Search Results

Search found 35561 results on 1423 pages for 'value'.

Page 705/1423 | < Previous Page | 701 702 703 704 705 706 707 708 709 710 711 712  | Next Page >

  • Elegant code question: How to avoid creating unneeded object

    - by SeaDrive
    The root of my question is that the C# compiler is too smart. It detects a path via which an object could be undefined, so demands that I fill it. In the code, I look at the tables in a DataSet to see if there is one that I want. If not, I create a new one. I know that dtOut will always be assigned a value, but the the compiler is not happy unless it's assigned a value when declared. This is inelegant. How do I rewrite this in a more elegant way? System.Data.DataTable dtOut = new System.Data.DataTable(); . . // find table with tablename = grp // if none, create new table bool bTableFound = false; foreach (System.Data.DataTable d1 in dsOut.Tables) { string d1_name = d1.TableName; if (d1_name.Equals(grp)) { dtOut = d1; bTableFound = true; break; } } if (!bTableFound) dtOut = RptTable(grp);

    Read the article

  • Is there a way to load an existing connection string for Linq to SQL from an app.config file?

    - by Brian Surowiec
    I'm running into a really annoying problem with my Linq to SQL project. When I add everything in under the web project everything goes as expected and I can tell it to use my existing connection string stored in the web.config file and the Linq code pulls directly from the ConfigurationManager. This all turns ugly once I move the code into its own project. I’ve created an app.config file, put the connection string in there as it was in the web.config but when I try to add another table in the IDE keeps forcing me to either hardcode the connection string or creates a Settings file and puts it in there, which then adds a new entry into the app.config file with a new name. Is there a way keep my Linq code in its own project yet still refer back to my config file without the IDE continuously hardcoding the connection string or creating the Settings file? I’m converting part of my DAL over to use Linq to SQL so I’d like to use the existing connection string that our old code is using as well as keep the value in a common location, and one spot, instead of in a number of spots. Manually changing the mode to WebSettings instead of AppSettings works untill I try to add a new table, then it goes back to hardcoding the value or recreating the Settings file. I also tried to switch the project type to be a web project and then rename my app.config to web.config and then everything works as I’d like it to. I’m just not sure if there are any downfalls to keeping this as a web project since it really isn't one. The project only contains the Linq to SQL code and an implementation of my repository classes. My project layout looks like this Website -connectionString.config -web.config (refers to connectionString.config) Middle Tier -Business Logic -Repository Interfaces -etc. DAL -Linq to SQL code -Existing SPROC code -connectionString.config (linked from the web poject) -app.config (refers to connectionString.config)

    Read the article

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • how to handle empty selection in a jface bound combobox?

    - by guido
    I am developing a search dialog in my eclipse-rcp application. In the search dialog I have a combobox as follows: comboImp = new CCombo(grpColSpet, SWT.BORDER | SWT.READ_ONLY); comboImp.setBounds(556, 46, 184, 27); comboImpViewer = new ComboViewer(comboImp); comboImpViewer.setContentProvider(new ArrayContentProvider()); comboImpViewer.setInput(ImpContentProvider.getInstance().getImps()); comboImpViewer.setLabelProvider(new LabelProvider() { @Override public String getText(Object element) { return ((Imp)element).getImpName(); } }); Imp is a database entity, ManyToOne to the main entity which is searched, and ImpContentProvider is the model class which speaks to embedded sqlite database via jpa/hibernate. This combobox is supposed to contain all instances of Imp, but to also let empty selection; it's value is bound to a service bean as follows: IObservableValue comboImpSelectionObserveWidget = ViewersObservables.observeSingleSelection(comboImpViewer); IObservableValue filterByImpObserveValue = BeansObservables.observeValue(searchPrep, "imp"); bindingContext.bindValue(comboImpSelectionObserveWidget, filterByImpObserveValue , null, null); As soon as the user clicks on the combo, a selection (first element) is made: I can see the call to a selectionlistener i added on the viewer. My question is: after a selection has been made, how do I let the user change his mind and have an empty selection in the combobox? should I add a "fake" empty instance of Imp to the List returned by the ImpContentProvider? or should I implement an alternative to ArrayContentProvider? and one additional related question is: why calling deselectAll() and clearSelection() on the combo does NOT set a null value to the bound bean?

    Read the article

  • im i doing this right or wrong using pointers in C

    - by Amandeep Singh Dhari
    i like to point out that i need some help with my home work, ok the lectuer gave us the idea of a program and we have to make it from bottom to top. got to have user to type in two set of string. pointers take in the value and then puts into a prototype i need to make a 3rd pointer that has the value of p1 and p2. like this p1 = asd, p2 = qwe and p3 = asdqwe #include "stdafx.h" #include <ctype.h> char *mystrcat(char*s1p, char*s2p); // Prototype char main(void) { char string1[80]; char string2[80]; printf("%s", "enter in your srting one "); gets_s(string1); printf("%s", "enter in your srting two "); gets_s(string2); *mystrcat(string1, string2); return 0; } char *mystrcat(char *s1p,char *s2p) { //char *string3; //char *string4; //string3 = s1p; //string4 = s2p; printf("whatever = %s%s\n", s1p, s2p); return 0; } this is the code that i made so far just need some help, thank guys in advance.

    Read the article

  • parsing of mathematical expressions

    - by gcc
    (in c90) (linux) input: sqrt(2 - sin(3*A/B)^2.5) + 0.5*(C*~(D) + 3.11 +B) a b /*there are values for a,b,c,d */ c d input: cos(2 - asin(3*A/B)^2.5) +cos(0.5*(C*~(D)) + 3.11 +B) a b /*there are values for a,b,c,d */ c d input: sqrt(2 - sin(3*A/B)^2.5)/(0.5*(C*~(D)) + sin(3.11) +ln(B)) /*max lenght of formula is 250 characters*/ a b /*there are values for a,b,c,d */ c /*each variable with set of floating numbers*/ d As you can see infix formula in the input depends on user. My program will take a formula and n-tuples value. Then it calculate the results for each value of a,b,c and d. If you wonder I am saying ;outcome of program is graph. /sometimes,I think i will take input and store in string. then another idea is arise " I should store formula in the struct" but i don't know how I can construct the code on the base of structure./ really, I don't know way how to store the formula in program code so that I can do my job. can you show me? /* a,b,c,d is letters cos,sin,sqrt,ln is function*/

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • odp.net SQL query retrieve set of rows from two input arrays.

    - by Karl Trumstedt
    I have a table with a primary key consisting of two columns. I want to retrieve a set of rows based on two input arrays, each corresponding to one primary key column. select pkt1.id, pkt1.id2, ... from PrimaryKeyTable pkt1, table(:1) t1, table(:2) t2 where pkt1.id = t1.column_value and pkt1.id2 = t2.column_value I then bind the values with two int[] in odp.net. This returns all different combinations of my resulting rows. So if I am expecting 13 rows I receive 169 rows (13*13). The problem is that each value in t1 and t2 should be linked. Value t1[4] should be used with t2[4] and not all the different values in t2. Using distinct solves my problem, but I'm wondering if my approach is wrong. Anyone have any pointers on how to solve this the best way? One way might be to use a for-loop accessing each index in t1 and t2 sequentially, but I wonder what will be more efficient. Edit: actually distinct won't solve my problem, it just did it based on my input-values (all values in t2 = 0)

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • parsing python to csv

    - by user185955
    I'm trying to download some game stats to do some analysis, only problem is each season the data their isn't 100% consistent. I grab the json file from the site, then wish to save it to a csv with the first line in the csv containing the heading for that column, so the heading would be essentially the key from the python data type. #!/usr/bin/env python import requests import json import csv base_url = 'http://www.afl.com.au/api/cfs/afl/' token_url = base_url + 'WMCTok' player_url = base_url + 'matchItems/round' def printPretty(data): print(json.dumps(data, sort_keys=True, indent=2, separators=(',', ': '))) session = requests.Session() # session makes it simple to use the token across the requests token = session.post(token_url).json()['token'] # get the token session.headers.update({'X-media-mis-token': token}) # set the token Season = 2014 Roundno = 4 if Roundno<10: strRoundno = '0'+str(Roundno) else: strRoundno = str(Roundno) # get some data (could easily be a for loop, might want to put in a delay using Sleep so that you don't get IP blocked) data = session.get(player_url + '/CD_R'+str(Season)+'014'+strRoundno) # print everything printPretty(data.json()) with open('stats_game_test.csv', 'w', newline='') as csvfile: spamwriter = csv.writer(csvfile, delimiter="'",quotechar='|', quoting=csv.QUOTE_ALL) for profile in data.json()['items']: spamwriter.writerow(['%s' %(profile)]) #for key in data.json().keys(): # print("key: %s , value: %s" % (key, data.json()[key])) The above code grabs the json and writes it to a csv, but it puts the key in each individual cell next to the value (eg 'venueId': 'CD_V190'), the key needs to be just across the first row as a heading. It gives me a csv file with data in the cells like this Column A B 'tempInCelsius': 17.0 'totalScore': 32 'tempInCelsius': 16.0 'totalScore': 28 What I want is the data like this tempInCelsius totalScore 17 32 16 28 As I mentioned up the top, the data isn't always consistent so if I define what fields to grab with spamwriter.writerow([profile['tempInCelsius'], profile['totalScore']]) then it will error out on certain data grabs. This is why I'm now trying the above method so it just grabs everything regardless of what data is there.

    Read the article

  • How do I get 2-way data binding to work for nested asp.net Repeater controls

    - by jimblanchard
    I have the following (trimmed) markup: <asp:Repeater ID="CostCategoryRepeater" runat="server"> <ItemTemplate> <div class="costCategory"> <asp:Repeater ID="CostRepeater" runat="server" DataSource='<%# Eval("Costs")%>'> <ItemTemplate> <tr class="oddCostRows"> <td class="costItemTextRight"><span><%# Eval("Variance", "{0:c0}")%></span></td> <td class="costItemTextRight"><input id="SupplementAmount" class="costEntryRight" type="text" value='<%# Bind("SupplementAmount")%>' runat="server" /></td> </tr> </ItemTemplate> </asp:Repeater> </div> </ItemTemplate> </asp:Repeater> The outer repeater's DataSource is set in the code-beside. I've snipped them, but there are Eval statements that wire up to the properties in the outer Repeater. Anyway, one of the fields in the inner Repeater needs to be a Bind instead of an Eval, as I want to get the values that the user types in. The SupplementAmount input element correctly receives it's value when the page loads, but on the other side, when I inspect the contents of the Costs List when the form posts back, the changes the user made aren't present. Thanks.

    Read the article

  • Drupal Ubercart: error in passing values back to the Content Type after checkout

    - by user512826
    I am trying to set up event registration in a drupal site using Ubercart + the UC Node Checkout Module. I have followed the instructions provided in http://drupaleasy.com/blogs/ultimike/2009/03/event-registration-ubercart. However I seem to be unable to pass the Order ID and Payment Status back to the node. I have created a conditional action that on node checkout executes the following PHP code: I am using the following code to update the node on checkout - but nothing happens: if (isset($order)) { foreach ($order->products as $product) { if (isset($product->data['node_checkout_nid'])) { $node = node_load($product->data['node_checkout_nid']); $node->field_status['0']['value'] = 1; $node->field_orderid['0']['value'] = $order->order_id; node_save($node); } } } I know the conditional action is working because it prints dsm('hello world') messages on node checkout - however when I include a dsm($node) or dsm($product) in the PHP code, they return blank. Also when I go back to my product and click the 'Devel' tab, the 'data' string contains the following characters: a:1:{s:13:"form_build_id";s:37:"form-3ccc03345f4832c69666a89c560de940";} In this link http://www.ubercart.org/forum/support/10951/node_checkout_issue I found someone else with the same issue, but I have been unable to replicate his solution. Can anybody please help? Thanks so much!

    Read the article

  • Generic Constraints And Type Parameters Mess

    - by Dummy01
    Hi everyone, I have the following base abstract class defined as: public abstract class BaseObject<T> : IComparable, IComparable<T>, IEquatable<T> {} I also have an interface defined as: public interface ICode<T> where T : struct { T Code { get; } } Now I want to derive a class that is inherited from BaseObject<T> and includes interface ICode<T>. I tried to define it like that: public class DerivedObject<T, U> : BaseObject<T>, ICode<U> where T : DerivedObject<T, U> where U : struct { public DerivedObject(U code) { Code = code; } // From BaseObject protected override int InstanceCompareTo(T obj) { return Code.CompareTo(obj.Code); } // From BaseObject protected override bool InstanceEquals(T obj) { return Code.Equals(obj.Code); } // From ICode U _Code; public U Code { get { return _Code; } protected set { _Code = value; } } } The only error that comes from the compiler is for Code.CompareTo(obj.Code) with the message: 'U' does not contain a definition for 'CompareTo' and no extension method 'CompareTo' accepting a first argument of type 'U' could be found. But U is a value type and should know CompareTo. Have you any idea what I am doing wrong, or if I do all wrong? My final aim is to derive classes such these: public class Account : DerivedObject<Account, int> public class ItemGroup : DerivedObject<ItemGroup, string> Big Thanks In Advance!

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • Recoverable error while running XSL

    - by Kate
    XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>&#10;</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '&#xFF00;')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

    Read the article

  • Call Oracle package function using Odbc from C#

    - by Paolo Tedesco
    I have a function defined inside an Oracle package: CREATE OR REPLACE PACKAGE BODY TESTUSER.TESTPKG as FUNCTION testfunc(n IN NUMBER) RETURN NUMBER as begin return n + 1; end testfunc; end testpkg; / How can I call it from C# using Odbc? I tried the following: using System; using System.Data; using System.Data.Odbc; class Program { static void Main(string[] args) { using (OdbcConnection connection = new OdbcConnection("DSN=testdb;UID=testuser;PWD=testpwd")) { connection.Open(); OdbcCommand command = new OdbcCommand("TESTUSER.TESTPKG.testfunc", connection); command.CommandType = System.Data.CommandType.StoredProcedure; command.Parameters.Add("ret", OdbcType.Int).Direction = ParameterDirection.ReturnValue; command.Parameters.Add("n", OdbcType.Int).Direction = ParameterDirection.Input; command.Parameters["n"].Value = 42; command.ExecuteNonQuery(); Console.WriteLine(command.Parameters["ret"].Value); } } } But I get an exception saying "Invalid SQL Statement". What am I doing wrong?

    Read the article

  • no instance of overloaded function getline c++

    - by Dave
    I'm a bit confused as to what i have incorrect with my script that is causing this error. I have a function which calls a fill for game settings but it doesn't like my getline. Also i should mention these are the files i have included for it: #include <fstream> #include <cctype> #include <map> #include <iostream> #include <string> #include <algorithm> #include <vector> using namespace std;' This is what i have: std::map<string, string> loadSettings(std::string file){ ifstream file(file); string line; std::map<string, string> config; while(std::getline(file, line)) { int pos = line.find('='); if(pos != string::npos) { string key = line.substr(0, pos); string value = line.substr(pos + 1); config[trim(key)] = trim(value); } } return (config); } The function is called like this from my main.cpp //load settings for game std::map<string, string> config = loadSettings("settings.txt"); //load theme for game std::map<string, string> theme = loadSettings("theme.txt"); Where did i go wrong ? Please help! The error: settings.h(61): error C2784: 'std::basic_istream<_Elem,_Traits> &std::getline(std::basic_istream<_Elem,_Traits> &&,std::basic_string<_Elem,_Traits,_Alloc> &)' : could not deduce template argument for 'std::basic_istream<_Elem,_Traits> &&' from 'std::string'

    Read the article

  • Greasemonkey failing to GM_setValue()

    - by HonoredMule
    I have a Greasemonkey script that uses a Javascript object to maintain some stored objects. It covers quite a large volume of information, but substantially less than it successfully stored and retrieved prior to encountering my problem. One value refuses to save, and I can not for the life of me determine why. The following problem code: Works for other larger objects being maintained. Is presently handling a smaller total amount of data than previously worked. Is not colliding with any function or other object definitions. Can (optionally) successfully save the problem storage key as "{}" during code startup. this.save = function(table) { var tables = this.tables; if(table) tables = [table]; for(i in tables) { logger.log(this[tables[i]]); logger.log(JSON.stringify(this[tables[i]])); GM_setValue(tables[i] + "_" + this.user, JSON.stringify(this[tables[i]])); logger.log(tables[i] + "_" + this.user + " updated"); logger.log(GM_getValue(tables[i] + "_" + this.user)); } } The problem is consistently reproducible and the logging statments produce the following output in Firebug: Object { 54,10 = Object } // Expansion shows complete contents as expected, but there is one oddity--Firebug highlights the array keys in purple instead of the usual black for anonymous objects. {"54,10":{"x":54,"y":10,"name":"Lucky Pheasant"}} // The correctly parsed string. bookmarks_HonoredMule saved undefined I have tried altering the format of the object keys, to no effect. Further narrowing down the issue is that this particular value is successfully saved as an empty object ("{}") during code initialization, but skipping that also does not help. Reloading the page confirms that saving of the nonempty object truly failed. Any idea what could cause this behavior? I've thoroughly explored the possibility of hitting size constraints, but it doesn't appear that can be the problem--as previously mentioned, I've already reduced storage usage. Other larger objects save still, and the total number of objects, which was not high already, has further been reduced by an amount greater than the quantity of data I'm attempting to store here.

    Read the article

  • Help Optimizing MySQL Table (~ 500,000 records) and PHP Code.

    - by Pyrite
    I have a MySQL table that collects player data from various game servers (Urban Terror). The bot that collects the data runs 24/7, and currently the table is up to about 475,000+ records. Because of this, querying this table from PHP has become quite slow. I wonder what I can do on the database side of things to make it as optomized as possible, then I can focus on the application to query the database. The table is as follows: CREATE TABLE IF NOT EXISTS `people` ( `id` bigint(20) unsigned NOT NULL AUTO_INCREMENT, `name` varchar(40) NOT NULL, `ip` int(4) unsigned NOT NULL, `guid` varchar(32) NOT NULL, `server` int(4) unsigned NOT NULL, `date` int(11) NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `Person` (`name`,`ip`,`guid`), KEY `server` (`server`), KEY `date` (`date`), KEY `PlayerName` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 COMMENT='People that Play on Servers' AUTO_INCREMENT=475843 ; I'm storying the IPv4 (ip and server) as 4 byte integers, and using the MySQL functions NTOA(), etc to encode and decode, I heard that this way is faster, rather than varchar(15). The guid is a md5sum, 32 char hex. Date is stored as unix timestamp. I have a unique key on name, ip and guid, as to avoid duplicates of the same player. Do I have my keys setup right? Is the way I'm storing data efficient? Here is the code to query this table. You search for a name, ip, or guid, and it grabs the results of the query and cross references other records that match the name, ip, or guid from the results of the first query, and does it for each field. This is kind of hard to explain. But basically, if I search for one player by name, I'll see every other name he has used, every IP he has used and every GUID he has used. <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> Search: <input type="text" name="query" id="query" /><input type="submit" name="btnSubmit" value="Submit" /> </form> <?php if (!empty($_POST['query'])) { ?> <table cellspacing="1" id="1up_people" class="tablesorter" width="300"> <thead> <tr> <th>ID</th> <th>Player Name</th> <th>Player IP</th> <th>Player GUID</th> <th>Server</th> <th>Date</th> </tr> </thead> <tbody> <?php function super_unique($array) { $result = array_map("unserialize", array_unique(array_map("serialize", $array))); foreach ($result as $key => $value) { if ( is_array($value) ) { $result[$key] = super_unique($value); } } return $result; } if (!empty($_POST['query'])) { $query = trim($_POST['query']); $count = 0; $people = array(); $link = mysql_connect('localhost', 'mysqluser', 'yea right!'); if (!$link) { die('Could not connect: ' . mysql_error()); } mysql_select_db("1up"); $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name LIKE \"%$query%\" OR INET_NTOA(ip) LIKE \"%$query%\" OR guid LIKE \"%$query%\")"; $result = mysql_query($sql, $link); if (!$result) { die(mysql_error()); } // Now take the initial results and parse each column into its own array while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } // now for each name, ip, guid in results, find additonal records $people2 = array(); foreach ($people AS $person) { $ip = $person['ip']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (ip = \"$ip\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people2[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people3 = array(); foreach ($people AS $person) { $guid = $person['guid']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (guid = \"$guid\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people3[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people4 = array(); foreach ($people AS $person) { $name = $person['name']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name = \"$name\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people4[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } // Combine people and people2 into just people $people = array_merge($people, $people2); $people = array_merge($people, $people3); $people = array_merge($people, $people4); $people = super_unique($people); foreach ($people AS $person) { $date = ($person['date']) ? date("M d, Y", $person['date']) : 'Before 8/1/10'; echo "<tr>\n"; echo "<td>".$person['id']."</td>"; echo "<td>".$person['name']."</td>"; echo "<td>".$person['ip']."</td>"; echo "<td>".$person['guid']."</td>"; echo "<td>".$person['server']."</td>"; echo "<td>".$date."</td>"; echo "</tr>\n"; $count++; } // Find Total Records //$result = mysql_query("SELECT id FROM 1up_people", $link); //$total = mysql_num_rows($result); mysql_close($link); } ?> </tbody> </table> <p> <?php echo $count." Records Found for \"".$_POST['query']."\" out of $total"; ?> </p> <?php } $time_stop = microtime(true); print("Done (ran for ".round($time_stop-$time_start)." seconds)."); ?> Any help at all is appreciated! Thank you.

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • create a class attribute without going through __setattr__

    - by eric.frederich
    Hello, What I have below is a class I made to easily store a bunch of data as attributes. They wind up getting stored in a dictionary. I override __getattr__ and __setattr__ to store and retrieve the values back in different types of units. When I started overriding __setattr__ I was having trouble creating that initial dicionary in the 2nd line of __init__ like so... super(MyDataFile, self).__setattr__('_data', {}) My question... Is there an easier way to create a class level attribute with going through __setattr__? Also, should I be concerned about keeping a separate dictionary or should I just store everything in self.__dict__? #!/usr/bin/env python from unitconverter import convert import re special_attribute_re = re.compile(r'(.+)__(.+)') class MyDataFile(object): def __init__(self, *args, **kwargs): super(MyDataFile, self).__init__(*args, **kwargs) super(MyDataFile, self).__setattr__('_data', {}) # # For attribute type access # def __setattr__(self, name, value): self._data[name] = value def __getattr__(self, name): if name in self._data: return self._data[name] match = special_attribute_re.match(name) if match: varname, units = match.groups() if varname in self._data: return self.getvaras(varname, units) raise AttributeError # # other methods # def getvaras(self, name, units): from_val, from_units = self._data[name] if from_units == units: return from_val return convert(from_val, from_units, units), units def __str__(self): return str(self._data) d = MyDataFile() print d # set like a dictionary or an attribute d.XYZ = 12.34, 'in' d.ABC = 76.54, 'ft' # get it back like a dictionary or an attribute print d.XYZ print d.ABC # get conversions using getvaras or using a specially formed attribute print d.getvaras('ABC', 'cm') print d.XYZ__mm

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How does asp.net MVC remember my false values on postback?

    - by Michel
    Hi, This is working, but how??? I have a controller action for a post: [AcceptVerbs(HttpVerbs.Post )] public ActionResult Edit(Person person) { bool isvalid = ModelState.IsValid; etc. The Person object has a property BirthDate, type DateTime. When i enter some invalid data in the form, say 'blabla' which is obvious not a valid Datetime, it fills all the (other) Person properties with the correct data and the BirthDate property with a new blank DateTime. The bool isvalid has the value 'false'. So far so good. Then i do this: return View(p); and in the view i have this: <%= Html.TextBox("BirthDate", String.Format("{0:g}", Model.BirthDate)) %> <%= Html.ValidationMessage("BirthDate", "*") %> Ant there it comes: i EXPECTED the model to contain the new, blank DateTime because i didn't put any new data in. Second, when the View displays something, it must be a DateTime, because Model.BirthDate can't hold anything but a DateTime. But to my surprise, it shows a textbox with the 'blabla' value! (and the red * behind it) Which ofcourse is nice because the user can seee what he typed wrong, but how can that (blabla)string be transferred to the View in a DateTime field?

    Read the article

  • Changing brightness in bufferedImage with DataBufferInt

    - by user2958025
    I must read some image and then I have to change brightness and contrast of this image I create main class and constructor where are panels, sliders and other stuff, I added changeListener to slider to take current value. My imagePanel is new Object of that class: public class Obrazek extends JPanel{ public static BufferedImage img = null; public Obrazek() { super(); try { img = ImageIO.read(new File("D:\\ja.jpg")); } catch (IOException e) {} } @Override public void paint(Graphics g) { g.drawImage(img, 0, 0, null); } } This is my load button private void przyciskWczytaj(java.awt.event.ActionEvent evt) { int odpowiedz = jFileChooser1.showOpenDialog(this); if (odpowiedz == jFileChooser1.APPROVE_OPTION) { File file = jFileChooser1.getSelectedFile(); try { BufferedImage im = ImageIO.read(new File(file.getAbsolutePath())); Obrazek.img = im; } catch (IOException ex) { System.out.println("Error"); } } } And now I want to create class where I will change that brightness. I have to use but I don't know how to use that thing: BufferedImage(256, 256, Bufferedmage.TYPE_INT_RGB) and to get each pixel of image I need to do something like: int rgb []=((DataBufferInt)img.getRaster().getDataBuffer()).getData(); And here I is next problem: How can I change the value of each r,g,b and show that new image on my panel

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

< Previous Page | 701 702 703 704 705 706 707 708 709 710 711 712  | Next Page >