Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 697/965 | < Previous Page | 693 694 695 696 697 698 699 700 701 702 703 704  | Next Page >

• How to edit files on the users file system from my web server?

  - by Abs

  Hello all, I am really looking for implementation advice as I have entered a new realm that I am not familiar with. At the simplest level, I would like to find a way that I can read/write to a users machine from my web server. For this to work, I think I will have to install some sort of "plugin" on the users machine which can receive (or poll?) the server for instructions. The above is the line of thought that I currently have, maybe using JAVA to do this. This needs to work on Linux, Mac and Windows OS. I am really looking for advice on the above, is it a good idea? Is there a better way of doing this? Is there something out there already that I can build on top of? I really appreciate all input and advice as this is something I have not done before. Thanks all

  Read the article

• Importing data from many excel workbooks and sheets into a single workbook/table

  - by Max Rusalen

  Hi, I have 54 excel files with three sheets each, each sheet has a different amount of data entries but they are set out in a identical format, and I need to import the data from those sheets into a single workbook using VBA. Is there any way I can program it so I can build the loops to import the data, but without having to write in each workbook name for each loop/sheet? I think I can use the call function, but I don't know how to make the loop codes independent of the workbook name they apply to. Thank you so much in advance, Millie

  Read the article

• What is this C function supposed to do based on description?

  - by user1261445

  unsigned int hex_c0c0c0c0(): Allowed operators: + - = & | ~ << ! >> Allowed constants: 1 2 4 8 16 Return 0xc0c0c0c0 The above is the description I have been given and I have to write the code for it. Can someone tell me what exactly the function is supposed to do? All the description says is what I have pasted above, so I'm not sure what my goal is. I'm sure it is an easy enough function to program on my own, but it would help if someone could tell me what the function is supposed to do, and maybe provide sample input/output so that I know my code is working correctly once I program this. Thanks.

  Read the article

• list within a list

  - by atm atm

  I'm working on this problem, but I cannot figure out the second part. I tried using reverse list but it did not work out how I planned it. Given a list L (e.g. [1,2,3,4]), write a program that generates the following nested lists: L1 = [[1],[1,2],[1,2,3],[1,2,3,4]], L2 = [[4],[3,4],[2,3,4],[1,2,3,4]]. My code that I have so far: mylist=[,1,2,3,4] print("Orginal list L=",mylist) n=len(mylist) l1=[] l2=[] for x in range(1,n+1,1): l1.append(mylist[0:x]) print("L1=",l1) #prints final product of l1 mylist.reverse() #this is where i get messed up for x in range(1,n+1,1): l2.append(mylist[0:x]) print("L2=",l2)

  Read the article

• Subversion Copy Hook on Windows

  - by GeoSQL

  Hi I am working on a web based project in my free time. I have SVN set up on my machine (running XP). What I would like to do is have a copy of my repository copied to the htdocs folder (Dev machine) post-commit via a hook. That way I can test my changes in a browser. I know that I can write up a .bat file, but I'm not sure what the syntax would be. I can do a basic DOS Copy command, but I saw one example that provided a username and password to SVN at copy time. Do I need to do this? Can someone point me in the right direction as far a syntax for the .bat file? Or maybe even suggest a better method. Thanks

  Read the article

• Running Test framework as part of application

  - by VP

  Hi, I would like to know if it is possible in rails to run some test cases through my application. I mean, i want show the test results to users. So i was thinking to be able to call my tests through a controller and put the tests output in a dialog. Imagine that i'm doing an application where before to apply a rule, i want to run some validation tests. I could write methods in my rule model to do it, but i would like to use something like shoulda or any other kind of DSL where the "fixture" would be a record itself. Any tip or idea?

  Read the article

• How to scramble string C#?

  - by a_Elnajjar

  I write the code to scramble word I am create simple game jumble string jumble = theWord; int length = jumble.Count(); for (int i = 0; i < length; ++i) { int index1 = (rand.Next() % length); int index2 = (rand.Next() % length); char temp =jumble[index1]; jumble = jumble.Replace(jumble[index1], jumble[index2]); jumble = jumble.Replace(jumble[index1], temp); }

  Read the article

• How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

  - by EugeneP

  How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

  Read the article

• Create set of random JPGs

  - by Kylar

  Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

  Read the article

• detect a string contained by another discontinuously

  - by SpawnCxy

  Recently I'm working on bad content(such as advertise post) filter of a BBS.And I write a function to detect a string is in another string not continuously.Code as below: $str = 'helloguys'; $substr1 = 'hlu'; $substr2 = 'elf'; function detect($a,$b) //function that detect a in b { $c = ''; for($i=0;$i<=strlen($a);$i++) { for($j=0;$j<=strlen($b);$j++) { if($a[$i] == $b[$j]) { $b=substr($b,$j+1); $c .=$a[$i]; break; } } } if($c == $a) return true; else return false; } var_dump(detect($substr1,$str)); //true var_dump(detect($substr2,$str)); //false Since the filter works before the users do their posts so I think the efficiency here is important.And I wonder if there's any better solution? Thanks!

  Read the article

• Managing a list of threads

  - by Satanlike

  Hi, I have an application (.Net 3.5) which creates threads to write something to the database so that the GUI does not block. All created threads are added to a list, so that I can wait (Thread.Join) for each thread when the application is closed (maybe not all threads are finished when the application is closed, so the app must wait for them). Because of the list I get some serious problems if there are too many threads created (OutOfMemoryException). I tried removing finished threads from the list, but somehow that didn't work. Are there better ways to manage a list of threads, so I can remove them once they are finished?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Is there a jQuery plugin for making a step-by-step type presentation?

  - by Earlz

  Hello, I was making a small thing in HTML and basically I have some "frames" like <div id="frame_1"> ... </div> <div id="frame_2"> ... </div> ... Basically what I want is for only one frame to be visible at one time and to navigate between frames easily with previous and next buttons (navigation by frame number a plus, but not required) Before I set out to write it myself I figured someone had already done it so has it been done?

  Read the article

• Memcached in a trusted shared environment?

  - by John Kary

  We are a university IT organization that hosts all of the university's websites on several shared servers on our server room floor. We have several VMs, each running its own instance of Apache as a web server for each respective server. If we were going to setup a memcached server, is it feasible to use it as a shared instance? If shared by several servers, or even multiple web apps running on the same server, what's the best way to keep each app's cache stores separate? Prefix the key? Would each VM require its own instance of memcached, or could we setup 1 memcached server and allow our multiple VMs to read/write to it?

  Read the article

• Integrate existing Spring based web application with a CMS

  - by anne_developer

  We have stable spring based (spring 2.x) web application. We have a new requirement which is our data entry operators should be able to login to some kind of an admin module and simply change the text in the web pages, change the color etc. I have seen PHP based CMS’s that allows authorized user to change the content in WYSIWYG manner. If anyone of you knows such open source Java CMS or third party application, which can facilitate such thing, please let me know. Please note: we cannot write our application from scratch. We are looking for pluggable component.

  Read the article

• Silently binding a variable instance to a class in C++?

  - by gct

  So I've got a plugin-based system I'm writing. Users can create a child class of a Plugin class and then it will be loaded at runtime and integrated with the rest of the system. When a Plugin is run from the system, it's run in the context of a group of plugins, which I call a Session. My problem is that inside the user plugins, two streaming classes called pf_ostream and pf_istream can be used to read/write data to the system. I'd like to bind the plugin instance's session variable to pf_ostream and pf_istream somehow so that when the user instantiates those classes, it's already bound to the session for them (basically I don't want them to see the session internals) I could just do this with a macro, wrapping a call to the constructor like: #define MAKE_OSTREAM = pf_ostream_int(this->session) But I thought there might be a better way. I looked at using a nested class inside Plugin wrapping pf_ostream but it appears nested classes don't get access to the enclosing classes variables in a closure sort of way. Does anyone know of a neat way to do this?

  Read the article

• need to loop through a PHP array in JavaScript

  - by user296516

  Hi guys, For example I have a PHP array, such as this one <?php $s= array('a','b','c','d','e','f') ; ?> And I need to loop through it in JavaScript, any ideas how do I do that? for ( i=0 ; i < <?php echo sizeof($s) ?> ; i++) { document.write('<?php echo $s [somehow need to get the 'i' value into here] ?>'); } Any suggestions? Thanks!

  Read the article

• Do I need the text "_size" in the my.cnf file for mysql 5.1?

  - by chongman

  This is a pretty simple question about setting parameters in the my.cnf file for mysql 5.1. This page gives me the parameters I can tune: http://dev.mysql.com/doc/refman/5.0/en/server-parameters.html and so I think I would need to write key_buffer_size = 256M But when I open my current my.cnf, it has the line: key_buffer = 16M My question is, do I need "key_buffer_size" or "key_buffer" or does it not matter which I use? And, how would I know if something in the my.cnf is incorrect? Where's the daemon start log file? I am running ubuntu; I think version 8.04 LTS

  Read the article

• Finding employees specific to department in SQL SERVER 2000(SET BASED)

  - by xyz

  Suppose I have a table (tblEmp) whose structure is like as under Dept Emp d1 e1 d1 e2 d1 e3 d2 e4 d2 e5 d3 e6 If I need to bring the output as Dept DepartmentSpecificEmployees d1 e1,e2,e3 d2 e4,e5 d3 e6 I will write the query as select Dept, stuff((select Emp + ',' from tblEmp t2 where t1.Dept = t2.Dept for xml path(''),1,1,'')DepartmentSpecificEmployees from tblEmp t1 group by Dept But this will work in Sql Server 2005+. How can I achieve the same in Sql Server 2000 without any variable declaration or loop or cursor? If I use COALESCE as an alternative, then I need to use a variable which will defeat the purpose Please help

  Read the article

• How to create your own advert engine for an Android App?

  - by Richard Green

  I have an Android App and I would like to start putting non-intrusive advert into the app. However, I have the benefit of knowing exactly what products I would like to put in these adverts (which will basically be amazon "similar products" type things and a few other suppliers). Is there any ad-engine out there that will allow me to do this? The ones I see already just put what they think are suitable. I have scoured and I can't find an example of this... Any ideas? Should I just bite the bullet and write my own classes to do this ?

  Read the article

• How do I make dynamic windows in Swing?

  - by Roman

  I have a general question. I would like to have a window containing some buttons, radio buttons, text fields and so on. So, user can do something (write text, select options and press buttons). As the result of the user activity window should change it structure/appearance some element should disappear and some appear. How do I program such "updates"? Should I close an old window and open a new one or I can modify content of window without closing it?

  Read the article

• How to cin Space in c++?

  - by Narek

  Say we have a code: int main() { char a[10]; for(int i = 0; i < 10; i++) { cin>>a[i]; if(a[i] = ' ') cout<<"It is a space!!!"<<<endl; } return 0; } How to cin a Space symbol from command line? If you write space, program ignores! :(

  Read the article

• How to schedule hundreds of thousands of tasks?

  - by wehriam

  We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

  Read the article

• How can I implement log4j logging to an existing J2EE Struts web application?

  - by Ruepen

  I have recently inherited a J2EE Struts web app that was written back in 2002. There is no logging in the application other than the odd System.out.println(). I have added log4j logging so that I can write out some info to the console, but I'm concerned on how best to approach this. Any suggestions, tips, best practices would be welcome as I don't want to spend too much time adding logging to every method or class (or trying to find what places where logging would be best - ie. bad code blocks/defects). My current approach is to just add some logging to the few classes that I have been looking at to understand the code, but are there a few key places where I can add logging to maximize my use of adding log4j?

  Read the article

• jQuery: Toggling an image when toggling a DIV

  - by Wanda

  Hey guys, I'm trying to write some jQuery that will toggle DIVs open and closed, and it's working, but I want an arrow that will change to "down" if the DIV is expanded, and "right" if the DIV is collapsed. What I have so far: $('.toggleHead').click(function() { $('#arrow').attr('src', 'images/icons/down.png'); $(this).next().toggle(); return false; }).next().hide(); Where would I put the other $('#arrow').attr('src', 'images/icons/right.png');? Thanks!

  Read the article

< Previous Page | 693 694 695 696 697 698 699 700 701 702 703 704  | Next Page >