Search Results

Search found 35561 results on 1423 pages for 'value'.

Page 708/1423 | < Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >

  • Create lambda action from function expression

    - by Martin Robins
    It is relatively easy to create a lambda function that will return the value of a property from an object, even including deep properties... Func<Category, string> getCategoryName = new Func<Category, string>(c => c.Name); and this can be called as follows... string categoryName = getCategoryName(this.category); But, given only the resulting function above (or the expression originally used to create the function), can anybody provide an easy way to create the opposing action... Action<Category, string> setCategoryName = new Action<Category, string>((c, s) => c.Name = s); ...that will enable the same property value to be set as follows? setCategoryName(this.category, ""); Note that I am looking for a way to create the action programatically from the function or expression - I hope that I have shown that I already know how to create it manually. I am open to answers that work in both .net 3.5 and 4.0. Thanks.

    Read the article

  • Why can't you return a List from a Compiled Query?

    - by Andrew
    I was speeding up my app by using compiled queries for queries which were getting hit over and over. I tried to implement it like this: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id) End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, List(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ (From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u).ToList()) This did not work and I got this error message: Type : System.ArgumentNullException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089 Message : Value cannot be null. Parameter name: value However, when I changed my compiled query to return IQueryable instead of List like so: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id).ToList() End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, IQueryable(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u) It worked fine. Can anyone shed any light as to why this is? BTW, compiled queries rock! They sped up my app by a factor of 2.

    Read the article

  • How to Prevent PostBack Event Handler from Firing

    - by user331744
    I have a custom class (ServerSideValidator.vb) that validates user input on server side (it doesn't use any of the .NET built in validators, therefore Page.Validate() is not an option for me). I am calling the Validate() method on page.IsPostback event and the class performs without any problem My issue is, when validation fails (returns false), I want to stop the postback event handler from firing, but load the page along with all the controls and user-input values in them. If I do, Response.End(), the page comes up blank. I can programmatically instruct the page to go to the previous page (original form before postback), but it loses all user-inputs. I thought of creating a global boolean variable in the page code behind file and check the value before performing any postback method, but this approach takes away from my plan to provide all functionalities inside the class itself. The page object is being referenced to ServerSideValidator. Seems like all the postback related properties/variables I come across inside Page class are 'Readonly' and I can't assign value(s) to control/prevent postback event from firing. Any idiea on how I can accomplish this? Please let me know if you need further details

    Read the article

  • how to validate the dropdownlist box values on submit

    - by kumar
    Hello friends, I have validate_excpt on Form Before Submit I am doing this.. on the View I have two dropdown listboxes I am using On Submit I need to check.. If I selet ResolutionCode I need to validat ReasonCode Dropdownlist that It should select if not Pelase select ReasonCode I should Dispaly? Do I need to do this on Submit ButtonClick? or Can I do it on Validate_excpt? Can anybody help me out? <label for="ResolutionCode"> Resolution: <span> <%=Html.DropDownListFor(model => model.ResolutionCode, new SelectList(Model.LookupCodes["C_EXCPT_RESL"], "Key", "Value"))%> </span> </label> <label for="ReasonCode"> Reason: <span><%=Html.DropDownListFor(model => model.ReasonCode, new SelectList(Model.LookupCodes["C_EXCPT_RSN"], "Key", "Value"))%></span> </label> function validate_excpt(formData, jqForm, options) { var form = jqForm[0]; return true; } // post-submit callback function showResponse(responseText, statusText, xhr, $form) { if (responseText[0].substring(0, 16) != "System.Exception") { $('#error-msg-ID span:last').html('<strong>Update successful.</strong>'); } else { $('#error-msg-ID span:last').html('<strong>Update failed.</strong> ' + responseText[0].substring(0, 48)); } $('#error-msg-ID').removeClass('hide'); } $('#exc-').ajaxForm({ target: '#error-msg-ID', beforeSubmit: validate_excpt, success: showResponse, dataType: 'json' });

    Read the article

  • How do I save the edits for a checkbox that implements an email notification?

    - by Ralph The Mouf
    On my site, a user gets email notifications when someone comments on their profile, or comments on their blog etc...I have made a email settings page that has checkboxes to allow the user to decide to receive emails or not. This is what I am wrapping around the email notification code chunck for the pages that have the php mail: <?php if(isset($_POST['email_toggle']) && $_POST['email_toggle'] == 'true') { if(isset($_POST['commentProfileSubmit']) && $auth) { $query etc $to = etc } } My question is what do I put on the email settings script that has the actual check boxes to make them stay checked or unchecked once you submit your settings? Another words what do I put in the if(isset portion to implement the changes? if(isset($_POST['email_toggle']) && $_POST['email_toggle'] == 'true') { /* what do I put here? */ header("Location: Profile.php?id=" . $auth->id); mysql_query($query,$connection); /* input/check boxes and submit button */ <tr> <td class="email_check"> <input type="checkbox" name="email_toggle" value="true" checked="checked" /> Receive email Notifications When Someone Answers A Question You've Answered </td> </tr> <tr> <td> <input style="margin:10px 0px 0px 10px;" class="submit" type="submit" name="email_toggle" value="Save Settings" /> </td> </tr> }

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • Problem with multiple checkbox

    - by Pushpendra
    I am using a checkbox that has the name selectedids[], and I am trying to select all checkbox with the JavaScript but the code is not working. However, when I change the name of checkbox to selectedids it works but I can't do so because I need all the ids that are selected on the POSTED page. The checkbox is as follow. foreach($rows as $row) { <input type="checkbox" name="selectedids[]" value="<?php echo $row['id']; ?>" class="checkbox" /> ........ ........ } And the Java-script function is as follow function SetAllCheckBoxes(CheckValue) { var CheckValue=true; if(!document.forms['main']) return; var objCheckBoxes = document.forms['main'].elements['selectedids[]']; if(!objCheckBoxes) return; var countCheckBoxes = objCheckBoxes.length; if(!countCheckBoxes) objCheckBoxes.checked = CheckValue; else // set the check value for all check boxes for(var i = 0; i < countCheckBoxes; i++) objCheckBoxes[i].checked = CheckValue; } Please help me. Thanks in advance..

    Read the article

  • Slow Response in checkbox using JQuery

    - by Dean
    Hi to all. I'm trying to optimize a website. The flow is i tried to query a certain table and all of its data entry in a page(w/ toolbars), work fine. When i tried to edit the page the problem is when i click the checkbox button i have to wait 2-5sec just by clicking it. I limit the viewing of entry to 5 only but the response on checkbox doesn't change. The tables have 100 entries in them. function checkAccess(celDiv,id) { var celValue = $(celDiv).html(); if (celValue==1) $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' checked disabled>") else $(celDiv).html("<input type='checkbox' value='"+$(celDiv).html()+"' disabled>") $(celDiv).click ( function() { $('input',this).each( function(){ tr_idx = $('#detFlex1 tbody tr').index($(this).parent().parent().parent()); td_idx = $('#detFlex1 tbody tr:eq('+tr_idx+') td').index($(this).parent().parent()); td_last = 13; for(var td=td_idx+1; td<=td_last;td++) { if ($(this).attr('checked') == true) { df[0].rows[tr_idx].cell[td_idx] = 1;//index[1] = Full Access if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 1; } df[0].rows[tr_idx].cell[2] = 1; if (td_idx > 3) { df[0].rows[tr_idx].cell[2] = 1; } } else { df[0].rows[tr_idx].cell[td_idx] = 0;//index[0] = With Access if (td_idx==2) { df[0].rows[tr_idx].cell[td] = 0; } else if (td_idx==3) { df[0].rows[tr_idx].cell[td] = 0; } if (td_idx > 3) { df[0].rows[tr_idx].cell[3] = 0; } } } $('#detFlex1').flexAddData(df[0]); $('.toolbar a[title=Edit Item]').trigger('click'); }); } ); } I've thought that the problem is this above code. Could anyone help me simplify this code.?

    Read the article

  • Spring Controller's URL request mapping not working as expected

    - by Atharva
    I have created a mapping in web.xml something like this: <servlet> <servlet-name>dispatcher</servlet-name> <servlet-class>org.springframework.web.servlet.DispatcherServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>dispatcher</servlet-name> <url-pattern>/about/*</url-pattern> </servlet-mapping> In my controller I have something like this: import org.springframework.stereotype.Controller; @Controller public class MyController{ @RequestMapping(value="/about/us", method=RequestMethod.GET) public ModelAndView myMethod1(ModelMap model){ //some code return new ModelAndView("aboutus1.jsp",model); } @RequestMapping(value="/about", method=RequestMethod.GET) public ModelAndView myMethod2(ModelMap model){ //some code return new ModelAndView("aboutus2.jsp",model); } } And my dispatcher-servlet.xml has view resolver like: <mvc:annotation-driven/> <bean id="viewResolver" class="org.springframework.web.servlet.view.InternalResourceViewResolver" p:viewClass="org.springframework.web.servlet.view.JstlView" p:prefix="/WEB-INF/jsp/" p:suffix=".jsp"/> To my surprise: request .../about/us is not reaching to myMethod1 in the controller. The browser shows 404 error. I put a logger inside the method but it isn't printing anything, meaning, its not being executed. .../about works fine! What can be the done to make .../about/us request work? Any suggestions?

    Read the article

  • HTML input not working correctly with AJAX update panels used else where on page

    - by Sean P
    I have some update panels on my page that do some asyncpostbacks to keep some dropdownlists correctly populated. My problem is that on my page i have an HTML input that is handling some file uploads. With the AJAX on the page with asyncpostbacks, and while i step through my code behind, the files arent being uploaded. Using a postbacktrigger (non-async) is not possible because of my layout. Here is my code: <div id="divFileInputs" runat="server"> <input id="file1" name="fileInput" type="file" runat="server" size="50" style="width: 50em" onfocus="AddFileInput()" class="textbox" /></div> <select id="selectFileList" name="ListBox1" size="5" style="width: 50em; text-align: left;" class="textbox" /> <input id="RemoveAttachmentButton" type="button" value="Remove" onclick="RemoveFileInput()" class="removebutton " /> </div> Here is my code behind: Protected Sub CopyAttachments(ByVal issueId As String) Dim files As HttpFileCollection = Request.Files Dim myStream As System.IO.Stream Dim service As New SubmitService.Service For i As Integer = 0 To files.Count - 1 Dim postedFile As HttpPostedFile = files(i) Dim fileNameWithoutPath As String = System.IO.Path.GetFileName(postedFile.FileName) If fileNameWithoutPath.Length > 0 And issueId.Length > 0 Then Dim fileLength As Integer = postedFile.ContentLength Dim fileContents(fileLength) As Byte ' Read the file into the byte array. Send it to the web service. myStream = postedFile.InputStream myStream.Read(fileContents, 0, fileLength) service.ClearQuestAttachToIssue(issueId, fileNameWithoutPath, fileContents) End If Next service = Nothing End Sub When I put a breakpoint in at the declaration of service and then check the value of "files", the count is 0. I am expecting it to be 2 when i have one file uploaded. Anyone know how to fix this?

    Read the article

  • How can a <label> completely fill its parent <td>?

    - by Shawn
    Here is the relevant code (doesn't work): <html> <head> <title>testing td checkboxes</title> <style type="text/css"> td { border: 1px solid #000; } label { border: 1px solid #f00; width: 100%; height: 100% } </style> </head> <body> <table> <tr><td>Some column title</td><td>Another column title</td></tr> <tr><td>Value 1<br>(a bit more info)</td><td><label><input type="checkbox" /> &nbsp;</label></td></tr> <tr><td>Value 2</td><td><input type="checkbox" /></td></tr> </table> </body> </html> The reason is that I want a click anywhere in the table cell to check/uncheck the checkbox.

    Read the article

  • Avoiding duplication in setting properties on the task in Rake tasks

    - by Stray
    I have a bunch of rake building tasks. They each have unique input / output properties, but the majority of the properties I set on the tasks are the same each time. Currently I'm doing that via simple repetition like this: task :buildThisModule => "bin/modules/thisModule.swf" mxmlc "bin/modules/thisModule.swf" do |t| t.input = "src/project/modules/ThisModule.as" t.prop1 = value1 t.prop2 = value2 ... (And many more property=value sets that are the same in each task) end task :buildThatModule => "bin/modules/thatModule.swf" mxmlc "bin/modules/thatModule.swf" do |t| t.input = "src/project/modules/ThatModule.as" t.prop1 = value1 t.prop2 = value2 ... (And many more property=value sets that are the same in each task) end In my usual programming headspace I'd expect to be able to break out the population of the recurring task properties to a re-usable function. Is there a rake analogy for this? Some way I can have a single function where the shared properties are set on any task? Something equivalent to: task :buildThisModule => "bin/modules/thisModule.swf" mxmlc "bin/modules/thisModule.swf" do |t| addCommonTaskParameters(t) t.input = "src/project/modules/ThisModule.as" end task :buildThatModule => "bin/modules/thatModule.swf" mxmlc "bin/modules/thatModule.swf" do |t| addCommonTaskParameters(t) t.input = "src/project/modules/ThatModule.as" end Thanks.

    Read the article

  • jQuery select by two name roots and perform one of two function depending on which root was selected

    - by RetroCoder
    I'm trying to get this code to work in jQuery and I'm trying to make sure that for each iteration of each root element, its alternate root element for that same iteration doesn't contain anything. Otherwise it sets the .val("") property to an empty string. Looking for a simple solution if possible using search, find, or swap. Each matching number is on the same row level and the same iteration count. I have two input types of input text elements with two different root names like so: 1st Root is "rootA" <input type="text" name="rootA1" /> <input type="text" name="rootA2 /> <input type="text" name="rootA3" /> 2nd Root is "rootB" <input type="text" name="rootB1" /> <input type="text" name="rootB2 /> <input type="text" name="rootB3" /> On blur if any of rootA is called call function fnRootA();. On blur if any of rootB is called call function fnRootB();. Again, I'm trying to make sure that for each iteration like 1 that the alternate root doesn't contain anything, else it sets the .val("") property to an empty string of the root being blurred. My current code works for a single element but wanted to use find or search but not sure how to construct it.. $("input[name='rootA1']").blur(function(e) { fnRootA(1); // this code just removes rootA1's value val("") //if rootB1 has something in it value property // the (1) in parenthesis is the iteration number });

    Read the article

  • shreding xml column

    - by csetzkorn
    Hi, I have a XML column which contains XML like this: <Set> <Element> <ID> 1 </ID> <List> <ListElement> <Part1> ListElement 1 </Part1> </ListElement> <ListElement> <Part1> ListElement2 </Part1> </ListElement> </List> </Element> <Element> <ID> 2 </ID> <List> <ListElement> <Part1> ListElement3 </Part1> </ListElement> <ListElement> <Part1> ListElement4 </Part1> </ListElement> </List> </Element> </Set> I would like to shred this into a relation table containing this: ID, ListElement 1, ListElement1 1, ListElement2 2, ListElement3 2, ListElement4 I am able to obtain the content of the Parts using something like this: select List.value('(Part1/text())[1]', 'varchar(max)') as test from Table CROSS APPLY xml.nodes('// Element/List/ListElement') AS List(List) but I have not yet achieved to keep the ‘foreign key’ (the ID value). Thanks. Best wishes, Christian

    Read the article

  • Userdefined margins in WPF printing

    - by MTR
    Most printing samples for WPF go like this: PrintDialog dialog = new PrintDialog(); if (dialog.ShowDialog() == true) { StackPanel myPanel = new StackPanel(); myPanel.Margin = new Thickness(15); Image myImage = new Image(); myImage.Width = dialog.PrintableAreaWidth; myImage.Stretch = Stretch.Uniform; myImage.Source = new BitmapImage(new Uri("pack://application:,,,/Images/picture.bmp")); myPanel.Children.Add(myImage); myPanel.Measure(new Size(dialog.PrintableAreaWidth, dialog.PrintableAreaHeight)); myPanel.Arrange(new Rect(new Point(0, 0), myPanel.DesiredSize)); dialog.PrintVisual(myPanel, "A Great Image."); } What I don't like about this is, that they always set the margin to a fixed value. But in PrintDialog the user has the option to choose a individual margin that no sample cares about. If the user now selects a margin that is larger as the fixed margin set by program, the printout is truncated. Is there a way to get the user selected margin value from PrintDialog? TIA Michael

    Read the article

  • On checkbox checked show radio button

    - by aDameToKillFor
    Hello, I would like to ask for a little help here, since I haven't got any big knowledge in Javascript, nor in jQuery. I need to show 5 radio buttons when a checkbox is checked, the checkboxes represent languages that the user speaks, so for each of the selected, there should appear 5 separate radio buttons for how good they speak it(1 to 5). I tried to do it with jQuery, but I did not manage to get very far away... This is where my checkboxes are created(dynamically): <% for(int i = 0; i < Model.Languages.Count; i++) { %> <input id="applang" name="applang" type="checkbox" value="<%: Model.Languages[i].languageID%>" /> <%: Model.Languages[i].name.ToString() %><br /> <%} %> So, I tried to add this script, but it's not working: <script type="text/javascript"> $("input[@name='applang']").click(function () { $("input[type='radio']").show(); }); I also tried this way - to use this javascript: <script type="text/javascript"> function toggle_visibility(id) { var e = document.getElementById(id); if (e.style.display == 'block') e.style.display = 'none'; else e.style.display = 'block'; } And it works, but it works on already present controls, and I guess I need to create mine dynamically, or maybe not? And I tried to hide a present control with CSS, but then when the script shows it, it is there, only invisible :) Also, I would want to get the name and value of the radio buttons from my database, i.e. Model(this is ASP.NET MVC).. Can someone help me a little bit, please?

    Read the article

  • How to test whether a char is NOT in a string? (java, junit)

    - by JB
    As title says, im having trouble with my junit tests passing for checking if a character is not in a string and how to check if an empty string doesnt have a character. here is the method i have: public static boolean isThere(String s, char value){ for(int x = 0; x <= s.length(); x++){ if(s.charAt(x) == value){ return true; } else if(s.length() == 0){ return false; } } return false; And here is the junit test: public void testIsThere() { { String sVal = "Jeff George"; boolean hasA = StringMethods.isThere(sVal,'e'); assertTrue(hasA); boolean hasE = StringMethods.isThere(sVal, 'o'); assertTrue(hasE); boolean notIn = StringMethods.isThere(sVal,'b'); assertTrue(notIn); } { String sVal = ""; boolean nothingIn = StringMethods.isThere(sVal,'a'); assertFalse(nothingIn); boolean notIn = StringMethods.isThere(sVal,'b'); assertFalse(notIn); } } Thank you very much, appreciated

    Read the article

  • Data confusion - Selecting data in one DataGridView based on selection in another

    - by Logan Young
    This probably isn't the best way to do what I want, but I can't think of anything else to try... NB: I'm using Visual Basic.NET My form has 2 DataGridView controls. One of these is bound to a DataSet, the other isn't visible - at least not until the user selects a uniqueidentifier cell in the 1st grid. When the user makes this selection, the 2nd grid will become visible and display the row from another with the same id as the one selected in the 1st grid. So, basically, I want to dynamically display data in one grid based on user selection in another grid. My code looks like this so far... Private Sub RulesGrid_CellClick(ByVal sender As System.Object, ByVal e As System.Windows.Forms.DataGridViewCellEventArgs) Handles RulesGrid.CellClick Try FlagsGrid.Visible = True ''// MsgBox(RulesGrid.CurrentCell.Value.ToString()) Dim sql As String = "SELECT * FROM ctblMKA_Status_Flags " + _ "WHERE intStatusID = '" & RulesGrid.CurrentCell.Value & "'" DSFlags = GetDS(sql) DSFlags.DataSetName = "FlagsDataSet" FlagsGrid.DataSource = DSFlags ProgressBar.Visible = False Catch ex As Exception MsgBox(ex.ToString) End Try End Sub I feel like I'm missing something here... Any ideas anyone?

    Read the article

  • Hashing Function for Map C++

    - by Josh
    I am trying to determine a hash function which takes an input (i, k) and determines a unique solution. The possible inputs for (i, k) range from 0 to 100. Consider each (i, k) as a position of a node in a trinomial tree. Ex: (0, 0) can diverge to (1, 1) (1, 0) (1, -1). (1, 1) can diverge to (2, 2) (2, 1) (2, 0). Sample given here: http://www.google.com/imgres?imgurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlimg1156.gif&imgrefurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlnode41.html&h=413&w=416&sz=4&tbnid=OegDZu-yeVitZM:&tbnh=90&tbnw=91&zoom=1&usg=__9uQWDNYNLV14YioWWbrqPgfa3DQ=&docid=2hhitNyRWjI_DM&hl=en&sa=X&ei=xAfFUIbyG8nzyAHv2YDICg&ved=0CDsQ9QEwAQ I am using a map map <double, double> hash_table I need a key value to be determined from pairs (i, k) to hash to to value for that (i, k) So far I was only able to come up with linear functions such as: double Hash_function(int i, int k) { //double val = pow(i, k) + i; //return (val % 4294967296); return (i*3.1415 + k*i*9.12341); } However, I cannot determine a unique key with a certain (i, k). What kind of functions can I use to help me do so?

    Read the article

  • python matrices - list index out of range

    - by user1888493
    I am writing a function, that takes a matrix as input, such as the one below. Then the it returns the matrix' inverse, where all the 1s are changed to 0s and all the 0s changed to 1s, while keeping the diagonal from top left to bottom right 0s. An example input: g1 = [[0, 1, 1, 0], [1, 0, 0, 1], [1, 0, 0, 1], [0, 1, 1, 0]] the function should output this: g1 = [[0, 0, 0, 1], [0, 0, 1, 0], [0, 1, 0, 0], [1, 0, 0, 0]] When I run the program, it raises a list index out of range error. I'm sure this happens, because the loops I have set up are trying to access values that do not exist. But how do I allow an input of unknown row and column size? I only know how to do this with a single list, but a list of lists? Following you see the transforming function, but not the test function that calls it: def inverse_graph(graph): # take in graph # change all zeros to ones and ones to zeros r, c = 0, 0 # row, column equal zero while (graph[r][c] == 0 or graph[r][c] == 1): # while the current row has a value. while (graph[r][c] == 0 or graph[r][c] == 1): # while the current column has a value if (graph[r][c] == 0): graph[r][c] = 1 elif (graph[r][c] == 1): graph[r][c] = 0 c+=1 c=0 r+=1 c=0 r=0 # sets diagonal to zeros while (g1[r][c] == 0 or g1[r][c] == 1): g1[r][c]=0 c+=1 r+=1 return graph

    Read the article

  • How do you use boost iterators

    - by Neil G
    It worked, and then I added the typedefs so that I could have a const_sparse_iterator as well. Now, when I compile this and try to use sparse_iterator, it says: /Users/neilrg/nn/src/./core/sparse_vector.h:331: error: invalid use of incomplete type 'struct sparse_vector<A>::sparse_iterator' Here's the code. More code here. tempalte<typename T> class sparse_vector { // There is more code at my previous question, but this might be enough...? private: template<typename base_type> class sparse_iterator_private : public boost::iterator_adaptor< sparse_iterator_private<base_type> // Derived , base_type // Base , value_type // Value , boost::random_access_traversal_tag // CategoryOrTraversal > { private: struct enabler {}; // a private type avoids misuse public: sparse_iterator_private() : sparse_iterator_private<base_type>::iterator_adaptor_(0) {} explicit sparse_iterator_private(typename array_type::iterator&& p) : sparse_iterator_private<base_type>::iterator_adaptor_(p) {} private: friend class boost::iterator_core_access; reference dereference() const { return this->base()->value; } }; public: typedef sparse_iterator_private<typename array_type::iterator> sparse_iterator; typedef sparse_iterator_private<typename array_type::const_iterator> const_sparse_iterator; };

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Can JQuery.Validate plugin prevent submission of an Ajax form

    - by berko
    I am using the JQuery form plugin (http://malsup.com/jquery/form/) to handle the ajax submission of a form. I also have JQuery.Validate (http://docs.jquery.com/Plugins/Validation) plugged in for my client side validation. What I am seeing is that the validation fails when I expect it to however it does not stop the form from submitting. When I was using a traditional form (i.e. non-ajax) the validation failing prevented the form for submitting at all.... which is my desired behaviour. I know that the validation is hooked up correctly as the validation messages still appear after the ajax submit has happened. So what I am I missing that is preventing my desired behaviour? Sample code below.... <form id="searchForm" method="post" action="/User/GetDetails"> <input id="username" name="username" type="text" value="user.name" /> <input id="submit" name="submit" type="submit" value="Search" /> </form> <div id="detailsView"> </div> <script type="text/javascript"> var options = { target: '#detailsView' }; $('#searchForm').ajaxForm(options); $('#searchForm').validate({ rules: { username: {required:true}}, messages: { username: {required:"Username is a required field."}} }); </script>

    Read the article

  • jQuery Suspected Naming Convention Problem

    - by donfigga
    Hi all, I'm having a problem with this jQuery function, the portion of the function that renames the id, class and name of the dropdown only works for the first dropdown, subsequent ones do not work, any ideas? I suspect it may have something to do with naming convention as in cat.parent_id but it is required for asp.net mvc model binding. $(document).ready(function () { $("table select").live("change", function () { var id = $(this).attr('id'); if ($(this).attr('classname') != "selected") { var rowIndex = $(this).closest('tr').prevAll().length; $.getJSON("/Category/GetSubCategories/" + $(this).val(), function (data) { if (data.length > 0) { //problematic portion $("#" + id).attr('classname', 'selected'); $("#" + id).attr('name', 'sel' + rowIndex); $("#" + id).attr('id', 'sel' + rowIndex); var position = ($('table').get(0)); var tr = position.insertRow(rowIndex + 1); var td1 = tr.insertCell(-1); var td2 = tr.insertCell(-1); td1.appendChild(document.createTextNode('SubCategory')); var sel = document.createElement("select"); sel.name = 'parent_id'; sel.id = 'parent_id'; sel.setAttribute('class', 'unselected'); td2.appendChild(sel); $('#parent_id').append($("<option></option>").attr("value", "-1").text("-please select item-")); $.each(data, function (GetSubCatergories, Category) { $('#parent_id').append($("<option></option>"). attr("value", Category.category_id). text(Category.name)); }); sel.name = 'cat.parent_id'; sel.id = 'cat.parent_id'; } }); } }); });

    Read the article

  • Another boost error

    - by user1676605
    On this code I get the enourmous error static void ParseTheCommandLine(int argc, char *argv[]) { int count; int seqNumber; namespace po = boost::program_options; std::string appName = boost::filesystem::basename(argv[0]); po::options_description desc("Generic options"); desc.add_options() ("version,v", "print version string") ("help", "produce help message") ("sequence-number", po::value<int>(&seqNumber)->default_value(0), "sequence number") ("pem-file", po::value< vector<string> >(), "pem file") ; po::positional_options_description p; p.add("pem-file", -1); po::variables_map vm; po::store(po::command_line_parser(argc, argv). options(desc).positional(p).run(), vm); po::notify(vm); if (vm.count("pem file")) { cout << "Pem files are: " << vm["pem-file"].as< vector<string> >() << "\n"; } cout << "Sequence number is " << seqNumber << "\n"; exit(1); ../../../FIXMarketDataCommandLineParameters/FIXMarketDataCommandLineParameters.hpp|98|error: no match for ‘operator<<’ in ‘std::operator<< [with _Traits = std::char_traits](((std::basic_ostream &)(& std::cout)), ((const char*)"Pem files are: ")) << ((const boost::program_options::variable_value*)vm.boost::program_options::variables_map::operator[](((const std::string&)(& std::basic_string, std::allocator (((const char*)"pem-file"), ((const std::allocator&)((const std::allocator*)(& std::allocator()))))))))-boost::program_options::variable_value::as with T = std::vector, std::allocator , std::allocator, std::allocator ’|

    Read the article

< Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >