Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 695/965 | < Previous Page | 691 692 693 694 695 696 697 698 699 700 701 702  | Next Page >

• Macro to create macros?

  - by JMarsch

  Over the years, I've built up a number of macros that I like to have available in visual studio. It's always a pain to reload them and rebind them to the keyboard when I go to a different machine/rebuild/use a VM/etc. Someone mentioned to me once that there is a way that you can write a macro that will recreate your macros and bind them to keys automatically. Anyone know how to do that? Is there another way to easily export/import macros (nonsensically, VS has an "export macro" function, but no import).

  Read the article

• What is the best, python or bash for selectively concatenating lots of files?

  - by Werner

  Hi, I have around 20000 files coming from the output of some program, and their names follow the format: data1.txt data2.txt ... data99.txt data100.txt ... data999.txt data1000.txt ... data20000.txt I would like to write a script that gets as input argument the number N. Then it makes blocks of N concatenated files, so if N=5, it would make the following new files: data_new_1.txt: it would contain (concatenated) data1.txt to data5.txt (like cat data1.txt data2.txt ... data_new_1.txt ) data_new_2.txt: it would contain (concatenated) data6.txt to data10.txt ..... I wonder what do you think would be the best approach to do this, whether bash, python or another one like awk, perl, etc. The best approach I mean in terms of simplest code. Thanks

  Read the article

• Problem with interaction servlet-jsp

  - by zp26

  Hi, I have a implementation prolbem. I have create a jsp and a servlet file. I have a remoteInterface of session bean. I wanna use remoteInterface in servlet and after write the data on the jsp. The client must see only the result page. For Example: A method of session bean return a Collection. I use this collection in the servlet and after this stamp all the element in the jsp. Can you help me with a code example. Thanks

  Read the article

• @Html.Label won't allow string concatination

  - by MrGrigg

  I'm building dynamic forms based on a partial view. My view inherits a model with a single property: CatalogName { get; set; }. I have tried this: @Html.Label(Model.CatalogName + "-ProductNumber", "Product Number") @Html.TextBox(Model.CatalogName + "-ProductNumber") The HTML renders like this though: <label for>Product Number</label> <input name="CatatalogName-ProductNumber" type="text" /> If I write my code like this: @Html.Label("ProductNumber-" + Model.CatalogName", "Product Number") It will render the way I expect <label for="ProductNumber-CatalogName">Product Number</label> Is this a bug with MVC? Are there any answers to why my concatenation won't work the way I want it in the label, but works fine with the TextBox?

  Read the article

• jQuery: Toggling an image when toggling a DIV

  - by Wanda

  Hey guys, I'm trying to write some jQuery that will toggle DIVs open and closed, and it's working, but I want an arrow that will change to "down" if the DIV is expanded, and "right" if the DIV is collapsed. What I have so far: $('.toggleHead').click(function() { $('#arrow').attr('src', 'images/icons/down.png'); $(this).next().toggle(); return false; }).next().hide(); Where would I put the other $('#arrow').attr('src', 'images/icons/right.png');? Thanks!

  Read the article

• Subversion Copy Hook on Windows

  - by GeoSQL

  Hi I am working on a web based project in my free time. I have SVN set up on my machine (running XP). What I would like to do is have a copy of my repository copied to the htdocs folder (Dev machine) post-commit via a hook. That way I can test my changes in a browser. I know that I can write up a .bat file, but I'm not sure what the syntax would be. I can do a basic DOS Copy command, but I saw one example that provided a username and password to SVN at copy time. Do I need to do this? Can someone point me in the right direction as far a syntax for the .bat file? Or maybe even suggest a better method. Thanks

  Read the article

• Can we avoid multiple if''s?

  - by Newbie

  I tried my level best to write an improved version but failed. inFiles.ToList().ForEach(i => { filePath = inFolder + "\\" + i.Value; if (i.Key.Equals(replacementFile)) { replacementCollection = GetReplacementDataFromFile(filePath); } else if (i.Key.Equals(standardizationFile)) { standardizationCollection = GetStandardizationDataFromFile(filePath); } }); The problem is that I cannot use a switch case over here because the comparison variables are not constant. Kindly help to improve this code. I am using C#(3.0). Thanks

  Read the article

• Django: IE doesn't load locahost or loads very SLOWLY

  - by reedvoid

  I'm just starting to learn Django, building a project on my computer, running Windows 7 64-bit, Python 2.7, Django 1.3. Basically whatever I write, it loads in Chrome and Firefox instantly. But for IE (version 9), it just stalls there, and does nothing. I can load up "http://127.0.0.1:8000" on IE and leave the computer on for hours and it doesn't load. Sometimes, when I refresh a couple of times or restart IE it'll work. If I change something in the code, again, Chrome and Firefox reflects changes instantly, whereas IE doesn't - if it loads the page at all. What is going on? I'm losing my mind here....

  Read the article

• Ruby: Parse Excel 95-2003 files?

  - by Larry K

  Is there a way to read Excel 97-2003 files from Ruby? Background I'm currently using the Ruby Gem parseexcel -- http://raa.ruby-lang.org/project/parseexcel/ But it is an old port of the perl module. It works fine, but the latest format it parses is Excel 95. And guess what? Excel 2007 will not produce the Excel 95 format. John McNamara has taken over duties as the maintainer for the Perl Excel parser, see http://search.cpan.org/~jmcnamara/Spreadsheet-ParseExcel-0.55/lib/Spreadsheet/ParseExcel.pm The current version will parse Excel 95-2003 files. But is there a port to Ruby? My other thought is to build some Ruby to Perl glue code to enable use of the Perl library itself from Ruby. Eg, see http://stackoverflow.com/questions/451636/whats-the-best-way-to-export-utf8-data-into-excel/620612#620612 (I think it would be much faster to write the glue code than to port the parser.) Thanks, Larry

  Read the article

• concurrent doubly-linked list (1 writer, n-readers)

  - by Arne

  Hi guys, I am back in the field of programming for my Diploma-thesis now and stumbled over the following issue: I need to implement a thread-safe doubly-linked list for one thread writing the list at any position (delete, insert, mutate node data) and one to many threads traversing and reading the list. I am well aware that mutexes can be used to serialize access to the list, still I presume that a naive lock around any write operation will be less than optimal. I am wondering whether there are better variants. (I am well aware that 'optimal' has not much of a practical meaning as long as no exact measure/profiling are available but this is an academic thesis after all..) I am very gratefull for code-samples as well as references to academic granted these have at least a tiny bit of practical relevance. Thanks at lot

  Read the article

• Should I be using libraries if I'm trying to learn how to program?

  - by CodeJustin.com

  I have been programming "a lot" in the past few months and at first I was trying to find the "easyest" language. Fortunately I realized that it's not about the language, it's about learning HOW to code. I ran into the Stanford lectures online (programming methodology) and I watched them all (around 23 hours total) awhile ago. Then I got into Java ME and programmed about 28.47% of a mobile RPG game (only around 2k lines of code). I feel like I learned a lot from those two experiences compared to previous ones but now that I'm moving into flash/actionscript 3.0 development and I'm finding myself learning like I did when I first started with PHP. I'm not really getting whats under the hood kind of. I'm finding myself using libraries to speed up development time which doesn't seem like a bad thing BUT I personally do not know how to write the libraries myself off hand. So should I be coding everything myself or is it ok to use libraries when you don't even know how to code them?

  Read the article

• What is the best way for converting phone numbers into international format (E.164) using Java?

  - by Vihung

  What is the best way for converting phone numbers into international format (E.164) using Java? Given a 'phone number' and a country id (let's say an ISO country code), I would like to convert it into a standard E.164 international format phone number. I am sure I can do it by hand quite easily - but I would not be sure it would work correctly in all situations. Which Java framework/library/utility would you recommend to accomplish this? P.S. The 'phone number' could be anything identifiable by the general public - such as * (510) 786-0404 * 1-800-GOT-MILK * +44-(0)800-7310658 that last one is my favourite - it is how some people write their number in the UK and means that you should either use the +44 or you should use the 0. The E.164 format number should be all numeric, and use the full international country code (e.g.+44)

  Read the article

• What are the advantages of squashing assignment and error checking in one line?

  - by avakar

  This question is inspired by this question, which features the following code snippet. int s; if((s = foo()) == ERROR) print_error(); I find this style hard to read and prone to error (as the original question demonstrates -- it was prompted by missing parentheses around the assignment). I would instead write the following, which is actually shorter in terms of characters. int s = foo(); if(s == ERROR) print_error(); This is not the first time I've seen this idiom though, and I'm guessing there are reasons (perhaps historical) for it being so often used. What are those reasons?

  Read the article

• c++ unicode writing is not working

  - by Jugal Kishore

  I am trying to write some Russian unicode text in file by wfstream. Following piece of code has been used for it. wfstream myfile; locale AvailLocale("Russian"); myfile.imbue(AvailLocale); myfile.open(L"d:\\example.txt",ios::out); if (myfile.is_open()) { myfile << L"?????? ????" <<endl; } myfile.flush(); myfile.close(); Something unrecognizable is written to the file by executing this code, I am using VS 2008.

  Read the article

• Integrate existing Spring based web application with a CMS

  - by anne_developer

  We have stable spring based (spring 2.x) web application. We have a new requirement which is our data entry operators should be able to login to some kind of an admin module and simply change the text in the web pages, change the color etc. I have seen PHP based CMS’s that allows authorized user to change the content in WYSIWYG manner. If anyone of you knows such open source Java CMS or third party application, which can facilitate such thing, please let me know. Please note: we cannot write our application from scratch. We are looking for pluggable component.

  Read the article

• Design cache mechanism

  - by Delashmate

  Hi All, I got assignment to write design for cache mechanism, This is my first time writing a design document, Our program display images for doctors, and we wan't to reduce the parsing time of the images So we want to save the parsed data in advance (in files or inside database) Currently I have several design key ideas Handle locks - each shared data structure should be handled, also files Test - add test to verify the data from the cache is equal to the data from the files To decouple the connection to the database- not to call directly to the database Cleanup mechanisem- to delete old files if the cahce directory exceed configurable threshold Support config file Support performance tool in the feature I will also add class diagram, data flow charts, and workflow What do you think I should add to the key ideas? Do you know good link to atricales about design? Thanks in advance, Dan

  Read the article

• Access DB with SQL Server Front End

  - by uyuni99

  I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

  Read the article

• What would a compress method do in a hash table?

  - by Bradley Oesch

  For an assignment I have to write the code for a generic Hash Table. In an example Put method, there are two lines: int hash = key.hashCode(); // get the hashcode of the key int index = compress(hash); // compress it to an index I was of the understanding that the hashCode method used the key to return an index, and you would place the key/value pair in the array at that index. But here we "compress" the hash code to get the index. What does this method do? How does it "compress" the hash code? Is it necessary and/or preferred?

  Read the article

• Visual Basic Display Square

  - by user1724157

  Alright I'm currently lost on a particular assignment I have for a class. I've seen many examples of this app but none of them see to help my problem is as follows: Write a Sub procedure "DisplaySquare" to display the solid square. The size should be specified by the integer parameter "size". The character that fills the square should be specified by the string parameter "fillCharacter. Use a For...Next statement nested within another For...Next statement to create the square. The outer For...Next specifies what row is currently being displayed. The inner For...Next appends all the characters that form the row to a display string. So it should come out like as follows: if a user enters "8" and "#" ######## ######## ######## ######## ######## ######## ######## ######## Any help would be appreciated.

  Read the article

• Search for all instances of certain annotation type

  - by user1064918

  Suppose I have this annotation @Retention(RetentionPolicy.RUNTIME) @Target(ElementType.FIELD) public @interface Name { String value(); } This is going to be used as follows @Name("name1") public static Foo foo = new Foo(); I have multiples of these across my project source files. Is there an fairly simple way to search and collect all those "foo"s that're preceded by @Name? In other words, I'd like to write a method that would return a Set<Foo> containing these. Thanks!!!

  Read the article

• Call function by pointer and set parametrs in memory block

  - by Ellesmess Glain

  Hi, I've little problem : I'm solving problem with calling function by pointer and passing to it parameters in continuous memory block. My goal is to have function named e.g CallFunc(void * func,void *params, unsigned int param_length); that I'll send function pointer, pointer to function's parameters and eventually parameters length and this calling function will call passed function with it's parameters. I will like write this in C/C++, but if somebody has idea, how this resolve in other language, that supports DLL generation and exportet functions, it will be fine too. Thanks for answers, Ellesmess P.S. I'm sorry about my English, but I'm Czech, thanks :o)

  Read the article

• Iterating through facebook comments JSON object failing

  - by user1594304

  I tried the option of students.item["http://www.myurl.com"].comments.data.length. However, the item["http://www.myurl.com"] call is not working. If I take out the URL from JSON object and write the iterator with students.comments.data, it works. Here is my code, any help highly appreciated. var students = { "http://www.myurl.com":{ "comments":{ "data" : [ { "id": "123456778", "from": { "name": "XYZ", "id": "1000005" }, "message": "Hey", "can_remove": false, "created_time": "2012-09-03T03:16:01+0000", "like_count": 0, "user_likes": false } ] } } } var i=0 var arrayObject = new Array(); alert("Parsing 2: "+students.item["http://www.myurl.com"].comments.data.length); for(i=0;i<students.item["http://www.myurl.com"].comments.data.length;i++) { alert("Parsing 1: "+i); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].id); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].message); arrayObject.push(students.item["http://www.myurl.com"].comments.data[i].created_time); }

  Read the article

• AS3: Performance question calling an event function with null param

  - by adehaas

  Lately I needed to call a listener function without an actual listener like so: foo(null); private function foo(event:Event):void { //do something } So I was wondering if there is a significant difference regarding performance between this and using the following, in which I can prevent the null in calling the function without the listener, but am still able to call it with a listener as well: foo(); private function foo(event:Event = null):void { } I am not sure wether it is just a question of style, or actually bad practice and I should write two similar functions, one with and one without the event param (which seems cumbersome to me). Looking forward to your opinions, thx.

  Read the article

• KindError: Property r must be an instance of SecondModel, why ?

  - by zjm1126

  class FirstModel(db.Model): p = db.StringProperty() r=db.ReferenceProperty(SecondModel) class SecondModel(db.Model): r = db.ReferenceProperty(FirstModel) class sss(webapp.RequestHandler): def get(self): a=FirstModel() a.p='sss' a.put() b=SecondModel() b.r=a b.put() a.r=b a.put() self.response.out.write(str(b.r.p)) the error is : Traceback (most recent call last): File "D:\Program Files\Google\google_appengine\google\appengine\ext\webapp\__init__.py", line 511, in __call__ handler.get(*groups) File "D:\zjm_code\helloworld\a.py", line 158, in get a.r=b File "D:\Program Files\Google\google_appengine\google\appengine\ext\db\__init__.py", line 3009, in __set__ value = self.validate(value) File "D:\Program Files\Google\google_appengine\google\appengine\ext\db\__init__.py", line 3048, in validate (self.name, self.reference_class.kind())) KindError: Property r must be an instance of SecondModel thanks

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

< Previous Page | 691 692 693 694 695 696 697 698 699 700 701 702  | Next Page >