Search Results

Search found 24406 results on 977 pages for 'javascript namespaces'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 643/977 | < Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • Write a completely fluid HTML page (using '%' instead of 'px' for EVERY element height/width)

    - by barak manos
    I am designing my HTML pages to be completely fluid: For every element in the mark-up (HTML), I am using 'style="height:%;width:%"' (instead of 'style="height:*px;width:*px"'). This approach seems to work pretty well, except for when changing the window measurements, in which case, the web page elements change their position and end up "on top of each other". I have come up with a pretty good run-time (java-script) solution to that: var elements = document.getElementsByTagName("*"); for (var i=0; i < elements.length; i++) { if (elements[i].style.height) elements[i].style.height = elements[i].offsetHeight+"px"; if (elements[i].style.width ) elements[i].style.width = elements[i].offsetWidth +"px"; } The only problem remaining is, that if the user opens up the website by entering the URL into a non-maximized window, then the page fits that portion of the window. Then, when maximizing the window, the page remains in its previous measurements. So in essence, I have solved the initial problem (when changing the window measurements), but only when the window is initially in its maximum size. Any ideas on how to tackle this problem? (given that I would like to keep my "% page-design" as is).

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • how to sort an existing table in greasemonkey ?

    - by user570512
    i'm writing a greasemonkey user.js for a page with a table in it. (table is 100 rows by 18 columns.) now what i want to do is to make it sortable on column. and also have it run in both chrome and firefox. all searches for answers sofar resulted in suggestions to use jquery/dojo or something alike. can i be done without any external code? after all it's just a matter of replacing the row's in a different order, right? or is that a silly thing to say? the thing is that i'm already using dojo for some query needs but since i want it to run in both firefox and chrome, i just copy paste the whole dojo thing in my script.. also, most of the solutions i found sofar seem to be more for use when building a table. not for altering an existing one. any help is appreciated.

    Read the article

  • Expected Expression

    - by coffeeaddict
    I cannot figure out what I did or did not do here syntactically to cause this error. I don't see what's missing: function ShowWaitMessage(button) { var isValid; if (buttonSelected()) { showWaitMessage(button, "showMessage1"); isValid = true; } else { Page_ClientValidate(); if (Page_IsValid) { showWaitMessage(button, "showMessage2"); isValid = true; } } return isValid; }

    Read the article

  • Problem with adding integers in an array

    - by rshivers
    Hello again, I'm trying to loop through my totals in order to get a grand total for my web app. So far the code I am working with is the following: function calcAllFields() { var name = parseFloat($('div [name = total[]]').text()); var totArray = $.makeArray(name); var total = 0; for (var i = 0; i < totArray.length; i++) { total += totArray[i]; } $("#target1").text(total); } Instead of adding integers, something is being read as a string. Say I want to add 200 + 50, instead of 250 I get 20050. Could anyone please point out what I'm doing wrong? Thanks!

    Read the article

  • ADO Execute not reading a line of SQL code?

    - by llaskin
    My code is below: var statement = "test_oracle.sql"; F = aqFile.OpenTextFile(statement, aqFile.faRead, aqFile.ctANSI); F.Cursor = 0; while(! F.IsEndOfFile()){ s = F.ReadLine(); oResult = Project.Variables.oConnection.Execute_(s); CheckResult(oResult, "Unable to run SQL script to add documents"); The first line that "s" reads is: set serverout on size 10000 An error is returned as "ORA-00922: missing or invalid option" Can anyone provide guidance?

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • getElementById does return null

    - by pbcoder
    I have following function: $('canvas').createWindow('xyz', 500, 600); And js-code behind is: var $ = function(element) { if (this.constructor !== $) { return new $(element); } alert(element); var windowObj = document.getElementById(element); this.createWindow = function(src, width, height) { if(width != "" && height != "") { windowWidth = windowObj.style.width = width + 'px'; windowHeight = windowObj.style.height = height + 'px'; } }; }; But the problem is that JS says windowObj is null, alert(element) works fine! Thanks for your help!

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • How to use Jquery UI in my Custom Function? (Autocomplete)

    - by bakazero
    I want to create a function to simplify configuration of jQuery UI AutoComplete. Here is my function code: (function($) { $.fn.myAutocomplete = function() { var cache = {}; var dataUrl = args.dataUrl; var dataSend = args.dataItem; $.autocomplete({ source: function(request, response) { if (cache.term == request.term && cache.content) { response(cache.content); } if (new RegExp(cache.term).test(request.term) && cache.content && cache.content.length < 13) { var matcher = new RegExp($.ui.autocomplete.escapeRegex(request.term), "i"); response($.grep(cache.content, function(value) { return matcher.test(value.value) })); } $.ajax({ url: dataUrl, dataType: "json", type: "POST", data: dataSend, success: function(data) { cache.term = request.term; cache.content = data; response(data); } }); }, minLength: 2, }); } }) (jQuery); but when I'm using this function like: $("input#tag").myAutocomplete({ dataUrl: "/auto_complete/tag", dataSend: { term: request.term, category: $("input#category").val() } }); It's give me an error: Uncaught ReferenceError: request is not defined

    Read the article

  • jQuery Treemap Plugin

    - by Revert
    Hello, I am trying to get the Treemap plugin (http://www.jquery.info/spip.php?article40) working with jQuery v1.3.x. The plugin works with jQuery v1.1 and v1.2 but for some reason it fails with the v1.3 base. This is the browser error "Error: uncaught exception: Syntax error, unrecognized expression: " Does anyone know changes occurred between JQuery v1.2 and v1.3 that could cause this? Cheers, D

    Read the article

  • How to disable an input with jQuery Validation Plugin

    - by Eelke
    This should be really simple but I can't get it to work, how do I disable and add a class to an input? Let's say I've got an input field with id = name, this is how far I got, $("input#name").attr("disabled"); What am I doing wrong here? Any help would be greatly appreciated, thanks in advance!

    Read the article

  • Local variable vs parameter

    - by Dhana
    function doIt(param) { var localVar = param; //do lots of stuff with localVar } function doIt(param) { //do lots of stuff with param } Is there any difference in terms of efficiency between the code above?

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • How to use jquery code in Internet Explorer?

    - by ilariah
    I put some jquery in my website that makes the text move to the right when the page changes. It works in Firefox and Safari but it doesn't work in Internet Explorer. My url to my website: http://katieduck.com/Courses/Improvisation%20Winter%20Course%20Dartington.html Here is the code that is not working: $(document).ready(function() { $('#tabvanilla > ul').tabs({ fx: { height: 'toggle', opacity: 'toggle' } }); $('#featuredvid > ul').tabs(); }); Maybe you can find out what is wrong.

    Read the article

  • Detecting when HTML5 audio is finished playing (more than once)?

    - by user386911
    I am having a problem detecting when an tag is finished playing an mp3. When I do something like this: myAudio.addEventListener("ended", function() { alert("ended"); }); It only occurs the first time the audi is played. When I play the audio again, nothing happens. The same thing occurs when I use the onended=doThis(); method. I've heard maybe there is a way to do it in jquery, but I haven't been able to get it to work. I've also heard there might be a way to fix it by changing the audio div id everytime the mp3 is played, but this doesn't work for me because I need the id to stay the same. Anyone got any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • JQuery function to select checkboxes

    - by Adem
    I need a function that accepts a parameter with its id example a div and after that loops inside the div to look for checkboxes and if there is/are any checks if its value is checked and returns true if every checkbox is checked returns false.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >