Search Results

Search found 26142 results on 1046 pages for 'javascript alert'.

Page 640/1046 | < Previous Page | 636 637 638 639 640 641 642 643 644 645 646 647  | Next Page >

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • How to determine which enemy is hit and destroy it alone

    - by Jon Ferriter
    http://jsfiddle.net/5DB6K/ I have this game being made where you shoot enemies from the sides of the screen. I've got the bullets moving and being removed when they reach the end of the screen (if they didn't hit any enemy) and removing the enemy when they collide with it. //------------collision----------------// if(shot === true){ bulletY = $('.bullet').position().top + 2; bulletX = $('.bullet').position().left + 2; $('.enemy').each(function(){ if($('.enemy').hasClass('smallEnemy')){ enemyY = $(this).position().top + 7; enemyX = $(this).position().left + 7; if(Math.abs(bulletY - enemyY) <= 9 && Math.abs(bulletX - enemyX) <=9){ $(this).remove(); score = score + 40; bulletDestroy(); } } }); } However, the bullet destroys every enemy if the collision check is right which isn't what I want. I want to check if the enemy has the class of either smallEnemy, medEnemy, or lrgEnemy and then do the collision check which is what I thought I had but it doesn't seem to work. Also, the game starts to lag the more and more time goes on. Would anyone know the reason for that?

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Same function on multiple div classes doesn't work

    - by Sebass van Boxel
    I'm doing something terribly wrong and just can't find the solution for it. Situation: I've got a number of products with a number of quotes per product. Those quote automatically scroll in a div. If the scroll reaches the last quote is scroll back to the first one. What works: The function basically works when it's applied on 1 div, but when applied on multiple div it doesn't scroll back to the first one or keeps scrolling endlessly. This is the function i've written for this: function quoteSlide(divname){ $total = ($(divname+" > div").size()) $width = $total * 160; $(divname).css('width', ($width)); console.log ($totalleft *-1); if ($width - 160 > $totalleft *-1){ $currentleft = $(divname).css('left'); $step = -160; $totalleft = parseInt($currentleft)+$step; }else{ $totalleft = 0; } $(divname).animate(     { left: $totalleft }, // what we are animating     'slow', // how fast we are animating     'swing', // the type of easing     function() { // the callback }); } It's being executed by something like: quoteSlide('#quotecontainer_1'); in combination with a setInterval so it keeps scrolling automatically. This is the jsFiddle where it goes wrong (So applied on more than 1 div) http://jsfiddle.net/FsrbZ/. This is the jsFiddle where everything goes okay. (applied on 1 div) When changing the following: quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); setInterval(function() { quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); }, 3400);? to quoteSlide('#quotecontainer_1'); setInterval(function() { quoteSlide('#quotecontainer_1'); }, 3400);? it does work... but only on 1 quotecontainer.

    Read the article

  • Changing class of h2 inside specific div

    - by user1985060
    I want to make it so that everytime you click on an 'h2' tag, the 'input' inside gets selected and the 'h2' tag changes background, but if another 'h2' tag is clicked, the current highlight and 'input' selection changes accordingly. problem is that I have 3 different that do the same and with my code all the 3 forms are affected rather one. How do i limit my changes to only be contained to that form. Here is some code for clarification ' <form> ... <h2 onclick="document.getElementById(1001).checked='True' $('h2').removeClass('selected'); $(this).addClass('selected'); "> CONTENT <input type="radio" name="radio" id="1001" value="1001" /> </h2> ... </form>

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • ANy way to fix the position of image

    - by Mirage
    I have an image on the left hand side and text on right side. Like two column layout. I want that when i scroll the text then the image should stay at center of page. I tried using position:fixed But then the problem , sometimes when i resize the IE window to small size then the image stay at same position and it comes out of the main content area when i scroll down. I want that image should scroll but should stay within the content area . It should not move outsid ethe main content aqrea

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Another way to handle a common JQuery event handling pattern

    - by bradgonesurfing
    I have the following code for example $("a.foo").bind(function (e){ var t; if ( $(e.target).is("a") ){ t = $(e.target); }else{ t = $(e.target).parent("a"); } var data = t.attr("data-info"); }); In english. I might have a list of anchors within which there may be a number of spans. Each anchor is declared as <a class="foo" href="#" data-info="1"> <span> ... </span> <span> ... </span> </a> <a class="foo" href="#" data-info="2"> <span> ... </span> <span> ... </span> </a> ... ... I bind a handler to the click event of the anchor but the event object comes back with the anchor OR one of the spans depending on where I click. So to get my html5 "data-info" value into the callback I have to insert a bit of messy code. This is now appearing throughout my code to the point where I am guessing there might be an idiomatic JQuery way of handling this.

    Read the article

  • Looking for a full list of jQuery event types.

    - by serg555
    Where I can find a complete list of all jQuery supported events (like click, mouseup etc) with some explanations when they are triggered? I am looking for those that can be binded: $('#foo').bind('click', handler); For example I just found out by accident that there is paste event but I can't find any references to it anywhere in their docs. What else is there?

    Read the article

< Previous Page | 636 637 638 639 640 641 642 643 644 645 646 647  | Next Page >