Search Results

Search found 26142 results on 1046 pages for 'javascript alert'.

Page 639/1046 | < Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >

  • How to add "Back to top" link at bottom at <div> is browser window is shorter than page, using jquer

    - by metal-gear-solid
    How to add "Back to top" link at bottom at is browser window is shorter than page, using jquery? <div id="mainContent"> <p>Some content</p> </div> If some content is bigger than browser window ( I mean if vertical bar comes on the page) then i want to add Back to top just before closing the div. <div id="mainContent"> <p>Some content</p> <p>Some content</p> <p>Some content</p> <a href="#"> Back to top </a> </div>

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Write a completely fluid HTML page (using '%' instead of 'px' for EVERY element height/width)

    - by barak manos
    I am designing my HTML pages to be completely fluid: For every element in the mark-up (HTML), I am using 'style="height:%;width:%"' (instead of 'style="height:*px;width:*px"'). This approach seems to work pretty well, except for when changing the window measurements, in which case, the web page elements change their position and end up "on top of each other". I have come up with a pretty good run-time (java-script) solution to that: var elements = document.getElementsByTagName("*"); for (var i=0; i < elements.length; i++) { if (elements[i].style.height) elements[i].style.height = elements[i].offsetHeight+"px"; if (elements[i].style.width ) elements[i].style.width = elements[i].offsetWidth +"px"; } The only problem remaining is, that if the user opens up the website by entering the URL into a non-maximized window, then the page fits that portion of the window. Then, when maximizing the window, the page remains in its previous measurements. So in essence, I have solved the initial problem (when changing the window measurements), but only when the window is initially in its maximum size. Any ideas on how to tackle this problem? (given that I would like to keep my "% page-design" as is).

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • jquery autocomplete extra spaces

    - by elasticrash
    I got this loop in a jsp file <% for (int i = 0; i < length; i++) { for( int j = 0; j < width; j++) { element = MAP_LIST[j][i]; if (element.equals("A")) {} else if (j == width-1 && i == length-1){ %> <%=element%><%} else { %> <%=element%>,<%} } } %> which gets me a csv list from an oracle database for my autocomplete text field by using jquery function Mapsheets(type,nomos) { $(function() { var f_data; $.get('/gaec_web/MapSheets.jsp',{'datasrc-select':datasource, 'type_1': type, 'nomos': nomos}, function(data){ f_data = data.split(','); $( "#fx_no" ).autocomplete({ source: f_data, minLength: 2 }); }); }); } everything works like a charm, i type the first 2 chars and the autocomplete pops up displays every thing as it was supposed to and when I try to pick a value i get the value with several (5) extra spaces in the tail. And then when it gets submitted it fails cause it doesnt match the mapname in question. the results look like this " 320-197" So what is causing this? if i run the jsp page alone also get normal results for example 372-146, 376-146, 372-149, 368-149, 376-149, 380-149, 380-152, 376-152, 372-152, 368-152, 368-155, 376-155, 372-155, 380-155, 368-158, 380-158, 376-158, 372-158 thanks in advance

    Read the article

  • Expected Expression

    - by coffeeaddict
    I cannot figure out what I did or did not do here syntactically to cause this error. I don't see what's missing: function ShowWaitMessage(button) { var isValid; if (buttonSelected()) { showWaitMessage(button, "showMessage1"); isValid = true; } else { Page_ClientValidate(); if (Page_IsValid) { showWaitMessage(button, "showMessage2"); isValid = true; } } return isValid; }

    Read the article

  • How to search with parameters in MVC?

    - by SnowJim
    Hi, I need to be able to provide a page for the end user where thay can search in the following : Search work Category Price AdType Location and so on. Its important that the user can copy the url and then use it later(and get the same settings). Its also important to be able to save these settings on the user in the database. So far I have created a ModelView class that contains the parameters but I am not sure that this is the right way to go? Maby I should pass all inte the URL. If so, how do I accomplish this? Is there any samples I could look at? BestRegards

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • ADO Execute not reading a line of SQL code?

    - by llaskin
    My code is below: var statement = "test_oracle.sql"; F = aqFile.OpenTextFile(statement, aqFile.faRead, aqFile.ctANSI); F.Cursor = 0; while(! F.IsEndOfFile()){ s = F.ReadLine(); oResult = Project.Variables.oConnection.Execute_(s); CheckResult(oResult, "Unable to run SQL script to add documents"); The first line that "s" reads is: set serverout on size 10000 An error is returned as "ORA-00922: missing or invalid option" Can anyone provide guidance?

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

< Previous Page | 635 636 637 638 639 640 641 642 643 644 645 646  | Next Page >