Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 641/1105 | < Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >

  • Expanding a row in a div-based table

    - by magneticMonster
    I have a stack of <div> elements that show a name. I'd like to include a + link off to the side that, when clicked, expands the <div> and adds more detailed information (from a RoR controller). After poking around on the net, I found link_to_remote and related RoR stuff, but I can't seem to get the right combination to work together. Can someone point me to a tutorial or show what the controller and view interaction should look like? Thanks!

    Read the article

  • Problem with running totals in jquery

    - by rshivers
    I'm having an issue trying to get an accurate running total for my calculations. When you enter numbers into the input field I get an accurate total for that line item, but the grand total comes out to a higher number. Note that this is a dynamic form and that the id's will change depending on how many form fields I have added to the form. Also, I have it set to make the calculations onKeyUp for each input field instead of a calculate button. The code that calculates a single item is this: function calcLineItem(id) { var id = $(id).attr("id"); var Item1 = $("#Item1" + id).val(); var Item2 = $("#Item2" + id).val(); var Item3 = $("#Item3" + id).val(); function calcTotal(Item1, Item2, Item3){ var total; total = Math.round((Item1 * Item2) * Item3); return total; } $("#total" + id).text(calcTotal(Item1, Item2, Item3)); calcAllFields(); } This will give me the total of this particular input field. The function at the end, calcAllFields(), is supposed to do the calculations for all items in my form to give me the grand total of all input fields: function calcAllFields(id) { var id = $(id).attr("id"); $('#target1').text($("#total" + id).map(function() { var currentValue = parseFloat(document.getElementById("currentTotal").value); var newValue = parseFloat($("#total" + id).text()); var newTotal = currentValue + newValue; document.getElementById("currentTotal").value = newTotal; return newTotal; }).get().join()); } The variable currentTotal is getting its value from a hidden field on my form: <input type="hidden" id="currentTotal" value="0"> As I enter numbers a field the calculation for that line will be accurate, but the grand total will be inaccurate because the value for currentTotal will continue to increment with every key stroke I make in the input field. Any ideas on how to avoid this from happening?

    Read the article

  • auto_complete plugin error: Couldn't find Question with ID=auto_complete_for_...

    - by bgadoci
    I have successfully set up this plugin before so I am curious as to what I am doing wrong here. I have built the ability for users to add tags to questions. I am not using tagging plugin here but that shouldn't matter for this. With respect to the auto complete, I am trying to have the form located in the /views/questions/show.html.erb file access the Tags table and display entries in the tags.tags_name column. When I begin to type in the field I get the following error message: Processing QuestionsController#show (for 127.0.0.1 at 2010-05-31 15:22:20) [GET] Parameters: {"tag"=>{"tag_name"=>"a"}, "id"=>"auto_complete_for_tag_tag_name"} Question Load (0.1ms) SELECT * FROM "questions" WHERE ("questions"."id" = 0) ActiveRecord::RecordNotFound (Couldn't find Question with ID=auto_complete_for_tag_tag_name): app/controllers/application_controller.rb:15:in `init_data' For some reason I am actually passing the field name as the Question.id. The plugin set up is fairly simple as you add the following line to your controller: auto_complete_for :tag, :tag_name and the following line in your routes.rb file: map.resources :tags, :collection => {:auto_complete_for_tag_tag_name => :get } I have added the controller line to both my tags and questions controller and also mapped resources for both tags and questions in my routes.rb file: map.resources :tags, :collection => {:auto_complete_for_tag_tag_name => :get } map.resources :questions, :collection => {:auto_complete_for_tag_tag_name => :get } I have played around with removing either or of the above but can't seem to fix it. Any ideas what I am doing wrong here? UPDATE: My QuestionsController#show action is fishing posts by: @question = Question.find(params[:id])

    Read the article

  • jquery ajax: headers seem to not be working

    - by Will
    hello, i am trying to get the headers of an ajax request i made through jquery $.get(url, function(response, textStatus, headers ) { console.log("Response: %o", response); console.log("TextStatus: %o", textStatus); console.log("Request: %o", headers); } ); this does not seem to be working however: the response and textstatus are printing, but the "headers" object seems to be undefined i simply want to check if it is what i expect (content type='excel', etc) or if the response type is html, i can assume the page i was calling is an error

    Read the article

  • Jquery return value

    - by Anton
    I used a code: jQuery.fn.MyFunction = function(){ return this.each(function() { attributes = "test"; return attributes; });} But when I call var1 = $(this).MyFunction();alert(var1); I got an [object], but not the "test". How to allow jquery plugin return a some value?

    Read the article

  • Bind event to AJAX populated list items

    - by AnPel
    I have an unordered list with no list items. I get some information from the user, I run it through my database using AJAX and the servers sends back a JSON object response. Then I append each list item I want to display to the list using something like $('blabla').append('<li>information</li>') My question is, since the li elements were not there at the time the DOM was ready, how can I bind a click event to them? Here is my full code: $(function(){ var timer; $('#f').keyup(function(){ clearTimeout(timer); timer = setTimeout(getSuggestions, 400); }); }) function getSuggestions(){ var a = $('#f')[0].value.length; if( a < 3){ if(a == 0){ $('#ajaxerror').hide(300,function(){ $('#loading').hide(300,function(){ $('#suggest').hide(300) }) }) } return; } $('#loading').slideDown(200,function(){ $.ajax({ url: '/models/AJAX/suggest.php', dataType: 'json', data: {'data' : $('#f')[0].value }, success: function(response){ $('#ajaxerror').hide(0,function(){ $('#loading').hide(100,function(){ $('#suggest ul li').remove(); for(var b = 0; b < ( response.rows * 3); b = b + 3){ $('#suggest ul').append('<li>'+response[b]+' '+response[b+1]+' '+response[b+2]+'</li>') // MISSING SOME CODE HERE TO BIND CLICK EVENT TO NEWLY CREATED LI } $('#suggest').show(300) }) }) }, error: function(){ $('#suggest').hide(0,function(){ $('#loading').slideUp(100,function(){ $('#ajaxerror').show(300) }) }) } }) }) }

    Read the article

  • Facebook API - Detect if session is active OR NOT active

    - by Tom Doe
    I'm sure I'm simply overlooking something in the Facebook API docs. Basically, after I've loaded the FB Graph, I need to know if the session is active... I cannot simply assume they're logged out and simply re-render if they're logged in once the 'auth.statusChange' event is triggered. I need to know right off the bat. Below is the code that I've used. Most importantly the FB.getLoginStatus/getAuthResponse/getAccessToken don't work like I'd expect; essentially where it indicates, when invoked, whether they're logged in or out. (function(d) { // Create fb-root var fb_root = document.createElement('div'); fb_root.id = "fb-root"; document.getElementsByTagName('body')[0].appendChild( fb_root ); // Load FB Async var js, id = 'facebook-jssdk', ref = d.getElementsByTagName('script')[0]; if (d.getElementById(id)) {return;} js = d.createElement('script'); js.id = id; js.async = true; js.src = "//connect.facebook.net/en_US/all.js"; ref.parentNode.insertBefore(js, ref); // App config-data var config = { appId : XXXX, cookie: true, status: true, frictionlessRequests: true }; window.fbAsyncInit = function() { // This won't work. // I can't assume they're logged out and rely on this to tell me they're logged in. FB.Event.subscribe('auth.statusChange', function(response) {}); // Init FB.init(config); // These do not inidicate if the user is logged out :( FB.getLoginStatus(function(response) { }); FB.getAuthResponse(function(response) { }); FB.getAccessToken(function(response) { }); }; }(document)); Any help is much appreciated. :)

    Read the article

  • JQuery Mobile bind event to listview

    - by nycynik
    I am trying to add a vclick to a dynamic JQM listview. But I can not figure out how to identify which number is being clicked. http://jsfiddle.net/2hR9w/ for (var x=0; x<2; x++ ) { $("#listitem"+x).bind("vclick",function(e) { console.log("clicked"+x); }); console.log(x); } ? Something is wrong with the code, but i can't figure out why x is always the max loop value, since I feel like it should be set at the time of the loop. it always reads clicked2, never clicked1.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Background position image overlay (Works in IE, not in Mozilla/Chrome/Safari)

    - by amm229
    Hi all, I am having an issue positioning a background image using the following jquery background position command in Firefox, Google Chrome, and Safari. The code works correctly in IE 8. $('#element).css({ backgroundPosition: 'xpx ypx' }); The x position of the image is calculated dynamically based on window size and the y position is static. The css appears to be modified correctly, however, the background image I am attempting to overlay is absent. See jscript code below: $(window).resize(function () { // image positioning variables var windowwidth = $(window).width(); var imgwidth = $('#imgFluid').width(); var offset = $('#divFluidBlur').offset(); // calculate and implement position blurPositionLeft = (windowwidth - imgwidth) - offset.left; $('#divFluidBlur').css({ backgroundPosition: blurPositionLeft + 'px' + ' 30px' }); // debug: display actual css Background Position of element to text box $("#txtActualBackgroundpos").val(document.getElementById ("divFluidBlur").style.backgroundPosition); Thanks in advance for your help, Andrew

    Read the article

  • Changing class of h2 inside specific div

    - by user1985060
    I want to make it so that everytime you click on an 'h2' tag, the 'input' inside gets selected and the 'h2' tag changes background, but if another 'h2' tag is clicked, the current highlight and 'input' selection changes accordingly. problem is that I have 3 different that do the same and with my code all the 3 forms are affected rather one. How do i limit my changes to only be contained to that form. Here is some code for clarification ' <form> ... <h2 onclick="document.getElementById(1001).checked='True' $('h2').removeClass('selected'); $(this).addClass('selected'); "> CONTENT <input type="radio" name="radio" id="1001" value="1001" /> </h2> ... </form>

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • XMLHttpRequest.status always returning 0

    - by Michael
    html <a href="#" onclick="MyObj.startup()">click me</a> js code var MyObj = { startup : function() { var ajax = null; ajax = new XMLHttpRequest(); ajax.open('GET', 'http://www.nasa.gov', true); ajax.onreadystatechange = function(evt) { if(ajax.readyState == 4) { if (ajax.status == 200) { window.dump(":)\n"); } else { window.dump(":(\n"); } } } ajax.send(null); } } ajax.status always returning 0, no matter which site it is, no matter what is the actual return code. I say actual, because ajax.statusText returning correct value, eg OK or Redirecting... ajax.readyState also returns proper values and 4 at the end.

    Read the article

  • Is there a jQuery plugin for making a step-by-step type presentation?

    - by Earlz
    Hello, I was making a small thing in HTML and basically I have some "frames" like <div id="frame_1"> ... </div> <div id="frame_2"> ... </div> ... Basically what I want is for only one frame to be visible at one time and to navigate between frames easily with previous and next buttons (navigation by frame number a plus, but not required) Before I set out to write it myself I figured someone had already done it so has it been done?

    Read the article

  • allignment issue of div tag

    - by Quasar the space thing
    I am trying to create a web page where on click of a button I can add div tags. What I thought to do was that I'll create two div tags within a single div so that over all presentation will be uniform and similar to a table having two columns and multiple rows and the first column contains only label's and second column will contain textbox. Here is the JS file : var counter = 0; function create_div(type){ var dynDiv = document.createElement("div"); dynDiv.id = "divid_"+counter; dynDiv.class="main"; document.body.appendChild(dynDiv); question(); if(type == 'ADDTEXTBOX'){ ADDTEXTBOX(); } counter=counter+1; } function question(){ var question_div = document.createElement("div"); question_div.class="question"; question_div.id = "question_div_"+counter; var Question = prompt("Enter The Question here:", ""); var node=document.createTextNode(Question); question_div.appendChild(node); var element=document.getElementById("divid_"+counter); element.appendChild(question_div); } function ADDTEXTBOX(){ var answer_div = document.createElement("div"); answer_div.class="answer"; answer_div.id = "answer_div_"+counter; var answer_tag = document.createElement("input"); answer_tag.id = "answer_tag_"+counter; answer_tag.setAttribute("type", "text"); answer_tag.setAttribute("name", "textbox"); answer_div.appendChild(answer_tag); var element=document.getElementById("divid_"+counter); element.appendChild(answer_div); } Here is the css file : .question { width: 40%; height: auto; float: left; display: inline-block; text-align: justify; word-wrap:break-word; } .answer { padding-left:10%; width: 40%; height: auto; float: left; overflow: auto; word-wrap:break-word; } .main { width: auto; background-color:gray; height: auto; overflow: auto; word-wrap:break-word; } My problem is that the code is working properly but both the divisions are not coming in a straight line. after the first div prints on the screen the second divisions comes in another line. How can I make both the div's come in the same line ? Thank You. PS : should I stick with the current idea of using div or should I try some other approach ? like tables ?

    Read the article

  • add html to div with jQuery

    - by mtwallet
    Hi. I am trying to add some additional html to a div with id slideshow using jQuery. My code: $("#slideshow").append("<a id="prev" title="Previous Slide">Previous Slide</a><a id="next" title="Next Slide">Next Slide</a>"); This isn't working, can anyone tell me what I am doing wrong?

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • finding specific immediate children of an element using prototype

    - by tatilans
    Following DOM structure: <ul> <li class="item">yes</li> <li>no</li> <li class="item">yes</li> <li> <ul> <li class="item">no</li> </ul> </li> </ul> Assuming I have the outer <ul> in $ul. How do I get the two immediate children which have the item-class? In jQuery I would write something like this: $ul.children().filter(".item") $ul.children(".item") $ul.find("> .item") How do I to this with Prototype? I tried the following ... $ul.select("> .item") //WRONG ... but it does does exactly the opposite and returns the one inner <li>

    Read the article

  • Jquery: how to sleep or delay?

    - by lazyanno
    i want move up the object, delay 1000ms , then hide it, i get the code: $("#test").animate({"top":"-=80px"},1500) .animate({"top":"-=0px"},1000) .animate({"opacity":"0"},500); i use ".animate({"top":"-=0px"},1000)" to implement delay, it's not good. i want: $("#test").animate({"top":"-=80px"},1500) .sleep(1000) .animate({"opacity":"0"},500); any idea? thanks! :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Highlighting search words like Chrome with jQuery

    - by ilkin
    I have recently done a very simple highlighting with jQuery and a highlight plugin. It looks like this: $('myButton').click(function() { $('body').highlight($('#myInputText').val()); }); But I wonder how can I do the Chrome like highlighting, I mean highlight the letters whenever I type in some letter in textbox without submitting. I think maybe use a keyup event... Any ideas?

    Read the article

< Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >