Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 643/1105 | < Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • ADO Execute not reading a line of SQL code?

    - by llaskin
    My code is below: var statement = "test_oracle.sql"; F = aqFile.OpenTextFile(statement, aqFile.faRead, aqFile.ctANSI); F.Cursor = 0; while(! F.IsEndOfFile()){ s = F.ReadLine(); oResult = Project.Variables.oConnection.Execute_(s); CheckResult(oResult, "Unable to run SQL script to add documents"); The first line that "s" reads is: set serverout on size 10000 An error is returned as "ORA-00922: missing or invalid option" Can anyone provide guidance?

    Read the article

  • Jquery - $.(post) data response not consistent with PHP

    - by Sasha
    Jquery code: var code = $('#code'), id = $('input[name=id]').val(), url = '<?php echo base_url() ?>mali_oglasi/mgl_check_paid'; code.on('focusout', function(){ var code_value = $(this).val(); if(code_value.length != 16 ) { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; code.after('<p role=code_msg>Pogrešan kod je unešen.</p>'); } else { if ($('p[role=code_msg]').length != 0 ) $('p[role=code_msg]').remove() ; $.post(url, {id : id, code : code_value}, function(data){ if(data != 'TRUE'){ code.after('<p role=code_msg>Uneti kod je neispravan.</p>'); } else { code.after('<p role=code_msg>Status malog oglasa je promenjen.</p>'); code.after(create_image()); code.remove(); } }); } }); PHP (Codeigniter) code: function mgl_check_paid() { $code = $this->input->post('code'); $id = $this->input->post('id'); echo ($this->mgl->mgl_check_paid($code, $id)) ? 'TRUE' : 'FALSE'; } Problem is following: When code is sent and if it is correct, PHP part will echo TRUE, and JS will execute ELSE part (after post), but for some reason it is not doing that (it is executing the first part of the statment)? What is wrong with this code?

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Detecting when HTML5 audio is finished playing (more than once)?

    - by user386911
    I am having a problem detecting when an tag is finished playing an mp3. When I do something like this: myAudio.addEventListener("ended", function() { alert("ended"); }); It only occurs the first time the audi is played. When I play the audio again, nothing happens. The same thing occurs when I use the onended=doThis(); method. I've heard maybe there is a way to do it in jquery, but I haven't been able to get it to work. I've also heard there might be a way to fix it by changing the audio div id everytime the mp3 is played, but this doesn't work for me because I need the id to stay the same. Anyone got any ideas?

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Problem with sending "SetCookie" first in php code

    - by Camran
    According to this manual: http://us2.php.net/setcookie I have to set the cookie before anything else. Here is my cookie code: if (isset($_COOKIE['watched_ads'])){ $expir = time()+1728000; //20 days $ad_arr = unserialize($_COOKIE['watched_ads']); $arr_elem = count($ad_arr); if (in_array($ad_id, $ad_arr) == FALSE){ if ($arr_elem>10){ array_shift($ad_arr); } $ad_arr[]=$ad_id; setcookie('watched_ads', serialize($ad_arr), $expir, '/'); } } else { $expir = time()+1728000; //20 days $ad_arr[] = $ad_id; setcookie('watched_ads', serialize($ad_arr), $expir, '/'); } As you can see I am using variables in setting the cookie. The variables comes from a mysql_query and I have to do the query first. But then, if I do, I will get an error message: Cannot modify header information - headers already sent by ... The error points to the line where I set the cookie above. What should I do?a

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Best way to make sure I get all available options array/loop

    - by jaz872
    OK, here is my problem. I'm looking for the best way to loop through a bunch of options to make sure that I hit all available options. Some detail. I've created a feature that allows a client to build images that are basically other images layered on top of each other. These other images are split up into different groups. They have links on the side of the image that they can click to scroll through all the different images to view them. I'm now making an automated process that is going to run the function that changes the image when a user clicks one of the links. I need to make sure that every possible combo of the different images is hit during this process. So I have an array with the number of options for each group. The current array is [3, 9, 3, 3] My question is what is the best way to loop through this to make sure that all possible options will be shown? I apologize if this seems simple for someone out there, but I'm just having trouble wrapping my head around it. Hopefully if that person is out there, they can give a helping hand :)

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Opera bug with JS autoselecting text (if more than 1 div)

    - by E L
    Here is HTML code. It supposed to select all text in "Container" div <B onclick="SelectText(document.getElementById('Container'));">select all text</B> <Div id="Container"> <Div>123456</Div> <Div>123456</Div> <Div onclick="SelectText();">123456</Div> </Div> here is JS code of the SelectText() function function SelectText(target){ if(target==null){ var e = window.event || e; if (!e) var e = window.event; var target=e.target || e.srcElement; } var rng, sel; if ( document.createRange ) { rng = document.createRange(); rng.selectNode( target ); sel = window.getSelection(); sel.removeAllRanges(); sel.addRange( rng ); } else { var rng = document.body.createTextRange(); rng.moveToElementText( target ); rng.select(); } } Problem is that in Opera 12.02 when "select all text" is clicked, all text seems like selected, but it's not selected (I can't rightclick it and copy). (terrific, but IE works fine with it) Why not in Opera?!!! And what can I do to make Opera 12.02 believe that all text in "Container" is selected?

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Real time content editing html5

    - by Mark Lauzon
    So I've seen things like WordPress and FCKEditor, and basically a bunch of stuff that uses external code that I can't see or edit. Whenever I ask about editing and saving the content of a page in real time I just get referenced to an API or I get handed code that only changes the page until it's reloaded. What I want to know is how do I code it myself? I want to add real time content editing to a page without the use of someone else's code. I've checked out code for various forums and wikipedia and whatnot, and all of it references code I don't have access to. Is this a thing? Can I edit a page in real time? I thought of writing the edited text to a file on the server, and then when they click save, reading it back into the code to the section they were editing, but I don't know how to do that or if it's even possible. As a side note, I'm very new to html, but not new to coding. EDIT: The structure can be very much like Wikipedia, it doesn't have to be real time, it just has to work

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >