Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 642/1105 | < Previous Page | 638 639 640 641 642 643 644 645 646 647 648 649  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

  • How to determine which enemy is hit and destroy it alone

    - by Jon Ferriter
    http://jsfiddle.net/5DB6K/ I have this game being made where you shoot enemies from the sides of the screen. I've got the bullets moving and being removed when they reach the end of the screen (if they didn't hit any enemy) and removing the enemy when they collide with it. //------------collision----------------// if(shot === true){ bulletY = $('.bullet').position().top + 2; bulletX = $('.bullet').position().left + 2; $('.enemy').each(function(){ if($('.enemy').hasClass('smallEnemy')){ enemyY = $(this).position().top + 7; enemyX = $(this).position().left + 7; if(Math.abs(bulletY - enemyY) <= 9 && Math.abs(bulletX - enemyX) <=9){ $(this).remove(); score = score + 40; bulletDestroy(); } } }); } However, the bullet destroys every enemy if the collision check is right which isn't what I want. I want to check if the enemy has the class of either smallEnemy, medEnemy, or lrgEnemy and then do the collision check which is what I thought I had but it doesn't seem to work. Also, the game starts to lag the more and more time goes on. Would anyone know the reason for that?

    Read the article

  • submit in html on sql query

    - by user1644661
    i need to run this sql query , which give me a list of Id and Dates i want to click each result and take with me the Id value to the next form i wrote this query above but i see in the debager that the hidden ID get his value but not pass to the next form i think i have a problem with the submit() . where should i put him ? thanks anat function ShowAllCarts($user_email) { $connB = new ProductDAO(); $connB->Connect(); $pro_query = "SELECT * FROM Cart WHERE `Email`='$user_email';"; $db_result = $connB->ExecSQL($pro_query); $html_result = '<div data-role="content"> <ul data-role="listview" data-theme="b"> '; $html_result .= '<form action="PreviouscartProduct.php" method="POST"/>'; while($row_array = $db_result->fetch_array(MYSQLI_ASSOC)) { $Id= $row_array['Id']; $Date= $row_array['Date']; //$html_result // $html_result .="<li><a href='PreviouscartProduct.php'>Cart number: $Id from Date: $Date><input type='hidden' name='Id' value'<?=$Id?>'</input></a></li>'"; $html_result .= '<a onclick="this.form.submit();" </a>; } $html_result .= ' </ul> </div>'; $html_result .= '</form>'; $connB->Disconnect(); return $html_result; } //display all carts $func_result = ShowAllCarts($Email);

    Read the article

  • Page does update with details from the database after i hit a button

    - by swathi
    I have a code and the way it should work is,when they click on NEW CUSTOMER,it takes them to test1.php where in they enter the details and they hit submit.it saves all the details in properly in the database and when i go back and hit REFRESH ,it should come up with the customer details which they had entered in previously. But what happens is, when i click on the REFRESH,it refreshes the same old page which is empty.I wanted to find out where am i missing the logic.Thanks in advance. The sample code would be <tr> <td class="tdvisitbig" colspan="5">THIS IS A TEST</td> </tr> <tr> <td class='tdvisitbig' colspan="5"><input type="button" onClick="openVisit('test1.php?id=<?=$key?>&name=<?=$name?>');return false;" value="NEW CUSTOMER" class="submit">&nbsp;<input type="button" value="REFRESH" name="add_xyz" class="submit" onClick="document.add.target='_self';document.add.action='test3.php?redirect=visit&section=test page';document.add.submit();"></td> </tr> <? $q = "SELECT address,customernum,status FROM customer WHERE name='$name' ORDER BY customernum"; $r = mysql_query( $q , $Link ); while( $rw = mysql_fetch_assoc( $r ) ) { extract( $rw ); ?> <tr> <? } ?>

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 638 639 640 641 642 643 644 645 646 647 648 649  | Next Page >