Search Results

Search found 19863 results on 795 pages for 'python subprocess module'.

Page 70/795 | < Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >

  • python 'self' explained

    - by richzilla
    What is the purpose of the 'self' word in python. I understand it refers to the specific object created from that class, but i cant see why it explicitly needs to be added to very function as a parameter. To illustrate, in ruby, i could do this: class myClass def myFunc(name) @name = name end end Which i understand, quite easily, However in python i need to include self: class myClass: def myFunc(self, name): self.name = name Can anyone talk me through this? Any help would be appreciated.

    Read the article

  • how to go back to first if statement if no choices are valid - python

    - by wondergoat77
    how can i have python move to the top of an if statement if nothing is satisfied correctly i have a basic if/else statement like this: print "pick a number, 1 or 2" a = int(raw_input("> ") if a == 1: print "this" if a == 2: print "that" else: print "you have made an invalid choice, try again." what i want is to prompt the user to make another choice for 'a' this if statement without them having to restart the entire program, but am very new to python and am having trouble finding the answer online anywhere.

    Read the article

  • How to pick a chunksize for python multiprocessing with large datasets

    - by Sandro
    I am attempting to to use python to gain some performance on a task that can be highly parallelized using http://docs.python.org/library/multiprocessing. When looking at their library they say to use chunk size for very long iterables. Now, my iterable is not long, one of the dicts that it contains is huge: ~100000 entries, with tuples as keys and numpy arrays for values. How would I set the chunksize to handle this and how can I transfer this data quickly? Thank you.

    Read the article

  • what does "from MODULE import _" do in python?

    - by Paul
    Hi all, In the Getting things gnome code base I stumbled upon this import statement from GTG import _ and have no idea what it means, never seen this in the documentation and a quick so / google search didn't turn anything up. Thank you all in advance Paul

    Read the article

  • How to parse json data in Python?

    - by backcross
    Please help me to parse this json in python. { "IT" : [ { "firstName" : "ajay", "lastName" : "stha", "age" : 24 }, { "firstName" : "Michiel", "lastName" : "Og", "age" : 35 } ], "sales" : [ { "firstName" : "Guru", "lastName" : "red", "age" : 27 }, { "firstName" : "Jim", "lastName" : "Galley", "age" : 34 } ] } How to parse this json in Python?Please help me

    Read the article

  • Using Python to add/remove Ubuntu login script items

    - by codebox_rob
    I have written a Python application and would like to give my users the option of having the app automatically launch itself when the user logs in. It is important that the user is able to toggle this option on/off from within the app itself, rather than having to manually edit login scripts, so this needs to be done from within the Python code rather than from a shell script. The app is deployed on Ubuntu Linux, any suggestions for the best way of doing this?

    Read the article

  • File encyption with Python

    - by Pinkie
    Is there a way to encrypt files (.zip, .doc, .exe, ... any type of file) with Python? I've looked at a bunch of crypto libraries for Python including pycrypto and ezpycrypto but as far as I see they only offer string encryption.

    Read the article

  • More nest Python nested dictionaries.

    - by clutch
    After reading http://stackoverflow.com/questions/635483/what-is-the-best-way-to-implement-nested-dictionaries-in-python why is it wrong to do: c = collections.defaultdict(collections.defaultdict(int)) in python? I would think this would work to produce {key:{key:1}} or am I thinking about it wrong?

    Read the article

  • install python modules on shared web hosting

    - by Ali
    I am using a shared hosting environment that will not give me access to the command line. Can I download the python module on my computer, compile it using python setup.py installand then simply upload a .py file to the web host? If yes, where does the install statement place the compiled file?

    Read the article

  • Python 3.1 twitter post with installed library,

    - by Andrew
    I'd like to be able to post twitter messages from python 3.0. None of the twitter API I have looked at support python 3.1. Since the post proceedure only requires this : JSON: curl -u username:password -d status="your message here" http://api.twitter.com/1/statuses/update.json I was wondering if it is possible with the standard libraries to format this so a message could be sent. My head says it should be possible.

    Read the article

  • How can I get the last-modified time with python3 urllib?

    - by Daenyth
    I'm porting over a program of mine from python2 to python3, and I'm hitting the following error: AttributeError: 'HTTPMessage' object has no attribute 'getdate' Here's the code: conn = urllib.request.urlopen(fileslist, timeout=30) last_modified = conn.info().getdate('last-modified') This section worked under python 2.7, and so far I haven't been able to find out the correct method to get this information in python 3.1. The full context is an update method. It pulls new files from a server down to its local database, but only if the file on the server is newer than the local file. If there's a smarter way to achieve this functionality than just comparing local and remote file timestamps, then I'm open to that as well.

    Read the article

  • Python: Is there a way to reflectivly list all attributes of a class

    - by hhafez
    Given a class such as def MyClass text = "hello" number = 123 Is there a way in python to inspect MyClass an determine that it has the two attributes text and number. I can not use something like inspect.getSource(object) because the class I am to get it's attributes for are generate using SWIG (so they are hidden in .so :) ). So I am really looking for something equivalant to Java's [Class.getDeclardFields][1] Any help would be appreciated, otherwise I'll have to solve this problem with SWIG + JAVA instead of SWIG + Python.

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Paste Excel clip to body of an email through Python

    - by Twinkle
    I am using win32com.client in Python to send an email. However I want the body of the email to be a table (HTML- formatted table), I can do it in an Excel first and then copy and paste (but how?), or directly edit the corresponding Pandas data frame. newMail.body = my_table which is a Pandas data frame didn't work. So I'm wondering if there is smarter ways for example, to combine Excel with Outlook apps within Python? Cheers,

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • copy files to nework path or Drive using python

    - by user218976
    hi , Mine is similar to this question. http://stackoverflow.com/questions/2042342/network-path-and-variables-in-python/2042376 The only difference is my network drive has a password protect with user name and password . I need to copy files to a samba share using python and verify it. if i manually login in then the code works but without logging in the shutil command does not work Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Eclipse Python Integration

    - by BCS
    I found this python plugin list but thought I'd ask if anyone has any experience with anything listed there? I'm totally new to both python and dynamic programming languages if that makes any difference.

    Read the article

  • Latest 100 mentions - Twitter api

    - by laurens
    I'm looking to achieve the following: For a specific person, for example BarackObama, I'd like to get the last 100 times/tweets he was mentioned. Not his own tweets but the tweets of others containing @BarackObama. In the end I'd like to have: the person who mentioned, location, datetime. This content should be written to a flat file. I've been experimenting with the Twitter API and Python, with success but haven't yet succeeded achieving the above problem. I know there is a dev sections on the twitter website but they don't provide any example of code!! https://dev.twitter.com/docs/api/1/get/statuses/mentions count=100 .... For me the scripting language or way of doing is not relevant it's the result. I just read on the internet that python and Twitter api are a good match. Thanks a lot in advance!!

    Read the article

< Previous Page | 66 67 68 69 70 71 72 73 74 75 76 77  | Next Page >