Search Results

Search found 24406 results on 977 pages for 'javascript namespaces'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 643/977 | < Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >

  • Is there a jQuery plugin for making a step-by-step type presentation?

    - by Earlz
    Hello, I was making a small thing in HTML and basically I have some "frames" like <div id="frame_1"> ... </div> <div id="frame_2"> ... </div> ... Basically what I want is for only one frame to be visible at one time and to navigate between frames easily with previous and next buttons (navigation by frame number a plus, but not required) Before I set out to write it myself I figured someone had already done it so has it been done?

    Read the article

  • Credit card validation with regexp using test()

    - by Matt
    I'm trying to complete some homework and it appears the book might have gotten it wrong. I have a simple html page that allows user to pick a credit card in our case american express. The user then enters a number and evalutes that number based on a regular expression. My question ends up being when test() evaluates the number it returns a boolean or a string? I should then compare that string or boolean? True == true should fire off the code in a nested if statement. Heres what the book gives me as valid code: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE if(cardProtocol.test(document.forms[0].cardNumber.value)) document.forms[0].ccResult.value = "Valid credit card number"; } The above code doesn't work in firefox. I've tried modifying it with 2 alerts to make sure the number is good and the boolean is good...and still no luck: if(document.forms[0].cardName.value == "American Express") { var cardProtocol = new RegExp("^3[47][0-9]{13}$"); //REGEX ENTRY HERE <------ alert(document.forms[0].cardNumber.value) alert(cardProtocol.test(document.forms[0].cardNumber.value)) if((cardProtocol.test(document.forms[0].cardNumber.value)) == true ) // <--Problem { document.forms[0].ccResult.value = "Valid credit card number"; } else { document.forms[0].ccResult.value = "Invalid credit card number"; } } Any ideas? the if loop is the culprit but I'm not figuring out why it is not working. Please throw up the code for the if loop! Thanks for the help!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Why is my index view not working when I implement datepicker in my rails app

    - by user3736107
    Hi I am new to rails and would really appreciate some help, I am using the jQuery datepicker, the show view works however the index view doesn't, i get "undefined method `start_date' for nil:NilClass" in my index.html.erb file. Can you please let me know what is wrong with my index view and how i can fix it. The following are included in my app: meetups_controller.rb def show @meetup = Meetup.find(params[:id]) end def index @meetups = Meetup.where('user_id = ?', current_user.id).order('created_at DESC') end show.html.erb <h3>Title: <%= @meetup.title %></h3> <p>Start date: <%= @meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= @meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p> index.html.erb <% if @meetups.any? %> <% @meetups.each do |meetup| %> <h3><%= link_to meetup.title, meetup_path(meetup) %></h3> <p>Start date: <%= meetup.start_date.strftime("%B %e, %Y") %></p> <p>Start time: <%= meetup.start_time.strftime("%l:%M %P") %></p> <p>End date: <%= @meetup.end_date.strftime("%B %e, %Y") %></p> <p>End time: <%= @meetup.end_time.strftime("%l:%M %P") %></p>

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Pass var to jquery from div

    - by user1518202
    I am using a jquery function to open a dialog box, and I need to be able to change the height and the width of the box. I am wanting to pass it a parameter from within the DIV. I have looked at many different possibilities, but to no avail. Any ideas would be greatly appreciated. $.fx.speeds._default = 1000; $(function() { $("#dialog").dialog({ autoOpen: false, height: 300, width: 500, show: "drop", hide: "drop" }); $("#opener").click(function() { $("#dialog").dialog("open"); return false; }); }); Here is my Div. <div id="dialog"> Some text here </div>

    Read the article

  • Use a table as container or not?

    - by Camran
    I have created my entire website by using a main table, and having the content inside the table. Some ppl suggest this is wrong, and I would like to know what to do specifically in my situation. On my index.html I have a <table align="center"> and then all content in it. Now the content is in form of DIVS and they all have relative positioning, so they are relative to the table. For example: <table align="center"> <tr> <td> <div style="position:relative; left:14px; top:50px;"> CONTENT HERE... (Form, divs, images) </div> </td> </tr> </table> I have just gotten to the stage of browser compatibility. Without making any changes whatsoever, my website works perfect in FF, SAFARI, Chrome and Opera. Only trouble with IE. So for my Q, if you where me, would you change my layout and remove the tables, and instead use alot more css and alot more DIVS, or would you go with what I have? And please if you answer me, don't just provide me with the answer, but also a "why" that is... in other words, give me arguments and facts... Thanks

    Read the article

  • why jquery can't be used in my $(document).ready() function?

    - by Firegun
    The page can be viewed at http://cistrome.org/cps/seqconfig?did=2693 When load in Firebugs, it gives me this error: TypeError: $(".open_gene").on is not a function [Break On This Error] $(".open_gene").on('change', function(event) { However, if I type in this expression in Firebug's console, it can be evaluated as a function without any problems: >>> $(".open_gene").on function() I was wondering what might be the reason to cause this issue. Does anyone have ideas about this? Thanks!

    Read the article

  • Cannot get document.getElementByID to work

    - by user1804234
    The following function doesn't work for some reason. Can someone see what the problem is? function checkMaxLen(txt, maxLen) { var actualLen = txt.value.length; var remain = maxLen - actualLen; document.getElementById('remainChar').Value = remain; } <input type="text" id="remainChar" runat="server" value="500"/> Whenever I try to run the function, I get this error: Microsoft JScript runtime error: Unable to set value of the property 'Value': object is null or undefined

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Best way to make sure I get all available options array/loop

    - by jaz872
    OK, here is my problem. I'm looking for the best way to loop through a bunch of options to make sure that I hit all available options. Some detail. I've created a feature that allows a client to build images that are basically other images layered on top of each other. These other images are split up into different groups. They have links on the side of the image that they can click to scroll through all the different images to view them. I'm now making an automated process that is going to run the function that changes the image when a user clicks one of the links. I need to make sure that every possible combo of the different images is hit during this process. So I have an array with the number of options for each group. The current array is [3, 9, 3, 3] My question is what is the best way to loop through this to make sure that all possible options will be shown? I apologize if this seems simple for someone out there, but I'm just having trouble wrapping my head around it. Hopefully if that person is out there, they can give a helping hand :)

    Read the article

  • Matching a String and then incrementing a number within HTML elements

    - by Abs
    Hello all, I have tags in a html list, here is an example of two tags. <div class="tags"> <ul> <li> <a onclick="tag_search('tag1');" href="#">tag1 <span class="num-active">1</span></a> </li> <li> <a onclick="tag_search('tag2');" href="#">tag2 <span class="num-active">1</span></a> </li> </ul> </div> I would like to write a function that I can pass a string to, that will match the strings in the a hyperlink i.e. "tag1" or "tag2", if there is a match then increment the number in the span, if not then add a new li. The bit I am having trouble with is how do I search for a string in the div with class tags and then when I find a match identifying the element. I can't even do the first bit as I am use to using an ID or a Class. I appreciate any help on this using JQuery Thanks all Code so far function change_tag_count(item){ alert(item);//alerts the string test $.fn.searchString = function(str) { return this.filter('*:contains("' + item + '")'); }; if($('body').searchString(item).length){ var n = $('a').searchString(item).children().text(); n = parseInt(n) + 1; $('a').searchString(item).children().text(n); }else{ alert('here');//does not alert this when no li contains the word test $("#all_tags ul").append('<a onclick="tag_search(\''+item+'\');" href="#">'+item+'<span class="num-active">1</span></a>'); } }

    Read the article

  • Cannot submit form when disabling JSF page

    - by Steve
    Simple submit button. <h:commandButton actionListener="#{regBean.findReg}" action="#{regBean.navigate}" value="Search" /> The form tag is displayed like so: <h:form onsubmit="this.disabled=true;busyProcess();return true;"> This is so if the submit button is pressed, the page shows a "busy" icon until request is processed. The problem is, the request is never submitted and it never reaches the backend. However, if I instead take out the "disabled" call like so: <h:form onsubmit="busyProcess();return true;"> Everything works. Any ideas?

    Read the article

  • check if foler exists in the root jquery

    - by Dimal Chandrasiri
    I'm trying to load an image to a div background using the following file structure in the root. WebContent -- | zharaimages -- | [ItemID] -- | Image.jpg This is done by jQuery and the file structure is inside the root. The ItemID folder is dynamic and I have to check whether the path exists using jQuery and if the path is not valid, I should go to a default path to fetch the default image. How can I check the path is valid using jQuery. I'm hoping to this can be done without an ajax call. Can any one help me on a tutorial or an API I can use for this! UPDATE The files are on the server. The concept I have is that I have 100s of item elements & I want to load an image for each item element. The images are saved in the server ( a local host ) and the folder hierarchy is divided using the item ID as shown. What I want to do is check whether the image file exists before appending it to the background of the item element div. Is this possible. This is a web application developed using spring.

    Read the article

  • Another way to handle a common JQuery event handling pattern

    - by bradgonesurfing
    I have the following code for example $("a.foo").bind(function (e){ var t; if ( $(e.target).is("a") ){ t = $(e.target); }else{ t = $(e.target).parent("a"); } var data = t.attr("data-info"); }); In english. I might have a list of anchors within which there may be a number of spans. Each anchor is declared as <a class="foo" href="#" data-info="1"> <span> ... </span> <span> ... </span> </a> <a class="foo" href="#" data-info="2"> <span> ... </span> <span> ... </span> </a> ... ... I bind a handler to the click event of the anchor but the event object comes back with the anchor OR one of the spans depending on where I click. So to get my html5 "data-info" value into the callback I have to insert a bit of messy code. This is now appearing throughout my code to the point where I am guessing there might be an idiomatic JQuery way of handling this.

    Read the article

  • jQuery plugins: How can I stop divs from overlapping?

    - by anir
    I'm using Masonry and Embedly plugin to display embedded content, I've put together an example in jsfiddle.net/anir/pBtbb/3/ It appears the Masonry plugin loads first and it causes the overlapping problem (they only show correctly when you resize the result window) I've read that I could use callback functions or retrigger Masonry once embedly has finished rendering content, but I don't know how to do it. Can you help me? Is there any other solution to fix this?

    Read the article

  • json retrival failed with jquery .each

    - by user545520
    {"paging": {"pageNum":2,"action":"Next","type":"","availableCacheName":"getAllFunds","selectedCacheName":"","showFrom":101,"showTo":200,"totalRec":289,"pageSize":100}, "Data":[{"sourceCodeId":0,"radio_fund":"individua l","availableFunds":[],"fundId":288,"searchName":[],"fundName":"Asian Equity Fund A Class Income","srcFundGrpId":"PGI","firstElement":0,"las tElement":0,"totalElements":0,"pageList":[],"standardExtract":true}] I have json file with above format with two fileds,one paging and one is Data array. I able to retrieve values of paging,but i am not able to retrieve the values of data array with .each function of jquery. Any suggestions or inputs really appreciated.

    Read the article

  • jQuery - Why doesn't combining has() and gt() work in some cases?

    - by KatieK
    I wanted to select any ul which contains more than 3 lis. This code worked with the 1.2.6 jQuery library: $("ul:has(li:gt(2))") .each( function() { $(this).css("border", "solid red 1px"); }); But not 1.3.2 or 1.4.2. This code worked with the 1.4.2 jQuery library: $('ul').has('li:nth-child(3)').css('border', 'solid red 1px'); But not v1.2.6. Why does each version work with one library version, but not the other? Am I encountering some kind of bug, or am I doing something wrong? Any help understanding , or differences to be aware of between different versions of the jQuery libraries, would be much appreciated. Thanks!

    Read the article

  • jQuery won't parse xml with nodes called option

    - by user170902
    hi all, I'm using jQuery to parse some XML, like so: function enumOptions(xml) { $(xml).find("animal").each(function(){ alert($(this).text()); }); } enumOptions("<root><animal>cow</animal><animal>squirrel</animal></root>"); This works great. However if I try and look for nodes called "option" then it doesn't work: function enumOptions(xml) { $(xml).find("option").each(function(){ alert($(this).text()); }); } enumOptions("<root><option>cow</option><option>squirrel</option></root>"); There's no error, just nothing gets alerted, as if the find isn't finding anything. It only does it for nodes called option everything else I tested works ok! I'm using the current version of jQuery - 1.4.2. Anyone any idea? TIA. bg

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 639 640 641 642 643 644 645 646 647 648 649 650  | Next Page >