Search Results

Search found 18329 results on 734 pages for 'interpret order'.

Page 680/734 | < Previous Page | 676 677 678 679 680 681 682 683 684 685 686 687  | Next Page >

  • XSD: xs:sequence & xs:choice combination for xs:extension elements?

    - by bguiz
    Hi, My question is about defining an XML schema that will validate the following sample XML: <rules> <other>...</other> <bool>...</bool> <other>...</other> <string>...</string> <other>...</other> </rules> The order of the child nodes does not matter. The cardinality of the child nodes is 0..unbounded. All the child elements of the rules node have a common base type, rule, like so: <xs:complexType name="booleanRule"> <xs:complexContent> <xs:extension base="rule"> ... </xs:extension> </xs:complexContent> </xs:complexType> <xs:complexType name="stringFilterRule"> <xs:complexContent> <xs:extension base="filterRule"> ... </xs:extension> </xs:complexContent> </xs:complexType> My current attempt at defining the schema for the rules node is below. However, Can I nest xs:choice within xs:sequence? If, where do I specify the maxOccurs="unbounded" attribute? Is there a better way to do this, such as an xs:sequence which specifies only the base type of its child elements? <xs:element name="rules"> <xs:complexType> <xs:sequence> <xs:choice> <xs:element name="bool" type="booleanRule" /> <xs:element name="string" type="stringRule" /> <xs:element name="other" type="someOtherRule" /> </xs:choice> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • Dynamic Multiple Choice (Like a Wizard) - How would you design it? (e.g. Schema, AI model, etc.)

    - by henry74
    This question can probably be broken up into multiple questions, but here goes... In essence, I'd like to allow users to type in what they would like to do and provide a wizard-like interface to ask for information which is missing to complete a requested query. For example, let's say a user types: "What is the weather like in Springfield?" We recognize the user is interested in weather, but it could be Springfield, Il or Springfield in another state. A follow-up question would be: What Springfield did you want weather for? 1 - Springfield, Il 2 - Springfield, Wi You can probably think of a million examples where a request is missing key data or its ambiguous. Make the assumption the gist of what the user wants can be understood, but there are missing pieces of data required to complete the request. Perhaps you can take it as far back as asking what the user wants to do and "leading" them to a query. This is not AI in the sense of taking any input and truly understanding it. I'm not referring to having some way to hold a conversation with a user. It's about inferring what a user wants, checking to see if there is an applicable service to be provided, identifying the inputs needed and overlaying that on top of what's missing from the request, then asking the user for the remaining information. That's it! :-) How would you want to store the information about services? How would you go about determining what was missing from the input data? My thoughts: Use regex expressions to identify clear pieces of information. These will be matched to the parameters of a service. Figure out which parameters do not have matching data and look up the associated question for those parameters. Ask those questions and capture answers. Re-run the service passing in the newly captured data. These would be more free-form questions. For multiple choice, identify the ambiguity and search for potential matches ranked in order of likelihood (add in user history/preferences to help decide). Provide the top 3 as choices. Thoughts appreciated. Cheers, Henry

    Read the article

  • Howto access thread data outside a thread

    - by Quandary
    Question: I start the MS Text-to-speech engine in a thread, in order to avoid a crash on DLL_attach. It starts fine, and the text to speech engine gets initialized, but I can't access ISpVoice outside the thread. How can I access ISpVoice outside the thread ? It's a global variable after all... #include <windows.h> #include <sapi.h> #include "XPThreads.h" ISpVoice * pVoice = NULL; unsigned long init_engine_thread(void* param) { Sleep(5000); printf("lolthread\n"); //HRESULT hr = CoInitializeEx(NULL, COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if(FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } else { printf("trying to create instance.\n"); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(__uuidof(ISpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); HRESULT hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { printf("Succeeded\n"); hr = pVoice->Speak(L"The text to speech engine has been successfully initialized.", 0, NULL); } else { printf("failed\n"); MessageBox(NULL, TEXT("Failed To Create COM instance"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } } if(pVoice != NULL) { pVoice->Release(); pVoice = NULL; } CoUninitialize(); return NULL; } XPThreads* ptrThread = new XPThreads(init_engine_thread); BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: //init_engine(); LoadLibrary(TEXT("ole32.dll")); ptrThread->Run(); break; case DLL_THREAD_ATTACH: break; case DLL_THREAD_DETACH: break; case DLL_PROCESS_DETACH: break; } return TRUE; }

    Read the article

  • How to efficently build an interpreter (lexer+parser) in C?

    - by Rizo
    I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

    Read the article

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • Spring transaction management breaks hibernate cascade

    - by TimmyJ
    I'm having a problem where the addition of spring's transaction management to an application causes Hibernate to throw the following error: org.hibernate.HibernateException: A collection with cascade="all-delete-orphan" was no longer referenced by the owning entity instance: org.fstrf.masterpk.domain.ReportCriteriaBean.treatmentArms org.hibernate.engine.Collections.processDereferencedCollection(Collections.java:96) org.hibernate.engine.Collections.processUnreachableCollection(Collections.java:39) org.hibernate.event.def.AbstractFlushingEventListener.flushCollections(AbstractFlushingEventListener.java:218) org.hibernate.event.def.AbstractFlushingEventListener.flushEverythingToExecutions(AbstractFlushingEventListener.java:77) org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:26) org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1000) org.springframework.orm.hibernate3.SpringSessionSynchronization.beforeCommit(SpringSessionSynchronization.java:135) org.springframework.transaction.support.TransactionSynchronizationUtils.triggerBeforeCommit(TransactionSynchronizationUtils.java:72) org.springframework.transaction.support.AbstractPlatformTransactionManager.triggerBeforeCommit(AbstractPlatformTransactionManager.java:905) org.springframework.transaction.support.AbstractPlatformTransactionManager.processCommit(AbstractPlatformTransactionManager.java:715) org.springframework.transaction.support.AbstractPlatformTransactionManager.commit(AbstractPlatformTransactionManager.java:701) org.springframework.transaction.interceptor.TransactionAspectSupport.commitTransactionAfterReturning(TransactionAspectSupport.java:321) org.springframework.transaction.interceptor.TransactionInterceptor.invoke(TransactionInterceptor.java:116) org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:171) org.springframework.aop.framework.JdkDynamicAopProxy.invoke(JdkDynamicAopProxy.java:204) $Proxy92.saveNewReportCriteria(Unknown Source) org.fstrf.masterpk.domain.logic.MasterPkFacade.saveNewReportCriteria(MasterPkFacade.java:134) org.fstrf.masterpk.controllers.ReportCriteriaController.setupReportType(ReportCriteriaController.java:302) sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) java.lang.reflect.Method.invoke(Method.java:585) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.doInvokeMethod(HandlerMethodInvoker.java:413) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.invokeHandlerMethod(HandlerMethodInvoker.java:134) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.invokeHandlerMethod(AnnotationMethodHandlerAdapter.java:310) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.handle(AnnotationMethodHandlerAdapter.java:297) org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:875) org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:809) org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:571) org.springframework.web.servlet.FrameworkServlet.doPost(FrameworkServlet.java:511) javax.servlet.http.HttpServlet.service(HttpServlet.java:710) javax.servlet.http.HttpServlet.service(HttpServlet.java:803) org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96) I'm using Spring 2.5 and annotations to implement this management. Here is the class containing the saveNewReportCriteria method (which, as can be seen by the stack trace, is causing the error) @Transactional( propagation = Propagation.REQUIRED, isolation = Isolation.DEFAULT, readOnly = false) public class HibernateReportCriteriaDao implements ReportCriteriaDao{ private HibernateTemplate hibernateTemplate; public Integer saveNewReportCriteria(ReportCriteriaBean reportCriteria) { hibernateTemplate.save(reportCriteria); List<Integer> maxIdList = hibernateTemplate.find("SELECT max(id) from ReportCriteriaBean"); logger.info("ID of newly saved list is: " + maxIdList.get(0)); return maxIdList.get(0); } public void setHibernateTemplate(HibernateTemplate hibernateTemplate) { this.hibernateTemplate = hibernateTemplate; } } Then I added the following sections to my configuration files to tell spring that I am using annotation driven transaction management: <bean id="actgDataSource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/actg" /> <property name="resourceRef" value="true" /> </bean> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="actgDataSource" /> </bean> <tx:annotation-driven/> I'm pretty sure that the de-referencing error is being caused due to the proxy class that Spring AOP creates and uses in order to handle transaction management, but I have no idea how I'd go about fixing it.

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • Passing variables from PHP to Javascript back to PHP using Ajax.

    - by ObjectiveJ
    I hope this makes sesne, please bare with me. So I have a PHP page that contains variables, I have some radial boxes, and on click of them, it calculates a price for the item you have clicked on. I do this by activating a js function that I have passed some variables to. Like so. PHP: <?php $result = mssql_query("SELECT * FROM Segments ORDER BY 'Squares'"); if (!$result) { echo 'query failed'; exit; } while ($row = mssql_fetch_array($result)) { ?> <span><?php echo $row["Squares"]; ?></span><input name="squares" type="radio" onclick="ajaxCases('<?php echo $row["Squares"]; ?>', '<?php echo $row["StartCaseID"]; ?>', '<?php echo $row["StartMatrixPrice"]; ?>')" value="<?php echo $row["Squares"]; ?>"<?php if ($row["Squares"] == "1") { ?> checked="checked" <?php }else{ ?> checked="" <?php } ?>/> <?php } ?> As you can see onclick it goes to a function called ajaxcases, this function looks like this. function ajaxCases(squares,start,price){ $('#step1').html('<p style="margin:100px 0px 0px 100px"><img src="images/ajax-loader-bigindic.gif" width="32" height="32" alt="" /></p>'); $('#step1').load("ajax-styles.php?squares="+squares); prevId1 = ""; document.varsForm.caseid.value=start; $('#step1price').html('<span style="margin:0px 0px 0px 30px"><img src="images/ajax-loader-price.gif" width="24" height="24" alt="" /></span>'); $('#step1price').load("ajax-step1-price.php?Squares="+Squares); return true; } This then goes to a php page called ajax-step1-price.php and I try to recall the variable Squares. However it doesn't work, I thought it was a GET however that returns undefined. In Summary: I would like to know how to pass a variable from PHP to JS then back to PHP, or if someone could just tell me where I am going wrong that would be greatly appreciated.

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • Tag Cloud JS + Flash. Actual Tags In Cloud Not Clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("some/swfObject/url", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); } </script>

    Read the article

  • shipping and handling fee calculation

    - by Newb
    Here is the question: Many companies normally charge a shipping and handling fee for purchases. Create a Web page that allows a user to enter a purchase price into a text box - include a JavaScript function that calculates shipping and handling. Add functionality to the script that adds a minimum shipping and handling fee of $1.50 for any purchase that is less than or equal to $25.00. For any orders over $25.00, add 10% to the total purchase price for shipping and handling, but do not include the $1.50 minimum shipping and handling fee. After you determine the total cost of the order (purchase plus shipping and handling), display it in an alert dialog box. I am beginner at JavaScript and struggling to get my code to work. It does display an alert box with the value entered by the user but doesn't add anything. Although, I don't know why the formula doesn't work. Please help. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Calculating Shipping & Handling</title> <script type="text/javascript"> /* <![CDATA[ */ var price=[]; var shipping=[]; var total=price+shipping; function calculateShipping(){ if (price <= 25){ shipping = (price + 1.5); } else { shipping = (price * 10 / 100); } window.alert("The purchase price with shipping is " + document.calculate.ent.value); } /* ]]> */ </script> </head> <body> <form name ="calculate" action="" > <p>Enter Purchase Price</p> <input type="text" name="ent" > <input type="button" name="button" value="Submit" onClick="calculateShipping()" /> </form> </body> </html>

    Read the article

  • Memory allocation and release for UIImage in iPhone?

    - by rkbang
    Hello all, I am using following code in iPhone to get smaller cropped image as follows: - (UIImage*) getSmallImage:(UIImage*) img { CGSize size = img.size; CGFloat ratio = 0; if (size.width < size.height) { ratio = 36 / size.width; } else { ratio = 36 / size.height; } CGRect rect = CGRectMake(0.0, 0.0, ratio * size.width, ratio * size.height); UIGraphicsBeginImageContext(rect.size); [img drawInRect:rect]; UIImage *tempImg = [UIGraphicsGetImageFromCurrentImageContext() retain]; UIGraphicsEndImageContext(); return [tempImg autorelease]; } - (UIImage*)imageByCropping:(UIImage *)imageToCrop toRect:(CGRect)rect { //create a context to do our clipping in UIGraphicsBeginImageContext(rect.size); CGContextRef currentContext = UIGraphicsGetCurrentContext(); //create a rect with the size we want to crop the image to //the X and Y here are zero so we start at the beginning of our //newly created context CGFloat X = (imageToCrop.size.width - rect.size.width)/2; CGFloat Y = (imageToCrop.size.height - rect.size.height)/2; CGRect clippedRect = CGRectMake(X, Y, rect.size.width, rect.size.height); //CGContextClipToRect( currentContext, clippedRect); //create a rect equivalent to the full size of the image //offset the rect by the X and Y we want to start the crop //from in order to cut off anything before them CGRect drawRect = CGRectMake(0, 0, imageToCrop.size.width, imageToCrop.size.height); CGContextTranslateCTM(currentContext, 0.0, drawRect.size.height); CGContextScaleCTM(currentContext, 1.0, -1.0); //draw the image to our clipped context using our offset rect //CGContextDrawImage(currentContext, drawRect, imageToCrop.CGImage); CGImageRef tmp = CGImageCreateWithImageInRect(imageToCrop.CGImage, clippedRect); //pull the image from our cropped context UIImage *cropped = [UIImage imageWithCGImage:tmp];//UIGraphicsGetImageFromCurrentImageContext(); CGImageRelease(tmp); //pop the context to get back to the default UIGraphicsEndImageContext(); //Note: this is autoreleased*/ return cropped; } I am using following line of code in cellForRowAtIndexPath to update the image of the cell: cell.img.image = [self imageByCropping:[self getSmallImage:[UIImage imageNamed:@"goal_image.png"]] toRect:CGRectMake(0, 0, 36, 36)]; Now when I add this table view and pop it from navigation controller, I see a memory hike.I see no leaks but memory keeps climbing. Please note that the images changes for each row and I am creating the controller using lazy initialization that is I create or alloc it whenever I need it. I saw on internet many people facing the same issue, but very rare good solutions. I have multiple views using the same way and I see almost memory raised to 4MB within 20-25 view transitions. What is the good solution to resolve this issue. tnx.

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • B-trees, databases, sequential inputs, and speed.

    - by IanC
    I know from experience that b-trees have awful performance when data is added to them sequentially (regardless of the direction). However, when data is added randomly, best performance is obtained. This is easy to demonstrate with the likes of an RB-Tree. Sequential writes cause a maximum number of tree balances to be performed. I know very few databases use binary trees, but rather used n-order balanced trees. I logically assume they suffer a similar fate to binary trees when it comes to sequential inputs. This sparked my curiosity. If this is so, then one could deduce that writing sequential IDs (such as in IDENTITY(1,1)) would cause multiple re-balances of the tree to occur. I have seen many posts argue against GUIDs as "these will cause random writes". I never use GUIDs, but it struck me that this "bad" point was in fact a good point. So I decided to test it. Here is my code: SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[T1]( [ID] [int] NOT NULL CONSTRAINT [T1_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO CREATE TABLE [dbo].[T2]( [ID] [uniqueidentifier] NOT NULL CONSTRAINT [T2_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO declare @i int, @t1 datetime, @t2 datetime, @t3 datetime, @c char(300) set @t1 = GETDATE() set @i = 1 while @i < 2000 begin insert into T2 values (NEWID(), @c) set @i = @i + 1 end set @t2 = GETDATE() WAITFOR delay '0:0:10' set @t3 = GETDATE() set @i = 1 while @i < 2000 begin insert into T1 values (@i, @c) set @i = @i + 1 end select DATEDIFF(ms, @t1, @t2) AS [Int], DATEDIFF(ms, @t3, getdate()) AS [GUID] drop table T1 drop table T2 Note that I am not subtracting any time for the creation of the GUID nor for the considerably extra size of the row. The results on my machine were as follows: Int: 17,340 ms GUID: 6,746 ms This means that in this test, random inserts of 16 bytes was almost 3 times faster than sequential inserts of 4 bytes. Would anyone like to comment on this? Ps. I get that this isn't a question. It's an invite to discussion, and that is relevant to learning optimum programming.

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Grid sorting with persistent master sort

    - by MikeWyatt
    I have a UI with a grid. Each record in the grid is sorted by a "master" sort column, let's call it a page number. Each record is a story in a magazine. I want the user to be able to drag and drop a record to a new position in the grid and automatically update the page number field to reflect the updated position. Easy enough, right? Now imagine that I also want to have the grid sortable by any other column (story title, section, author name, etc.). How does the drag and drop operation work now? Revert to page number sort during or after the drag and drop operation? This could confuse the user (why did my sort just change?). It would also result in arbitrary row positioning. Would the story now be before the row that was after it when the user dropped it? Or, would it be after the row that was before it? Those rows may now be widely separated after the master order sort. Disable the drag and drop feature if the grid isn't currently sorted by the page number? This would be easy, but the user might wonder why he can't drag and drop at certain times. Knowing to first sort by page number may not be very intuitive. Let the user rearrange his rows, but not make any changes to the page number? Require the user to enter a "Arrange Stories" mode, in which the grid sort is temporarily switched to page number and drag and drop is enabled? They would then exit the mode, and the previous sort would be reapplied. The big difference between this and the second option is that it would be more explicit than simply clicking on a column header. Any other ideas, or reasons why one of the above is the way to go? EDIT I'd like to point out that any of the above is technically possible, and easy to implement. My question is design-related. What is the most intuitive way to solve this problem, from the user's perspective?

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 676 677 678 679 680 681 682 683 684 685 686 687  | Next Page >