So what I want is for the automatic model binding on the Edit or Create action to set this Time instance up from a string (i.e. feed the Parse method with the string and return the result). The reason I am doing this is that I will have a DropDownList with selectable times. The value of each option will be the parser readable string. Can anyone provide an example BindModel method from the IModelBinder interface?

    Read the article

  • Why is this variables declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • Datetime comparaison in CAML Query for Sharepoint

    - by Garcia Julien
    Hi, i'm trying to have some item from a sharepoint list, depends on date in a custom column. I've created my query with 2U2 Caml Builder, and that's worked but when I put it in my own code in my webpart, it always return to me all the items od the list. Here is my code: DateTime startDate = new DateTime(Int32.Parse(year), 1, 1); DateTime endDate = new DateTime(Int32.Parse(year), 12, 31); SPQuery q = new SPQuery(); q.Query = "<Query><Where><And><Geq><FieldRef Name='Publicate Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(startDate) + "</Value></Geq><Leq><FieldRef Name='Publicate_x0020_Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(endDate) + "</Value></Leq></And></Where></Query>"; SPListItemCollection allItem = library.GetItems(q);

    Read the article

  • "Compiling" content with short tags to var, without eval()

    - by Spot
    To start off, let me clear the air by saying we are aware of the dis/advantages to using short tag syntax in PHP. That is not what this question is about. Is there a way to "include" a file containing short tag code, into a variable, and have PHP actually parse the code? include/require obviously do not provide the data in a workable form, and output buffering does not parse the short tag code because it happens at runtime. Using eval() is simply not an option. Suggestions?

    Read the article

  • Combining DROP USER and DROP DATABASE with SELECT .. WHERE query?

    - by zsero
    I'd like to make a very simple thing, replicate the functionality of mysql's interactive mysql_secure_installation script. My question is that is there a simple, built-in way in MySQL to combine the output of a SELECT query with the input of a DROP user or DROP database script? For example, if I'd like to drop all users with empty passwords. How could I do that with DROP USER statement? I know an obvious solution would be to run everything for example from a Python script, run a query with mysql -Bse "select..." parse the output with some program construct the drop query run it. Is there an easy way to do it in a simple SQL query? I've seen some example here, but I wouldn't call it simple: http://stackoverflow.com/a/12097567/518169 Would you recommend making a combined query, or just to parse the output using for example Python or bash scripts/sed?

    Read the article

  • C# SQL Parameter Errors in Loops

    - by jakesankey
    Please help me out with this. I have this small application to load txt files into a sql db and it works fine with sqlite. When I ported to SQL I started getting 'parameter already declared' errors.. If anyone can help me reorganize this code, it would be great! I need to get the parameter definitions outside of the loops or something.. using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"SELECT FileName FROM Import;"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { Console.WriteLine("Connecting to SQL server..."); SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R.txt*", SearchOption.AllDirectories); insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { var FileNameExt1 = Path.GetFileName(file); cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } } FYI - the PartNumber, CMMNumber, Date, etc at the bottom are pulled from the file name and I need it in the table next to each respective record.

    Read the article

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • [PHP] Using cURL to download large XML files

    - by ndg
    I'm working with PHP and need to parse a number of fairly large XML files (50-75MB uncompressed). The issue, however, is that these XML files are stored remotely and will need to be downloaded before I can parse them. Having thought about the issue, I think using a system() call in PHP in order to initiate a cURL transfer is probably the best way to avoid timeouts and PHP memory limits. Has anyone done anything like this before? Specifically, what should I pass to cURL to download the remote file and ensure it's saved to a local folder of my choice?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Error in Decompression?

    - by user595606
    I am writing a crawler for a website. Its response is gzip encoded. I am not able to parse correctly a particular field, though the decompression is successful. I am also using htmlagilitypack to parse it, the parsed value of the field is only a part of the original value as an example : I am getting only /wEWAwKc04vTCQKb86mzBwKln/PuCg== whereas the firebug shows the actual value as much longer: /wEWBgKj7IuJCgKb86mzBwKln/PuCgLT250qAtC0+8cMAvimiNYD what does the '==' at the end means? I am assuming it that its a error on decompressors behalf?

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • Why is this variable declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • dijit.form.FilteringSelectinitial initial value always null.

    - by jiggs
    I'm using QueryReadStore as data and displaying the widget using the declarative way. My store looks like this: <div style="display:none" jsId="role_store" url="some/url/here" requestMethod="post" dojoType="dojox.data.QueryReadStore"></div> My widget is like this: <input dojoType="dijit.form.FilteringSelect" id="role_id" name="role_name" required="false" store="role_store" value="100" searchAttr="description"> Scenario: store is declared inside the HTML page. widget is loaded using parse.parse in the javascript. Issue: At first click no displayed value on the widget. But at the second click, values are displayed right.

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >