Search Results

Search found 16643 results on 666 pages for 'stackoverflow answer'.

Page 632/666 | < Previous Page | 628 629 630 631 632 633 634 635 636 637 638 639  | Next Page >

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • Javascript scope problem with object and setTimeout

    - by Shabbyrobe
    I'm trying to make a jQuery plugin that executes a method on a timer. I'd like it to work on multiple elements on a page independently. I've reached a point where the timer executes for each element, but the method called in the setTimeout seems to only know about the last instance of the plugin. I know I'm doing something fundamentally stupid here, but I'm danged if I know what. I know stuff like this has been asked 8 million times on here before, but I've not managed to find an answer that relates to my specific problem. Here's a script that demonstrates the structure of what I'm doing. <html> <head> <script type="text/javascript" src="assets/jquery.min.js"></script> <script type="text/javascript"> var crap = 0; (function($) { jQuery.fn.pants = function(options) { var trousers = { id: null, current: 0, waitTimeMs: 1000, begin: function() { var d = new Date(); this.id = crap++; console.log(this.id); // do a bunch of stuff window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, next: function() { this.current ++; console.log(this.id); window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, }; options = options || {}; $.extend(trousers, options); this.each(function(index, element) { trousers.begin(); }); return this; }; } )(jQuery); jQuery(document).ready(function() { jQuery("div.wahey").pants(); }); </script> </head> <body> <div class="wahey"></div> <div class="wahey"></div> </body> </html> The output I get is this: 0 1 1 1 1 1 The output I expect to get is this: 0 1 0 1 0 1

    Read the article

  • .NET and C# Exceptions. What is it reasonable to catch.

    - by djna
    Disclaimer, I'm from a Java background. I don't do much C#. There's a great deal of transfer between the two worlds, but of course there are differences and one is in the way Exceptions tend to be thought about. I recently answered a C# question suggesting that under some circstances it's reasonable to do this: try { some work } catch (Exeption e) { commonExceptionHandler(); } (The reasons why are immaterial). I got a response that I don't quite understand: until .NET 4.0, it's very bad to catch Exception. It means you catch various low-level fatal errors and so disguise bugs. It also means that in the event of some kind of corruption that triggers such an exception, any open finally blocks on the stack will be executed, so even if the callExceptionReporter fuunction tries to log and quit, it may not even get to that point (the finally blocks may throw again, or cause more corruption, or delete something important from the disk or database). May I'm more confused than I realise, but I don't agree with some of that. Please would other folks comment. I understand that there are many low level Exceptions we don't want to swallow. My commonExceptionHandler() function could reasonably rethrow those. This seems consistent with this answer to a related question. Which does say "Depending on your context it can be acceptable to use catch(...), providing the exception is re-thrown." So I conclude using catch (Exception ) is not always evil, silently swallowing certain exceptions is. The phrase "Until .NET 4 it is very bad to Catch Exception" What changes in .NET 4? IS this a reference to AggregateException, which may give us some new things to do with exceptions we catch, but I don't think changes the fundamental "don't swallow" rule. The next phrase really bothers be. Can this be right? It also means that in the event of some kind of corruption that triggers such an exception, any open finally blocks on the stack will be executed (the finally blocks may throw again, or cause more corruption, or delete something important from the disk or database) My understanding is that if some low level code had lowLevelMethod() { try { lowestLevelMethod(); } finally { some really important stuff } } and in my code I call lowLevel(); try { lowLevel() } catch (Exception e) { exception handling and maybe rethrowing } Whether or not I catch Exception this has no effect whatever on the excution of the finally block. By the time we leave lowLevelMethod() the finally has already run. If the finally is going to do any of the bad things, such as corrupt my disk, then it will do so. My catching the Exception made no difference. If It reaches my Exception block I need to do the right thing, but I can't be the cause of dmis-executing finallys

    Read the article

  • overwrite existing entity via bulkloader.Loader

    - by Ray Yun
    I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

    Read the article

  • Doing some stuff right before the user exits the page

    - by Mike
    I have seen some questions here regarding what I want to achieve and have based what I have so far on those answer. But there is a slight misbehavior that is still irritating me. What I have is sort of a recovery feature. Whenever you are typing text, the client sends a sync request to the server every 45 seconds. It does 2 things. First, it extends the lease the client has on the record (only one person may edit at one time) for another 60 seconds. Second, it sends the text typed so far to the server in case the server crashes, internet connection fails, etc. In that case, the next time the user enters our application, the user is notified that something has gone wrong and that some text was recovered. Think of Microsoft or OpenOffice recovery whenever they crash! Of course, if the user leaves the page willingly, the user does not need to be notified and as a result, the recovery is deleted. I do that final request via a beforeunload event. Everything went fine until I was asked to make a final adjustment... The same behavior you have here at stack overflow when you exit the editor... a confirm dialogue. This works so far, BUT, the confirm dialogue is shown twice. Here is the code. The event if (local.sync.autosave_textelement) { window.onbeforeunload = exitConfirm; } The function function exitConfirm() { var local = Core; if (confirm('blub?')) { local.sync.autosave_destroy = true; sync(false); return true; } else { return false; } }; Some problem irrelevant clarifications: Core is a global Object that contains a lot of variables that are used everywhere. sync makes an ajax request. The values are based on the values that the Core.sync object contains. The parameter determines if the call should be async (default) or sync. Edit 1 I did try to separate both things (recovery deletion and user confirmation that is) into beforeunload and unload. The problem there was that unload is a bit too late. The user gets informed that there is a recovery even though it is scheduled to be deleted. If you refresh the page 1 second later, the dialogue disappears as the file was deleted by then.

    Read the article

  • How can I implement ASP.NET MVC without using Visual Studio?

    - by Cheeso
    I have seen ASP.NET MVC Without Visual Studio, which asks, Is it possible to produce a website based on ASP.NET MVC, without using Visual Studio? And the accepted answer is, yes. Ok, next question: how? Here's an analogy. If I want to create an ASP.NET Webforms page, I load up my favorite text editor, create a file named Something.aspx. Then I insert into that file, some boilerplate: <%@ Page Language="C#" Debug="true" Trace="false" Src="Sourcefile.cs" Inherits="My.Namespace.ContentsPage" %> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head> <title>Title goes here </title> <link rel="stylesheet" type="text/css" href="css/style.css"></link> <style type="text/css"> #elementid { font-size: 9pt; color: Navy; ... more css ... } </style> <script type="text/javascript" language='javascript'> // insert javascript here. </script> </head> <body> <asp:Literal Id='Holder' runat='server'/> <br/> <div id='msgs'></div> </body> </html> Then I also create the Sourcefile.cs file: namespace My.Namespace { using System; using System.Web; using System.Xml; // etc... public class ContentsPage : System.Web.UI.Page { protected System.Web.UI.WebControls.Literal Holder; void Page_Load(Object sender, EventArgs e) { // page load logic here } } } And that is a working ASPNET page, created in a text editor. Drop it into an IIS virtual directory, and it's working. What do I have to do, to make a basic, hello, World ASPNET MVC app, in a text editor? (without Visual Studio)

    Read the article

  • How can I create a Base64-Encoded string from an GDI+ Image in C++?

    - by Schnapple
    I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

    Read the article

  • Best way to test for a variable's existence in PHP; isset() is clearly broken

    - by chazomaticus
    From the isset() docs: isset() will return FALSE if testing a variable that has been set to NULL. Basically, isset() doesn't check for whether the variable is set at all, but whether it's set to anything but NULL. Given that, what's the best way to actually check for the existence of a variable? I tried something like: if(isset($v) || @is_null($v)) (the @ is necessary to avoid the warning when $v is not set) but is_null() has a similar problem to isset(): it returns TRUE on unset variables! It also appears that: @($v === NULL) works exactly like @is_null($v), so that's out, too. How are we supposed to reliably check for the existence of a variable in PHP? Edit: there is clearly a difference in PHP between variables that are not set, and variables that are set to NULL: <?php $a = array('b' => NULL); var_dump($a); PHP shows that $a['b'] exists, and has a NULL value. If you add: var_dump(isset($a['b'])); var_dump(isset($a['c'])); you can see the ambiguity I'm talking about with the isset() function. Here's the output of all three of these var_dump()s: array(1) { ["b"]=> NULL } bool(false) bool(false) Further edit: two things. One, a use case. An array being turned into the data of an SQL UPDATE statement, where the array's keys are the table's columns, and the array's values are the values to be applied to each column. Any of the table's columns can hold a NULL value, signified by passing a NULL value in the array. You need a way to differentiate between an array key not existing, and an array's value being set to NULL; that's the difference between not updating the column's value and updating the column's value to NULL. Second, Zoredache's answer, array_key_exists() works correctly, for my above use case and for any global variables: <?php $a = NULL; var_dump(array_key_exists('a', $GLOBALS)); var_dump(array_key_exists('b', $GLOBALS)); outputs: bool(true) bool(false) Since that properly handles just about everywhere I can see there being any ambiguity between variables that don't exist and variables that are set to NULL, I'm calling array_key_exists() the official easiest way in PHP to truly check for the existence of a variable. (Only other case I can think of is for class properties, for which there's property_exists(), which, according to its docs, works similarly to array_key_exists() in that it properly distinguishes between not being set and being set to NULL.)

    Read the article

  • how to develop a program to minimize errors in human transcription of hand written surveys

    - by Alex. S.
    I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

    Read the article

  • How to list all duplicated rows which may include NULL columns?

    - by Yousui
    Hi guys, I have a problem of listing duplicated rows that include NULL columns. Lemme show my problem first. USE [tempdb]; GO IF OBJECT_ID(N'dbo.t') IS NOT NULL BEGIN DROP TABLE dbo.t END GO CREATE TABLE dbo.t ( a NVARCHAR(8), b NVARCHAR(8) ); GO INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('a', 'b'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('c', 'd'); INSERT t VALUES ('e', NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); INSERT t VALUES (NULL, NULL); GO Now I want to show all rows that have other rows duplicated with them, I use the following query. SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 which will give us the result: a b -------- -------- NULL NULL a b c d Now if I want to list all rows that make contribution to duplication, I use this query: WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) Which will give me the result: a b -------- -------- a b a b a b c d c d c d c d As you can see, all rows include NULLs are filtered. The reason I thought is that I use equal sign to test the condition(dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b), and NULLs cannot be compared use equal sign. So, in order to include rows that include NULLs in it in the last result, I have change the aforementioned query to WITH duplicate (a, b) AS ( SELECT a, b FROM dbo.t GROUP BY a, b HAVING count(*) > 1 ) SELECT dbo.t.a, dbo.t.b FROM dbo.t INNER JOIN duplicate ON (dbo.t.a = duplicate.a AND dbo.t.b = duplicate.b) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b = duplicate.b) OR (dbo.t.b IS NULL AND duplicate.b IS NULL AND dbo.t.a = duplicate.a) OR (dbo.t.a IS NULL AND duplicate.a IS NULL AND dbo.t.b IS NULL AND duplicate.b IS NULL) And this query will give me the answer as I wanted: a b -------- -------- NULL NULL NULL NULL NULL NULL NULL NULL a b a b a b c d c d c d c d Now my question is, as you can see, this query just include two columns, in order to include NULLs in the last result, you have to use many condition testing statements in the query. As the column number increasing, the condition testing statements you need in your query is increasing astonishingly. How can I solve this problem? Great thanks.

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Ruby: Parse, replace, and evaluate a string formula

    - by Swartz
    I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

    Read the article

  • how to refactor user-permission system?

    - by John
    Sorry for lengthy question. I can't tell if this should be a programming question or a project management question. Any advice will help. I inherited a reasonably large web project (1 year old) from a solo freelancer who architected it then abandoned it. The project was a mess, but I cleaned up what I could, and now the system is more maintainable. I need suggestions on how to extend the user-permission system. As it is now, the database has a t_user table with the column t_user.membership_type. Currently, there are 4 membership types with the following properties: 3 of the membership types are almost functionally the same, except for the different monthly fees each must pay 1 of the membership type is a "fake-user" type which has limited access ( different business logic also applies) With regards to the fake-user type, if you look in the system's business logic files, you will see a lot of hard-coded IF statements that do something like if (fake-user) { // do something } else { // a paid member of type 1,2 or 3 // proceed normally } My client asked me to add 3 more membership types to the system, each of them with unique features to be implemented this month, and substantive "to-be-determined" features next month. My first reaction is that I need to refactor the user-permission system. But it concerns me that I don't have enough information on the "to-be-determined" membership type features for next month. Refactoring the user-permission system will take a substantive amount of time. I don't want to refactor something and throw it out the following month. I get substantive feature requests on a monthly basis that come out of the blue. There is no project road map. I've asked my client to provide me with a roadmap of what they intend to do with the new membership types, but their answer is along the lines of "We just want to do [feature here] this month. We'll think of something new next month." So questions that come to mind are: 1) Is it dangerous for me to refactor the user permission system not knowing what membership type features exist beyond a month from now? 2) Should I refactor the user permission system regardless? Or just continue adding IF statements as needed in all my controller files? Or can you recommend a different approach to user permission systems? Maybe role-based ? 3) Should this project have a road map? For a 1 year old project like mine, how far into the future should this roadmap project? 4) Any general advice on the best way to add 3 new membership types?

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • algorithm q: Fuzzy matching of structured data

    - by user86432
    I have a fairly small corpus of structured records sitting in a database. Given a tiny fraction of the information contained in a single record, submitted via a web form (so structured in the same way as the table schema), (let us call it the test record) I need to quickly draw up a list of the records that are the most likely matches for the test record, as well as provide a confidence estimate of how closely the search terms match a record. The primary purpose of this search is to discover whether someone is attempting to input a record that is duplicate to one in the corpus. There is a reasonable chance that the test record will be a dupe, and a reasonable chance the test record will not be a dupe. The records are about 12000 bytes wide and the total count of records is about 150,000. There are 110 columns in the table schema and 95% of searches will be on the top 5% most commonly searched columns. The data is stuff like names, addresses, telephone numbers, and other industry specific numbers. In both the corpus and the test record it is entered by hand and is semistructured within an individual field. You might at first blush say "weight the columns by hand and match word tokens within them", but it's not so easy. I thought so too: if I get a telephone number I thought that would indicate a perfect match. The problem is that there isn't a single field in the form whose token frequency does not vary by orders of magnitude. A telephone number might appear 100 times in the corpus or 1 time in the corpus. The same goes for any other field. This makes weighting at the field level impractical. I need a more fine-grained approach to get decent matching. My initial plan was to create a hash of hashes, top level being the fieldname. Then I would select all of the information from the corpus for a given field, attempt to clean up the data contained in it, and tokenize the sanitized data, hashing the tokens at the second level, with the tokens as keys and frequency as value. I would use the frequency count as a weight: the higher the frequency of a token in the reference corpus, the less weight I attach to that token if it is found in the test record. My first question is for the statisticians in the room: how would I use the frequency as a weight? Is there a precise mathematical relationship between n, the number of records, f(t), the frequency with which a token t appeared in the corpus, the probability o that a record is an original and not a duplicate, and the probability p that the test record is really a record x given the test and x contain the same t in the same field? How about the relationship for multiple token matches across multiple fields? Since I sincerely doubt that there is, is there anything that gets me close but is better than a completely arbitrary hack full of magic factors? Barring that, has anyone got a way to do this? I'm especially keen on other suggestions that do not involve maintaining another table in the database, such as a token frequency lookup table :). This is my first post on StackOverflow, thanks in advance for any replies you may see fit to give.

    Read the article

  • "C variable type sizes are machine dependent." Is it really true? signed & unsigned numbers ;

    - by claws
    Hello, I've been told that C types are machine dependent. Today I wanted to verify it. void legacyTypes() { /* character types */ char k_char = 'a'; //Signedness --> signed & unsigned signed char k_char_s = 'a'; unsigned char k_char_u = 'a'; /* integer types */ int k_int = 1; /* Same as "signed int" */ //Signedness --> signed & unsigned signed int k_int_s = -2; unsigned int k_int_u = 3; //Size --> short, _____, long, long long short int k_s_int = 4; long int k_l_int = 5; long long int k_ll_int = 6; /* real number types */ float k_float = 7; double k_double = 8; } I compiled it on a 32-Bit machine using minGW C compiler _legacyTypes: pushl %ebp movl %esp, %ebp subl $48, %esp movb $97, -1(%ebp) # char movb $97, -2(%ebp) # signed char movb $97, -3(%ebp) # unsigned char movl $1, -8(%ebp) # int movl $-2, -12(%ebp)# signed int movl $3, -16(%ebp) # unsigned int movw $4, -18(%ebp) # short int movl $5, -24(%ebp) # long int movl $6, -32(%ebp) # long long int movl $0, -28(%ebp) movl $0x40e00000, %eax movl %eax, -36(%ebp) fldl LC2 fstpl -48(%ebp) leave ret I compiled the same code on 64-Bit processor (Intel Core 2 Duo) on GCC (linux) legacyTypes: .LFB2: .cfi_startproc pushq %rbp .cfi_def_cfa_offset 16 movq %rsp, %rbp .cfi_offset 6, -16 .cfi_def_cfa_register 6 movb $97, -1(%rbp) # char movb $97, -2(%rbp) # signed char movb $97, -3(%rbp) # unsigned char movl $1, -12(%rbp) # int movl $-2, -16(%rbp)# signed int movl $3, -20(%rbp) # unsigned int movw $4, -6(%rbp) # short int movq $5, -32(%rbp) # long int movq $6, -40(%rbp) # long long int movl $0x40e00000, %eax movl %eax, -24(%rbp) movabsq $4620693217682128896, %rax movq %rax, -48(%rbp) leave ret Observations char, signed char, unsigned char, int, unsigned int, signed int, short int, unsigned short int, signed short int all occupy same no. of bytes on both 32-Bit & 64-Bit Processor. The only change is in long int & long long int both of these occupy 32-bit on 32-bit machine & 64-bit on 64-bit machine. And also the pointers, which take 32-bit on 32-bit CPU & 64-bit on 64-bit CPU. Questions: I cannot say, what the books say is wrong. But I'm missing something here. What exactly does "Variable types are machine dependent mean?" As you can see, There is no difference between instructions for unsigned & signed numbers. Then how come the range of numbers that can be addressed using both is different? I was reading http://stackoverflow.com/questions/2511246/how-to-maintain-fixed-size-of-c-variable-types-over-different-machines I didn't get the purpose of the question or their answers. What maintaining fixed size? They all are the same. I didn't understand how those answers are going to ensure the same size.

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • How to draw a filled envelop like a cone on OpenGL (using GLUT)?

    - by ashishsony
    Hi, I am relatively new to OpenGL programming...currently involved in a project that uses freeglut for opengl rendering... I need to draw an envelop looking like a cone (2D) that has to be filled with some color and some transparency applied. Is the freeglut toolkit equipped with such an inbuilt functionality to draw filled geometries(or some trick)?? or is there some other api that has an inbuilt support for filled up geometries.. Thanks. Best Regards. Edit1: just to clarify the 2D cone thing... the envelop is the graphical interpretation of the coverage area of an aircraft during interception(of an enemy aircraft)...that resembles a sector of a circle..i should have mentioned sector instead.. and glutSolidCone doesnot help me as i want to draw a filled sector of a circle...which i have already done...what remains to do is to fill it with some color... how to fill geometries with color in opengl?? Thanks. Edit2: Ok thanks for replying...all the answers posted to this questions can work for my problem in a way.. But i would definitely would want to know a way how to fill a geometry with some color. Say if i want to draw an envelop which is a parabola...in that case there would be no default glut function to actually draw a filled parabola(or is there any??).. So to generalise this question...how to draw a custom geometry in some solid color?? Thanks. Edit3: The answer that mstrobl posted works for GL_TRIANGLES but for such a code: glBegin(GL_LINE_STRIP); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 0.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(200.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 200.0, 0.0); glColor3f(0.0, 0.0, 1.0); glVertex3f(0.0, 0.0, 0.0); glEnd(); which draws a square...only a wired square is drawn...i need to fill it with blue color. anyway to do it? if i put some drawing commands for a closed curve..like a pie..and i need to fill it with a color is there a way to make it possible... i dont know how its possible for GL_TRIANGLES... but how to do it for any closed curve?? Thanks.

    Read the article

  • openDatabase Hello World - 2

    - by cf_PhillipSenn
    This is a continuation from a previous stackoverflow question. I've renamed some variables so that I can tell what are keywords and what are names that I can control. Q: Why is the deleteRow function not working? <html> <head> <title>html5 openDatabase Hello World</title> <script src="http://www.google.com/jsapi"></script> <script type="text/javascript"> google.load("jquery", "1"); google.setOnLoadCallback(OnLoadCallback); function OnLoadCallback() { var dbo; dbo = openDatabase('HelloWorld'); dbo.transaction( function(T1) { T1.executeSql( 'CREATE TABLE IF NOT EXISTS myTable ' + ' (myTableID INTEGER NOT NULL PRIMARY KEY AUTOINCREMENT, ' + ' Field1 TEXT NOT NULL );' ); } ); dbo.transaction(function(T2) { T2.executeSql('SELECT * FROM myTable',[], function (T6, result) { for (var i=0; i < result.rows.length; i++) { var row = result.rows.item(i); $('#savedData').append('<li id="'+row.myTableID+'">' + row.Field1 + '</li>'); } }, errorHandler); }); $('form').submit(function() { var xxx = $('#xxx').val(); dbo.transaction( function(T3) { T3.executeSql( 'INSERT INTO myTable (Field1) VALUES (?);', [xxx], function(){ $('#savedData').append('<li id="ThisisWhereIneedHELP">' + xxx + '</li>'); $('#xxx').val(''); }, errorHandler ); } ); return false; }); $('#savedData > li').live('click', function (){ deleteRow(this.id); $(this).remove(); }); } function deleteRow(myTableID) { alert('trying to delete'); dbo.transaction(function(T4) { T4.executeSql('DELETE FROM myTable WHERE myTableID = ?', [myTableID], function(){ alert('Deleted!'); }, errorHandler); }); } function errorHandler(T5, error) { alert('Oops. Error was '+error.message+' (Code '+error.code+')'); // T5.executeSql('INSERT INTO errors (code, message) VALUES (?, ?);', // [error.code, error.message]); return false; } </script> </head> <body> <form method="post"> <input name="xxx" id="xxx" /> <p> <input type="submit" name="OK" /> </p> <ul id="savedData"> </ul> </form> </body> </html>

    Read the article

  • How to measure a canvas that has auto height and width

    - by Wymmeroo
    Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

< Previous Page | 628 629 630 631 632 633 634 635 636 637 638 639  | Next Page >