Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 696/965 | < Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Question in Flex (parser)

  - by shkk

  Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

  Read the article

• what is regular expression not generated over {a,b}?

  - by Loop

  Hello all, I am really stuck with these 2 question for over 2 days now. trying to figure out what the question means.... my tutor is out of town too.... write a regular expression for the only strings that are not generated over {a,b} by the expression: (a+b)*a(a+b)*. explain your reasoning. and i tried the second question, do you think is there any better answer than this one? what is regular expression of set of string that contain an odd number of a's or exactly two b's................(a((a|b)(a|b))*|bb).... coz i know to represent any odd length of a's, the RE is a((a|b)(a|b))*

  Read the article

• Assign pointers in objective C

  - by Tattat

  -(id)setBigObject:(BigObject *)abc{ self.wl = abc; abc.smallObject = self.smallObject; } I have a abc, which is a big Object, when the user pass the bigObject, abc. I assign to my wl value, so , I write "self.wl = abc;", but I want my smallObject assign to the abc's smallObject, so, I do "abc.smallObject = self.smallObject; " So, when I edit the smallObject in self, it will also changed in the abc's also? Am I right?

  Read the article

• Managing a list of threads

  - by Satanlike

  Hi, I have an application (.Net 3.5) which creates threads to write something to the database so that the GUI does not block. All created threads are added to a list, so that I can wait (Thread.Join) for each thread when the application is closed (maybe not all threads are finished when the application is closed, so the app must wait for them). Because of the list I get some serious problems if there are too many threads created (OutOfMemoryException). I tried removing finished threads from the list, but somehow that didn't work. Are there better ways to manage a list of threads, so I can remove them once they are finished?

  Read the article

• KindError: Property r must be an instance of SecondModel, why ?

  - by zjm1126

  class FirstModel(db.Model): p = db.StringProperty() r=db.ReferenceProperty(SecondModel) class SecondModel(db.Model): r = db.ReferenceProperty(FirstModel) class sss(webapp.RequestHandler): def get(self): a=FirstModel() a.p='sss' a.put() b=SecondModel() b.r=a b.put() a.r=b a.put() self.response.out.write(str(b.r.p)) the error is : Traceback (most recent call last): File "D:\Program Files\Google\google_appengine\google\appengine\ext\webapp\__init__.py", line 511, in __call__ handler.get(*groups) File "D:\zjm_code\helloworld\a.py", line 158, in get a.r=b File "D:\Program Files\Google\google_appengine\google\appengine\ext\db\__init__.py", line 3009, in __set__ value = self.validate(value) File "D:\Program Files\Google\google_appengine\google\appengine\ext\db\__init__.py", line 3048, in validate (self.name, self.reference_class.kind())) KindError: Property r must be an instance of SecondModel thanks

  Read the article

• AS3: Performance question calling an event function with null param

  - by adehaas

  Lately I needed to call a listener function without an actual listener like so: foo(null); private function foo(event:Event):void { //do something } So I was wondering if there is a significant difference regarding performance between this and using the following, in which I can prevent the null in calling the function without the listener, but am still able to call it with a listener as well: foo(); private function foo(event:Event = null):void { } I am not sure wether it is just a question of style, or actually bad practice and I should write two similar functions, one with and one without the event param (which seems cumbersome to me). Looking forward to your opinions, thx.

  Read the article

• Odd toString behavior in javascript

  - by George

  I have this small function that's behaving oddly to me. Easy enough to work around, but enough to pique my curiosity. function formatNumber(number,style) { if (typeof style == 'number') { style = style.toString(); } return (number).format(style); } The return format part is based on another function that requires the style variable to be a string to work properly, so I'm just checking if style is a number and if it is to convert it to a string. When the function above is written as is, the format function format doesn't work properly. However when I write it as simply: return (number).format(style.toString()); Everything works. Is there a difference between putting the .toString function inside the format call vs performing it before hand and setting it as the variable style?

  Read the article

• Identify machine (relatively) uniquely using unc path

  - by Gareth

  Using C#, and given that the user enters in a unc path. Is there a way to verify that 2 months down the line, when I'm writing a file to the unc path, that it is the same machine as when he entered it? i.e. I'm writing some sensitive information to the path, and want to stop someone from putting another machine on the network with the same name / share etc and grabbing the output. Or if the software is running on a laptop and the user plugs it into another network, and there just happens to be a machine with the same name / share... Any ideas, other than using the IP address (and verifying that its the same?). I don't necessarily have any rights on the remote machine other than write access to the unc share. Yes, I'm probably being paranoid, but would like to know if anything is possible...

  Read the article

• How to parse out html links from a huge string with html links and other text (Java).

  - by Robert

  Hello, my question is how would i be able to go through a string and take out only the links and erase all the rest? I thought about using some type of delemiter, but wouldnt know how to go about using it in java. an example of what i am trying to do: this is my String: String myString = "The file is http: // www. .com/hello.txt and the second file is " + "http: // www. .com/hello2.dat"; I would want the output to be: "http: // www. .com/hello.txt http: // www. .com/hello2.dat" or each could be added to an array, separately. I just want some ideas, id like to write the code myself but am having trouble on how to do it. Any help would be awesome.

  Read the article

• How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

  - by EugeneP

  How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

  Read the article

• In Ruby, how do I make a hash from an array?

  - by Wizzlewott

  I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

  Read the article

• (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

  - by Pyronaut

  I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

  Read the article

• c# getting value from other form

  - by djuzla123

  Situation i have: textbox(to input your name) on form1. From that form1 on button click i go to form2. From form2 button click to form3. On form3 on button click i need to writte me in empty textbox value from textbox on form1 that user wrote down. example: on form1 in textbox1 i write my name "Djuzla". When i go to form3 and click button to see what name i wrote in form1 it should show in empty textbox3 form3 "Djuzla". I'm stuck with this few hours now, and it stupid problem but i have no idea what to do next.. tried all from zillion theards on net :p

  Read the article

• 1054 - Unknown column 'apa_calda' in 'where clause'

  - by sebastian

  Hi, I keep getting this error in mysql. Here is the query: SELECT user_id FROM detalii_contor WHERE tip_contor=apa_calda i want to use this query in a php file but it doesn't give any result. so i tried to write it in the sql command prompt. here is what i tried in the php file: $Q = "SELECT id_contor, den_contor FROM detalii_contor WHERE tip_contor='".$contor."'"; $Q = "SELECT id_contor, den_contor FROM detalii_contor WHERE tip_contor='$contor'"; even without "" or without '' i wanted to get $contor from a form, i also tried with $_POST['util'] and {$_POST['util']} i've also tried to set $contor the value i need, but no result. please help. thanks, Sebastian

  Read the article

• Help with implementing a function to change size of dynamic array

  - by iRobot

  I'm trying to write a function that will change the size of a dynamic array to a new size. In my header file, I have: Image **images; //pointer to a dynamic array of image pointers int maximum; //size I want to do this by allocating a new array and copying the values over without changing their indices. If there are non-null pointers outside the range newmax, then we cant do this. So heres what I have: There are no compilation or runtime errors. However, I find that the new array isnt getting sized right. When I run the following test case: I should get an index out of bounds error, but instead the system lets it slide. Can anyone see the mistake? I've looked for hours but cant find anything.

  Read the article

• How do I pick the most beneficial combination of items from a set of items?

  - by Chu

  I'm designing a piece of a game where the AI needs to determine which combination of armor will give the best overall stat bonus to the character. Each character will have about 10 stats, of which only 3-4 are important, and of those important ones, a few will be more important than the others. Armor will also give a boost to 1 or all stats. For example, a shirt might give +4 to the character's int and +2 stamina while at the same time, a pair of pants may have +7 strength and nothing else. So let's say that a character has a healthy choice of armor to use (5 pairs of pants, 5 pairs of gloves, etc.) We've designated that Int and Perception are the most important stats for this character. How could I write an algorithm that would determine which combination of armor and items would result in the highest of any given stat (say in this example Int and Perception)?

  Read the article

• @echo off in DOS (cmd)

  - by Rayne

  I'm trying to write a BAT script and I have the following: @echo off REM Comments here SETLOCAL ENABLEDELAYEDEXPANSION set PROG_ROOT=C:\Prog set ONE=1 echo 1>> %PROG_ROOT\test.txt echo %ONE%>> %PROG_ROOT\test.txt for /f "tokens=*" %%f in (folders.txt) do ( echo %%f>> %PROG_ROOT\test.txt ) ENDLOCAL My folders.txt contains the number "5". My test.txt output is ECHO is off ECHO is off 5 I don't understand why the first 2 lines of output has "ECHO is off", while the third line is printed out correctly. How do I print the correct output?

  Read the article

• Problem with an application in USB

  - by rajivpradeep

  I have an application on a pen drive, which executes some flash files on the same USB flash drive. when i run the application with in the drive, the application just keeps running in the back ground without running the flash files. When i copy the application on desktop, it runs the flash files in the USB. Also i programmed the app to write log file, when i run the application with in USB, the app is running but the log file is not getting written, when i remove the pen drive, the file gets written. What might be the problem, I am using VC++ , VS 2008 to build the application.

  Read the article

• How come the [L] flag isn't working in my .htaccess file?

  - by George Edison

  Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

  Read the article

• Can I reproduce Scala's behavior for == ?

  - by JPP

  In Programming in Scala, I can read that the == operator behaves as if it was defined like this: final def == (that: Any): Boolean = if (null eq this) {null eq that} else {this equals that} But there must actually be compiler magic to avoid null pointer exceptions, right? Is there any way for me to replicate this behavior with pure Scala; i.e., have an operator/method return one thing if the receiver is null and another one if it isn't? What I mean is an actual implementation of null eq this. I suppose I can write a "pimp" and then define the method on the wrapper class, but is there a more direct way to do this?

  Read the article

• Writing an installer using codigniter

  - by RobertWHurst

  I'm just about finished my first release of automailer, a program I've been working on for a while now. I've just got to finish writing the installer. Its job is to rewrite the codigniter configs from templates. I've got the read/write stuff working, but I'd like to be able to test the server credentials given by the user without codingiter throwing a system error if they're wrong. Is there a function other than mysql_connect that I can use to test a connection that will return true or false and won't make codeigniter have a fit?

  Read the article

• need to loop through a PHP array in JavaScript

  - by user296516

  Hi guys, For example I have a PHP array, such as this one <?php $s= array('a','b','c','d','e','f') ; ?> And I need to loop through it in JavaScript, any ideas how do I do that? for ( i=0 ; i < <?php echo sizeof($s) ?> ; i++) { document.write('<?php echo $s [somehow need to get the 'i' value into here] ?>'); } Any suggestions? Thanks!

  Read the article

• Strange python error

  - by Werner

  Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

  Read the article

• Java generics: actual class as a generic parameter.

  - by user554916

  What do I write instead of "TheClass" to make this work? Or is there an alternative way to do it (possibly without making WithName and WithAge generic)? class Item { NeigborList<TheClass> neighbors; } class WithName extends Item { // here I want neighbors to be a NeighborList<WithName> String name; void someMethod() { System.out.println(neighbors.nearestTo(this).name); } } class WithAge extends Item { // here I want neighbors to be a NeighborList<WithAge> int age; void someOtherMethod() { System.out.println(neighbors.nearestTo(this).age); } }

  Read the article

< Previous Page | 692 693 694 695 696 697 698 699 700 701 702 703  | Next Page >