Search Results

Search found 24406 results on 977 pages for 'javascript namespaces'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 646/977 | < Previous Page | 642 643 644 645 646 647 648 649 650 651 652 653  | Next Page >

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • Creating a json obj from a string when working without a net connection?

    - by user246114
    Hi, I have a json object returned from a third party api, it looks like: {"version":"1.0","encoding":"UTF-8"} I'm going to be working on my project without a network connection, so I have to do everything locally. How can I create an instance of a json object locally for testing? Say I copy the above string, can I do something like: var json = null; if (debugging_locally) { json = new jsonObj('{"version":"1.0","encoding":"UTF-8"}'); } else { json = doAjaxCall(); } doStuffWithJsonObj(json); so I just want to create a json object from a stored string if debugging locally - how can I do that? Thanks

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Animate/Ease an element to position when other elements disappear

    - by Jonathan
    Please take a look at this fiddle: http://jsfiddle.net/dhcyA/ Try clicking on a block. What I want is that when the other elements disapear, the selected block will animate/ease to his giving position instead of just jumping like it does now. Then the same animation repeats itself when clicking again on the box, but then back to place. Maybe to keep in mind: I'm using a reponsive design, which means those blocks can be vertical and horizontal after scaling the window. Any redevisions on the fiddle or suggustions would be great!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • Simplify my menu animation code

    - by zaius
    I've got a bunch of 'project' divs that I want to expand when they're clicked on. If there's already a project open, I want to hide it before I slide out the new one. I also want to stop clicks on an already open project from closing and then opening it again. Here's an example of what I mean (warning - wrote the code in the browser): $('.projects').click(function() { var clicked_project = $(this); if (clicked_project.is(':visible')) { clicked_project.height(10).slideUp(); return; } var visible_projects = $('.projects:visible'); if (visible_projects.size() > 0) { visible_projects.height(10).slideUp(function() { clicked_project.slideDown(); }); } else { clicked_project.slideDown(); } }); Really, my big issue is with the second part - it sucks that I have to use that if/else - I should just be able to make the callback run instantly if there aren't any visible_projects. I would think this would be a pretty common task, and I'm sure there's a simplification I'm missing. Any suggestions appreciated!

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Fetch html page content into a var

    - by Cipher
    Just a small question here, that how do we get fetch the html content via ajax into a variable that I could use later. Right now, I have a button on the click of which, I fetch another html page simply through load method as follows: $('#container').load('http://127.0.0.1/someUrl') I want to get the content into a var instead that I could at a later time use to append to the dom $('#someContainer').append(someVar)

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 642 643 644 645 646 647 648 649 650 651 652 653  | Next Page >