Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 697/965 | < Previous Page | 693 694 695 696 697 698 699 700 701 702 703 704  | Next Page >

• Problem with an application in USB

  - by rajivpradeep

  I have an application on a pen drive, which executes some flash files on the same USB flash drive. when i run the application with in the drive, the application just keeps running in the back ground without running the flash files. When i copy the application on desktop, it runs the flash files in the USB. Also i programmed the app to write log file, when i run the application with in USB, the app is running but the log file is not getting written, when i remove the pen drive, the file gets written. What might be the problem, I am using VC++ , VS 2008 to build the application.

  Read the article

• what is regular expression not generated over {a,b}?

  - by Loop

  Hello all, I am really stuck with these 2 question for over 2 days now. trying to figure out what the question means.... my tutor is out of town too.... write a regular expression for the only strings that are not generated over {a,b} by the expression: (a+b)*a(a+b)*. explain your reasoning. and i tried the second question, do you think is there any better answer than this one? what is regular expression of set of string that contain an odd number of a's or exactly two b's................(a((a|b)(a|b))*|bb).... coz i know to represent any odd length of a's, the RE is a((a|b)(a|b))*

  Read the article

• @echo off in DOS (cmd)

  - by Rayne

  I'm trying to write a BAT script and I have the following: @echo off REM Comments here SETLOCAL ENABLEDELAYEDEXPANSION set PROG_ROOT=C:\Prog set ONE=1 echo 1>> %PROG_ROOT\test.txt echo %ONE%>> %PROG_ROOT\test.txt for /f "tokens=*" %%f in (folders.txt) do ( echo %%f>> %PROG_ROOT\test.txt ) ENDLOCAL My folders.txt contains the number "5". My test.txt output is ECHO is off ECHO is off 5 I don't understand why the first 2 lines of output has "ECHO is off", while the third line is printed out correctly. How do I print the correct output?

  Read the article

• Windows 8 Set User Account Image

  - by Nexion

  I'm trying to write a small CONSOLE (not metro style) app to quickly change the user account image of the current user to a select image for a setup scrip that I'm running on a bunch of laptops. They're all Windows 8 and (since it hasn't been out terribly long) I can't find a ton of info on it. I did manage to figure out that you need to use the Windows.System.UserProfile object to do so, but I can't find any documentation on how to do so in a console app. Thoughts? Suggestions?

  Read the article

• How to version SQL Server schema using VS 2005?

  - by Mike

  I am new to C# programming and am coming to it most recently from working with Ruby on Rails. In RoR, I am used to being able to write schema migrations for the database. I would like to be able to do something similar for my C#/SQLServer projects. Does such a tool exist for the VS 2005 toolset? Would it be wise to use RoR migrations with SQL Server directly outside of VS 2005? In other words, I would handle all schema versioning using ActiveRecord:Migration from Rails but nothing else. If I do handle migrations outside of C# and VS 2005 with another tool, is RoR ActiveRecord:Migration the best thing to use or is there something which is a better fit?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• SQL grouping query question; evaluating a group of rows based on the value of one field.

  - by user324575

  I've got table vendorparts that lists all my parts and their vendor(s). Parts with multiple vendors have multiple records in this table. I'm trying to write a query that only returns the partid, and vendor of parts that do not have a default vendor assigned. Partid Vendor Defaultflag 1 A 1 2 B 0 2 C 0 3 D 0 3 E 0 3 F 1 4 G 0 I would like to return the following: Partid Vendor 2 A 2 B 4 G I'm obviously having issues with partid 3 and getting the query to see it as having a default vendor assigned.

  Read the article

• How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way?

  - by EugeneP

  How to deal with the Hibernate hql multi-join query result in an Object-Oriented Way? As I see it returns a list of Objects. yes, it is tricky and only you who write the query know what should the query return (what objects). But are there ways to simplify things, so that it returned specific objects with no need in casting Object to a specific class according to its position in the query ? Maybe Spring can simplify things here? It has the similar functionality for JDBC, but I don't see if it can help in a similar way with Hibernate.

  Read the article

• PotgreSQL 2D array to rows

  - by PostGreSQL newbie

  Hello, I am new to PostgreSQL array's. I am trying to a write a procedure to convert array-into-rows, and wanted following output: alphabet | number ---------+---------- A | 10 B | 10 C | 6 D | 9 E | 3 from following: id | alphabet_series -------+-------------------------------------------------------------------------------------------------- 1 | {{A,10},{B,10},{C,6},{D,9},{E,3},{F,9},{I,10},{J,17},{K,16},{L,17},{M,20},{N,13},{O,19}} I have searched for array-to-rows functions, but they all seems to accept 1-d array. but in this case, it is 2-d array. Any pointers will be appreciated. Many thanks.

  Read the article

• "IOError [Errno 13] Permisson denied" when copy a file on Windows

  - by wong2

  Hi, I wrote a program that will copy a file called a.exe to C:/Windows/, then I pack it to exe with PyInstaller, and rename the exe file to a.exe. When I run the exe file, it output IOError [Errno 13] Permisson denied: 'C:/Windows/a.exe', but the file a.exe was copied to the directory C:/Windows. Then I ran it as the Administrator, it happened again... At first, I copy the file with shututil.copy, then I wrote a function myself(open a.exe, create a.exe under C:/Windows, read a.exe 's content and write to C:/Windows/a.exe, close all), but it doesn't help...Any ideas?

  Read the article

• hook to save action in eclipse plugin

  - by 4485670

  I want to create a Google Closure Compiler plugin for eclipse. I already have a popup menu entry to compile a Javascript file to its minified version. But it would be more than helpful if every time you save a *.js that minified version would be generated automatically. I read/heard about natures and builders, extension points and IResourceChangeListener. But I did not manage to figure out what I should use and especially how to get it to work. Is there a working example of a plugin that does "the same kind of thing" so I can work from that or a tutorial to write such? With the answer below I searched for projects that use the IResourceChangeListener and came up with this code: manifest: http://codepaste.net/3yahwe plugin.xml: http://codepaste.net/qek3rw activator: http://codepaste.net/s7xowm DummyStartup: http://codepaste.net/rkub82 MinifiedJavascriptUpdater: http://codepaste.net/koweuh There in the MinifiedJavascriptUpdater.java which holds the code for the IResourceChangeListener the "resourceChanged" function is never reached.

  Read the article

• In Ruby, how do I make a hash from an array?

  - by Wizzlewott

  I have a simple array: arr = ["apples", "bananas", "coconuts", "watermelons"] I also have a function f that will perform an operation on a single string input and return a value. This operation is very expensive, so I would like to memoize the results in the hash. I know I can make the desired hash with something like this: h = {} arr.each { |a| h[a] = f(a) } What I'd like to do is not have to initialize h, so that I can just write something like this: h = arr.(???) { |a| a => f(a) } Can that be done?

  Read the article

• between syntax, are there any equal function

  - by gcc

  /* char **mainp=malloc(sizeof(char *)*2); mainp[0]=malloc(sizeof(char)*300); mainp[1]=malloc(sizeof(char )*300); */ *I have some input about propositional calculus *After calculating some math funtion-removing paranthesis-changing"&" with ","-replacing "|" with"," I have >> (1) P,-Q,Q,-R is stored in mainp[0] R,A,P,B,F is stored in mainp[1] *My question is: Between comma , I have want to compare two pointer array. If there is any equal two or more functions(Q,-R is function representation) ,function which you will show me how to write must return int. According to example (1),function will return 1 (I expect like that) /*I have som thought://which function should I have use:*/ in for loop if( strspn(mainp[0][i])==1 ) increment d; continue; or in for loop srtcmp(mainp[0][i],mainp[1]);

  Read the article

• how to compress a PNG image using Java

  - by 116213060698242344024

  Hi I would like to know if there is any way in Java to reduce the size of an image (use any kind of compression) that was loaded as a BufferedImage and is going to be saved as an PNG. Maybe some sort of png imagewriteparam? I didnt find anything helpful so im stuck. heres a sample how the image is loaded and saved public static BufferedImage load(String imageUrl) { Image image = new ImageIcon(imageUrl).getImage(); bufferedImage = new BufferedImage(image.getWidth(null), image.getHeight(null), BufferedImage.TYPE_INT_ARGB); Graphics2D g2D = bufferedImage.createGraphics(); g2D.drawImage(image, 0, 0, null); return bufferedImage; } public static void storeImageAsPng(BufferedImage image, String imageUrl) throws IOException { ImageIO.write(image, "png", new File(imageUrl)); }

  Read the article

• Question in Flex (parser)

  - by shkk

  Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

  Read the article

• Ignoring specific differences in diff

  - by naumcho

  When doing recursive diffs I want to ignore expected differences/translations - is there a way to do that with standard unix tools? E.g. file1: 1 ... 2 /path/to/something/ver1/blah/blah 3 /path/to/something/ver1/blah/blah 4 ... file2: 1 ... 2 /path/to/something/ver2/blah/blah 3 /path/to/something/ver3/blah/blah 4 ... I want to be able to do something like: diff file1 file2 --ignore-transltion "ver1>ver2" This should show only show me that line 3 is different Does anyone know of a good way to do that? I can easily write a perl script to do it but i will end up re-implementing most of the rest of the functionality of 'diff'. Update: My goal is to run this on directories with different versions of the same files with "diff -r" so I can spot unexpected differences in versions.

  Read the article

• A simple log file format

  - by hgulyan

  Hi, I'm not sure if it was asked, but I couldn't find anything like this. My program uses a simple .txt file for log purposes, It just creates/opens a file and appends lines. After some time, I started to log quite a lot of activities, so the file became too large and hardly readable. I know, that it's not write way to do this, but I simply need to have a readable file. So I thought maybe there's a simple file format for log files and a soft to view it or if you'd have any other suggestions on this question? Thanks for help in advance.

  Read the article

• How come the [L] flag isn't working in my .htaccess file?

  - by George Edison

  Here are the rules: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^$ index.php?action=home [L] RewriteRule ^[\w\W]*$ error.php [L] When a page matches the first one, it is supposed to ignore any other further rules. Yet accessing / results in error.php being invoked. Commenting out the second rule works as intended - the page redirects to index.php. What am I doing wrong? Also: is there a better way to write the last line? It's basically a catch-all.

  Read the article

• c# getting value from other form

  - by djuzla123

  Situation i have: textbox(to input your name) on form1. From that form1 on button click i go to form2. From form2 button click to form3. On form3 on button click i need to writte me in empty textbox value from textbox on form1 that user wrote down. example: on form1 in textbox1 i write my name "Djuzla". When i go to form3 and click button to see what name i wrote in form1 it should show in empty textbox3 form3 "Djuzla". I'm stuck with this few hours now, and it stupid problem but i have no idea what to do next.. tried all from zillion theards on net :p

  Read the article

• How to define a ternary operator in Scala which preserves leading tokens?

  - by Alex R

  I'm writing a code generator which produces Scala output. I need to emulate a ternary operator in such a way that the tokens leading up to '?' remain intact. e.g. convert the expression c ? p : q to c something. The simple if(c) p else q fails my criteria, as it requires putting if( before c. My first attempt (still using c/p/q as above) is c match { case(true) = p; case _ = q } another option I found was: class ternary(val g: Boolean = Any) { def |: (b:Boolean) = g(b) } implicit def autoTernary (g: Boolean = Any): ternary = new ternary(g) which allows me to write: c |: { b: Boolean = if(b) p else q } I like the overall look of the second option, but is there a way to make it less verbose? Thanks

  Read the article

• Writing at the end of file

  - by user342534

  Hi, I'm working on a system that requires high file I/O performance (with C#). Basically, I'm filling up large files (~100MB) from the start of the file until the end of the file. Every ~5 seconds I'm adding ~5MB to the file (sequentially from the start of the file), on every bulk I'm flushing the stream. Every few minutes I need to update a structure which I write at the end of the file (some kind of metadata). When flushing each one of the bulks I have no performance issue. However, when updating the metadata at the end of the file I get really low performance. My guess is that when creating the file (which also should be done extra fast), the file doesn't really allocates the entire 100MB on the disk and when I flush the metadata it must allocates all space until the end of file. Guys/Girls, any Idea how I can overcome this problem? Thanks a lot!

  Read the article

• Writing an installer using codigniter

  - by RobertWHurst

  I'm just about finished my first release of automailer, a program I've been working on for a while now. I've just got to finish writing the installer. Its job is to rewrite the codigniter configs from templates. I've got the read/write stuff working, but I'd like to be able to test the server credentials given by the user without codingiter throwing a system error if they're wrong. Is there a function other than mysql_connect that I can use to test a connection that will return true or false and won't make codeigniter have a fit?

  Read the article

• How to schedule hundreds of thousands of tasks?

  - by wehriam

  We have hundreds of thousands of tasks that need to be run at a variety of arbitrary intervals, some every hour, some every day, and so on. The tasks are resource intensive and need to be distributed across many machines. Right now tasks are stored in a database with an "execute at this time" timestamp. To find tasks that need to be executed, we query the database for jobs that are due to be executed, then update the timestamps when the task is complete. Naturally this leads to a substantial write load on the database. As far as I can tell, we are looking for something to release tasks into a queue at a set interval. (Workers could then request tasks from that queue.) What is the best way to schedule recurring tasks at scale? For what it's worth we're largely using Python, although we have no problems using components (RabbitMQ?) written in other languages.

  Read the article

• JavaScript not working with Chrome & Xampp!

  - by Anonymous

  Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

  Read the article

• (WinForm/.net) Databind List Of Classes To A DataGridView. But Not Show Certain Public Properties

  - by Pyronaut

  I'm not even sure if i'm doing this correctly. But basically I have a list of objects that are built out of a class. From there, I am binding the list to a datagrid view that is on a Windows Form (C#) From there, it shows all the public properties of the object, in the datagrid view. However there is some properties that i still need accessible from other parts of my application, but aren't really required to be visible in the DataGridView. So is there an attribute or something similar that I can write above the property to exclude it from being shown. P.S. Im binding at runtime. So i cannot edit the columns via the designer. P.P.S. Please no answers of just making public variables (Although if that is the only way, let me know :)).

  Read the article

< Previous Page | 693 694 695 696 697 698 699 700 701 702 703 704  | Next Page >