Search Results

Search found 24406 results on 977 pages for 'javascript namespaces'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 647/977 | < Previous Page | 643 644 645 646 647 648 649 650 651 652 653 654  | Next Page >

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Fetch html page content into a var

    - by Cipher
    Just a small question here, that how do we get fetch the html content via ajax into a variable that I could use later. Right now, I have a button on the click of which, I fetch another html page simply through load method as follows: $('#container').load('http://127.0.0.1/someUrl') I want to get the content into a var instead that I could at a later time use to append to the dom $('#someContainer').append(someVar)

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

  • Can I define which characters are allowed to 'break' a word?

    - by zneak
    Hey guys, I'm showing up veeeery long URLs in my Safari extension. Obviously, they can't fit on a single line. Currently, word breaking rules make it so most URLs are on two lines: the first one is rather short and ends with the ? symbol, and the other is ridiculously long and contains all the rest of the GET parameters. I'd like to make it so words also break on the & symbol, without screwing up copy-paste if possible. I've tried to replace every & with &\u00ad (& + the soft hyphen character), but it's kind of weird to see the hyphen after the & when there really isn't any in the URL. I thought there was something in store with CSS3 for that kind of problem, but I can't find it. Any suggestion welcome, as long as it works with Safari.

    Read the article

  • Get an array of forms in java script using prototype

    - by Saurabh
    My document contains more than one forms. How can I get an array of all forms using prototype? <html> <head></head> <body> <form id="form1"> <!-- Other stuffs here --> </form> <form id="form2"> <!-- Other stuffs here --> </form> <form id="form3"> <!-- Other stuffs here --> </form> </body> </html>

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • This code works fine in Chrome, Firefox but not in IE.

    - by Jeddizero
    Hi, I'm trying to make a jquery tooltip that appears when a user mouses over a link. In my case the link is using display:block style so that it covers a large area. It works perfectly in Chrome and Firefox but in Internet Explorer it doesn't work at all. The tooltip doesn't show, the browsers own tooltip shows etc... IE!!!! http://pastebin.com/1kBaMujV Any ideas? Got to love internet explorer...

    Read the article

  • JQuery: How to find what is between two text points

    - by Sarfraz
    Hello, Let's say I have this: <div id="wrapper"> <pre class="highlight"> $(function(){ // hide all links except for the first $('ul.child:not(:first)').hide(); $("a.slide:first").css("background-color","#FF9900"); /* The comment goes here. */ </pre> </div> With Jquery, I want to find what is in between: /* The comment goes here. */ Including those comment signs. So it should return: /* The comment goes here. */ How to do that, how to find text between two points? Thanks

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • How to get four following text inputs after each checkbox?

    - by Richard Knop
    I am traversing checkboxes like this: $('.day').each(function() { // here I need to get the following 4 text inputs in the HTML // and set some attributes on them }); After every checkbox there are four text input fields (there are also some div, span tags for CSS around them). So inside the loop above I need to get four text input fields that follow the checkbox in the HTML source so I can set some attributes on them. How would I go about that?

    Read the article

  • How do i make form data not disappear after hitting refresh?

    - by acidzombie24
    I went to test my page on another browser. On google chrome i can fill out a form, hit back and forward and still have the data there. Now i need to refresh the page so certain data is correct (such as session id if the cookie expires or user logs out before submitting). I refresh and lose all data. Is there some option i can set so all data is kept?

    Read the article

  • How do i loop an ajax request (using jquery) and jsp

    - by Mrshll187
    <script> //when page is ready do the following $(document).ready(function() { //set interval of refresh setInterval(doAjaxMethod, 1000); }); function doAjaxMethod(id) { $.ajax({ url: "getStatus/"+id, dataType: "json", success: function(json) { $('#ajaxStatus').html(json.status); } }); </script> <% //How can I do something like this int n = object.size(); for(int i=0; i<n; i++) { doAjaxMethod(object.getId()); } %> <div id=ajaxStatus> status updates here </div>

    Read the article

  • Show AJAX content after images have loaded

    - by Ben4Himv
    I am developing my own lightbox kind of jquery plugin. Everything works but I want to hide the loaded content until the images have loaded in the browser from the AJAX call. I found a similar post and I am using the following script but the setTimeout function is what reveals the content and not the .load function. Am I trying to achieve the impossible? $.ajax({ url: 'meet/'+ pLoad + '.html', success: function(data) { var imageCount = $(data).filter('img').length; var imagesLoaded = 0; $(data).hide() .appendTo('#zoom_inner') .filter('img') .load( function() { ++imagesLoaded; if (imagesLoaded >= imageCount) { $('#zoom_inner').children().show(); } }); setTimeout( function() { $('#zoom_inner').children().show() }, 5000 ); } });

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • Delay image loading with jQuery

    - by DCD
    I have a page with several galleries including accordions and sliders. The problem is that the page takes forever to load. Is there a way of wrapping an image in a bit of code or applying a class to it to force it to load only after everything else is loaded?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 643 644 645 646 647 648 649 650 651 652 653 654  | Next Page >