Search Results

Search found 26142 results on 1046 pages for 'javascript alert'.

Page 640/1046 | < Previous Page | 636 637 638 639 640 641 642 643 644 645 646 647  | Next Page >

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • How to determine which enemy is hit and destroy it alone

    - by Jon Ferriter
    http://jsfiddle.net/5DB6K/ I have this game being made where you shoot enemies from the sides of the screen. I've got the bullets moving and being removed when they reach the end of the screen (if they didn't hit any enemy) and removing the enemy when they collide with it. //------------collision----------------// if(shot === true){ bulletY = $('.bullet').position().top + 2; bulletX = $('.bullet').position().left + 2; $('.enemy').each(function(){ if($('.enemy').hasClass('smallEnemy')){ enemyY = $(this).position().top + 7; enemyX = $(this).position().left + 7; if(Math.abs(bulletY - enemyY) <= 9 && Math.abs(bulletX - enemyX) <=9){ $(this).remove(); score = score + 40; bulletDestroy(); } } }); } However, the bullet destroys every enemy if the collision check is right which isn't what I want. I want to check if the enemy has the class of either smallEnemy, medEnemy, or lrgEnemy and then do the collision check which is what I thought I had but it doesn't seem to work. Also, the game starts to lag the more and more time goes on. Would anyone know the reason for that?

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Same function on multiple div classes doesn't work

    - by Sebass van Boxel
    I'm doing something terribly wrong and just can't find the solution for it. Situation: I've got a number of products with a number of quotes per product. Those quote automatically scroll in a div. If the scroll reaches the last quote is scroll back to the first one. What works: The function basically works when it's applied on 1 div, but when applied on multiple div it doesn't scroll back to the first one or keeps scrolling endlessly. This is the function i've written for this: function quoteSlide(divname){ $total = ($(divname+" > div").size()) $width = $total * 160; $(divname).css('width', ($width)); console.log ($totalleft *-1); if ($width - 160 > $totalleft *-1){ $currentleft = $(divname).css('left'); $step = -160; $totalleft = parseInt($currentleft)+$step; }else{ $totalleft = 0; } $(divname).animate(     { left: $totalleft }, // what we are animating     'slow', // how fast we are animating     'swing', // the type of easing     function() { // the callback }); } It's being executed by something like: quoteSlide('#quotecontainer_1'); in combination with a setInterval so it keeps scrolling automatically. This is the jsFiddle where it goes wrong (So applied on more than 1 div) http://jsfiddle.net/FsrbZ/. This is the jsFiddle where everything goes okay. (applied on 1 div) When changing the following: quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); setInterval(function() { quoteSlide('#quotecontainer_1'); quoteSlide('#quotecontainer_2'); }, 3400);? to quoteSlide('#quotecontainer_1'); setInterval(function() { quoteSlide('#quotecontainer_1'); }, 3400);? it does work... but only on 1 quotecontainer.

    Read the article

  • drawImage don't work on chrome extention

    - by shrwea
    I use canvas drawImage in popup.html. But it doesn't work. Please advise me. popup.html <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> </head> <body> <canvas id="test"></canvas> <script src="test.js"></script> </body> </html> test.js var image = document.createElement("img"); image.src = "test.png"; image.onload = function(){ var canvas = document.getElementById('test'); var ctx = canvas.getContext('2d'); ctx.drawImage(image, 0, 0); }

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • A HREF URL won't work

    - by user3586248
    I am trying to get the following link to work. <a href='#' onclick='window.open(" | &ESPP_Info_URL | ");return false;'>Employee Stock Purchase Plan Information</a> Basically the &ESPP_Info_URL variable takes in a url so that the code below looks like... <a onclick="window.open(https://...);return false;" href="#">Employee Stock Purchase Plan Information</a> But when I click the url it just refreshes the page. Does anyone know how to get this to access the link within the window.open function?

    Read the article

  • Another way to handle a common JQuery event handling pattern

    - by bradgonesurfing
    I have the following code for example $("a.foo").bind(function (e){ var t; if ( $(e.target).is("a") ){ t = $(e.target); }else{ t = $(e.target).parent("a"); } var data = t.attr("data-info"); }); In english. I might have a list of anchors within which there may be a number of spans. Each anchor is declared as <a class="foo" href="#" data-info="1"> <span> ... </span> <span> ... </span> </a> <a class="foo" href="#" data-info="2"> <span> ... </span> <span> ... </span> </a> ... ... I bind a handler to the click event of the anchor but the event object comes back with the anchor OR one of the spans depending on where I click. So to get my html5 "data-info" value into the callback I have to insert a bit of messy code. This is now appearing throughout my code to the point where I am guessing there might be an idiomatic JQuery way of handling this.

    Read the article

  • Changing class of h2 inside specific div

    - by user1985060
    I want to make it so that everytime you click on an 'h2' tag, the 'input' inside gets selected and the 'h2' tag changes background, but if another 'h2' tag is clicked, the current highlight and 'input' selection changes accordingly. problem is that I have 3 different that do the same and with my code all the 3 forms are affected rather one. How do i limit my changes to only be contained to that form. Here is some code for clarification ' <form> ... <h2 onclick="document.getElementById(1001).checked='True' $('h2').removeClass('selected'); $(this).addClass('selected'); "> CONTENT <input type="radio" name="radio" id="1001" value="1001" /> </h2> ... </form>

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

< Previous Page | 636 637 638 639 640 641 642 643 644 645 646 647  | Next Page >