Search Results

Search found 26142 results on 1046 pages for 'javascript alert'.

Page 637/1046 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • Is it possible to create a timer in jscript that you can manually change without it being affected by timezones?

    - by Lixorp
    is it possible to create a timer where I can manually set the hours each day to a set number of hours but still remains accurate? For example; if I set the countdown for 5 hours at 2pm I want the timer to stop as soon as it hits 7pm. Also, when I set the timer for 5 hours I would like everyone in the world to see it countdown from 5 hours, no matter what the time is in their country. In the format: days hours minutes seconds. The reason I want to do this is for a streamer's website. He needs a flexible timer which can be manually changed and is the same worldwide for his viewers to know when he starts streaming. The current timer we're using at the moment; setInterval(function(){ var currentTime = new Date(); if(currentTime.getHours() > 19){ var countdownHours = (24 - currentTime.getHours()) + 19; }else if(currentTime.getHours() < 19){ var countdownHours = 19 - currentTime.getHours(); }else{ var countdownHours = 0; } var countdownMins = 59 - currentTime.getMinutes(); var countdownSecs = 60 - currentTime.getSeconds(); $('#countdown-days h1').text('0'); $('#countdown-hours h1').text(countdownHours); $('#countdown-minutes h1').text(countdownMins); $('#countdown-seconds h1').text(countdownSecs); }, 1000); As you can tell it isn't ideal for what we need it for since it counts down to 7pm in the timezone you're in. Any help/examples would be greatly appreciated, Thank you in advance, Lixorp.

    Read the article

  • The SVG text node disappear after change its text content

    - by sureone
    svg: <text xml:space="preserve" y="228" x="349.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_b">cur_b</text> <text xml:space="preserve" y="222" x="103.98" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_a">cur_a</text> <text xml:space="preserve" y="229" x="590.0211" text-anchor="middle" stroke-width="0" stroke-linejoin="null" stroke-linecap="null" stroke-dasharray="null" stroke="#000000" fill="#000000" style="cursor: move; pointer-events: inherit;" font-size="24" font-family="serif" id="cur_c">cur_c</text> NSString* theJS = @ "var theNode0 = document.getElementById('cur_a'); theNode0.textContent='200A'; theNode0.setAttribute('fill','#FF0000'); var theNode1 = document.getElementById('cur_c'); theNode1.textContent='200A'; theNode1.setAttribute('fill','#00FF00');" [self.webView stringByEvaluatingJavaScriptFromString:theJS]; The SVG text node value is changed but disappeared after about one second.

    Read the article

  • jQuery trigger custom event synchronously?

    - by Miguel Angelo
    I am using the jQuery trigger method to call an event... but it behaves inconsistently. Sometimes it call the event, sometimes it does not. <a href="#" onclick=" $(this).trigger('custom-event'); window.location.href = 'url'; return false; ">text</a> The custom-event has lots of listeners added to it. It is as if the trigger method is not synchronous, allowing the window.location.href be changed before executing the events. And when window.location.href is changed a navigation occurs, interrupting everything. How can I trigger events synchronously? Using jQuery 1.8.1. Thanks! EDIT I have found that the event, when called has a stack trace like this: jQuery.fx.tick (jquery-1.8.1.js:9021) tick (jquery-1.8.1.js:8499) jQuery.Callbacks.self.fireWith (jquery-1.8.1.js:1082) jQuery.Callbacks.fire (jquery-1.8.1.js:974) jQuery.speed.opt.complete (jquery-1.8.1.js:8991) $.customEvent (myfile.js:28) This proves that jQuery trigger method is asynchronous. Oohhh my... =\

    Read the article

  • More compact way to do this?

    - by Macha
    I have a couple of functions that loop around the surrounding cells of a cell. The grid is contained inside an array. In my code, I have checks to make sure it's not one of the edge cells, as checking an undefined cell causes an error. As such, I have code like this: if(x > 0) { var firstX = x - 1; } else { var firstX = x; } if(x < 199) { var lastX = x + 1; } else { var lastX = x; } if(y > 0) { var firstY = y - 1; } else { var firstY = y; } if(y < 199) { var lastY = y + 1; } else { var lastY = y; } A lot of lines of code to do very little. Is there a more elegant way to do this?

    Read the article

  • How to disable the delete button using if condition in Extjs

    - by sample
    How to disable the delete button using if condition in Extjs for ex;i want to disable the button if it satifies the given if condition else remain enabled. if(validAction(entityHash.get('entity.xyz'),actionHash.get('action.delete'))) This is the grid Delete button code. Ext.reg("gridheaderbar-inActive", Ad.GridInActiveButton,{ xtype: 'tbspacer', width: 5 }); Ad.GridCampDeleteButton = Ext.extend(Ext.Toolbar.Button, { //text: 'Delete', cls: 'ad-img-button', width:61, height:40, iconCls: 'ad-btn-icon', icon: '/webapp/resources/images/btn_del.png', handler:function(){ statusChange(this.parentBar.parentGrid, 'Delete') } });

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • How to achieve jQuery scrolling/overlay effect (video in description)

    - by waffl
    I have two columns. The left column contains text of dynamic lengths. The right column is of fixed height and will contain a set of images selected at random per page load. I am trying to create an effect where while the user scrolls, the Image 2 scrolls above Image 1. When it reaches the top, the Image 1 begins to scroll up until it disappears, then Image 3 comes in and repeats the process. As this is rather confusing, I made a short video describing the desired effect. Video - MP4 I have begun trying to get it working in this jsbin but am at a loss for when the user scrolls back down and also when more images are required. I am thinking my current path is not the right direction. I'm thinking that employing something like jQuery waypoints is more the direction I should be pursuing?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do i Convert a Select to a Checkbox

    - by streetparade
    That sounds pretty odd but i have this cod and i need to convert it to checkbox, with the same functionalities <select onchange="document.getElementById('reasonDiv{$test->id}').style.display = ''; document.getElementById('reason{$test->id}').value = this.value;" name='reasonId{$test->id}' id='reasonId{$test->id}'> <option value=''>Test</option> {foreach item=test from=$testtmp.6} <input type="checkbox" value='{include file='testen.tpl' blog=$test1 member=$test2 contents=$test->contents replyId=$test->predefinedreplyid }' label='{$test->predefinedreplyid}' {if $test->predefinedreplyid==$test1->declineId}selected="selected"{/if}>{$test->subject}</option> {/foreach} </select> How can i do that? Thanks for help

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Can't get jQuery and IE to be friends

    - by Matthew
    Using jQuery and the Cycle plugin. Runs flawless in Safari, Chrome, Firefox, and the latest version of Opera. Won't run in older versions of Opera, and of course, IE. I know its running Java, because its picking up the rollovers. This is driving me batty. Hopefully its something simple. Here's the code... $(document).ready(function() { $("#slideshow").css("overflow", "hidden"); $("div#slides").cycle({ fx: 'scrollHorz', speed: 'slow', timeout: 0, prev: '#prev', next: '#next' }); Really appreciate the help guys.

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Expected Expression

    - by coffeeaddict
    I cannot figure out what I did or did not do here syntactically to cause this error. I don't see what's missing: function ShowWaitMessage(button) { var isValid; if (buttonSelected()) { showWaitMessage(button, "showMessage1"); isValid = true; } else { Page_ClientValidate(); if (Page_IsValid) { showWaitMessage(button, "showMessage2"); isValid = true; } } return isValid; }

    Read the article

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • Redirect Using jQuery

    - by tshauck
    Hi, So I'm using jquerymobile for an app I'm creating. I have a link that if all the validation passes I'd like to go through, but if something fails I'd like to redirect. In the jquery something like this. Since it is jquerymobile the link will be a new div on the same index.html page - if that helps. $(#link).click(function(){ if(validation_fails) link_elsewhere; else return true; }

    Read the article

  • Disable a form and all contained elements until an ajax query completes (or another solution to prev

    - by Max Williams
    I have a search form with inputs and selects, and when any input/select is changed i run some js and then make an ajax query with jquery. I want to stop the user from making further changes to the form while the request is in progress, as at the moment they can initiate several remote searches at once, effectively causing a race between the different searches. It seems like the best solution to this is to prevent the user from interacting with the form while waiting for the request to come back. At the moment i'm doing this in the dumbest way possible by hiding the form before making the ajax query and then showing it again on success/error. This solves the problem but looks horrible and isn't really acceptable. Is there another, better way to prevent interaction with the form? To make things more complicated, to allow nice-looking selects, the user actually interacts with spans which have js hooked up to them to tie them to the actual, hidden, selects. So, even though the spans aren't inputs, they are contained in the form and represent the actual interactive elements of the form. Grateful for any advice - max. Here's what i'm doing now: function submitQuestionSearchForm(){ //bunch of irrelevant stuff var questionSearchForm = jQuery("#searchForm"); questionSearchForm.addClass("searching"); jQuery.ajax({ async: true, data: jQuery.param(questionSearchForm.serializeArray()), dataType: 'script', type: 'get', url: "/questions", success: function(msg){ //more irrelevant stuff questionSearchForm.removeClass("searching"); }, error: function(msg){ questionSearchForm.removeClass("searching"); } }); return true; }

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >