Search Results

Search found 35561 results on 1423 pages for 'value'.

Page 706/1423 | < Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >

  • JSP - Beginner question , Bypass the if..statement on page load?

    - by TatMing
    i am new in JSP,i have some problem with the following code : <%@ page contentType="text/html;charset=Big5" %> <html> <head> <title></title> </head> <body> <form method="post" action="InsertStudent.jsp"> <input type="text" size="20" name="txtName" /> <input type="text" size="20" name="txtDob" /> <input type="text" size="20" name="txtProStudied" /> <input type="submit" name="B1" value="Submit" /> </form> <% if (request.getParameter("txtName") !="" && request.getParameter("txtDob") != "" && request.getParameter("txtProStudied") != "" ) { out.println("...bypass the if....statement"); } %> </body> </html> If run this code, the out.println will fire even the 3 input box have value or not..

    Read the article

  • how to validate the dropdownlist box values on submit

    - by kumar
    Hello friends, I have validate_excpt on Form Before Submit I am doing this.. on the View I have two dropdown listboxes I am using On Submit I need to check.. If I selet ResolutionCode I need to validat ReasonCode Dropdownlist that It should select if not Pelase select ReasonCode I should Dispaly? Do I need to do this on Submit ButtonClick? or Can I do it on Validate_excpt? Can anybody help me out? <label for="ResolutionCode"> Resolution: <span> <%=Html.DropDownListFor(model => model.ResolutionCode, new SelectList(Model.LookupCodes["C_EXCPT_RESL"], "Key", "Value"))%> </span> </label> <label for="ReasonCode"> Reason: <span><%=Html.DropDownListFor(model => model.ReasonCode, new SelectList(Model.LookupCodes["C_EXCPT_RSN"], "Key", "Value"))%></span> </label> function validate_excpt(formData, jqForm, options) { var form = jqForm[0]; return true; } // post-submit callback function showResponse(responseText, statusText, xhr, $form) { if (responseText[0].substring(0, 16) != "System.Exception") { $('#error-msg-ID span:last').html('<strong>Update successful.</strong>'); } else { $('#error-msg-ID span:last').html('<strong>Update failed.</strong> ' + responseText[0].substring(0, 48)); } $('#error-msg-ID').removeClass('hide'); } $('#exc-').ajaxForm({ target: '#error-msg-ID', beforeSubmit: validate_excpt, success: showResponse, dataType: 'json' });

    Read the article

  • How do I get 2-way data binding to work for nested asp.net Repeater controls

    - by jimblanchard
    I have the following (trimmed) markup: <asp:Repeater ID="CostCategoryRepeater" runat="server"> <ItemTemplate> <div class="costCategory"> <asp:Repeater ID="CostRepeater" runat="server" DataSource='<%# Eval("Costs")%>'> <ItemTemplate> <tr class="oddCostRows"> <td class="costItemTextRight"><span><%# Eval("Variance", "{0:c0}")%></span></td> <td class="costItemTextRight"><input id="SupplementAmount" class="costEntryRight" type="text" value='<%# Bind("SupplementAmount")%>' runat="server" /></td> </tr> </ItemTemplate> </asp:Repeater> </div> </ItemTemplate> </asp:Repeater> The outer repeater's DataSource is set in the code-beside. I've snipped them, but there are Eval statements that wire up to the properties in the outer Repeater. Anyway, one of the fields in the inner Repeater needs to be a Bind instead of an Eval, as I want to get the values that the user types in. The SupplementAmount input element correctly receives it's value when the page loads, but on the other side, when I inspect the contents of the Costs List when the form posts back, the changes the user made aren't present. Thanks.

    Read the article

  • larger file upload problem with php

    - by chris
    I need to upload a csv file to a server. works fine for smaller files but when the file is 3-6 meg its not working. $allowedExtensions = array("csv"); foreach ($_FILES as $file) { if ($file['tmp_name'] > '') { if (!in_array(end(explode(".", strtolower($file['name']))), $allowedExtensions)) { die($file['name'].' is an invalid file type!<br/>'. '<a href="javascript:history.go(-1);">'. '&lt;&lt Go Back</a>'); } if (move_uploaded_file($file['tmp_name'], $uploadfile)) { echo "File is valid, and was successfully uploaded.\n"; } else { echo "Possible file upload attack!\n"; } echo "File has been uploaded"; } //upload form <form name="upload" enctype="multipart/form-data" action="<? echo $_SERVER['php_self'];?>?action=upload_process" method="POST"> <!-- MAX_FILE_SIZE must precede the file input field --> <input type="hidden" name="MAX_FILE_SIZE" value="31457280" /> <!-- Name of input element determines name in $_FILES array --> Send this file: <input name="userfile" type="file" /> <input type="submit" value="Send File" /> </form> I have also added this to htaccess php_value upload_max_filesize 20M php_value post_max_size 20M php_value max_execution_time 200 php_value max_input_time 200 Where am i going wrong?

    Read the article

  • jquery question

    - by OM The Eternity
    I am using the Jquery library to copy the text enter in one textfield to another textfield using a check box when clicked.. which is as follows <html> <head> <script src="js/jquery.js" ></script> </head> <body> <form> <input type="text" name="startdate" id="startdate" value=""/> <input type="text" name="enddate" id="enddate" value=""/> <input type="checkbox" name="checker" id="checker" /> </form> <script> $(document).ready(function(){ $("input#checker").bind("click",function(o){ if($("input#checker:checked").length){ $("#enddate").val($("#startdate").val()); }else{ $("#enddate").val(""); } }); } ); </script> </body> </html> now here i want the check box to be selected by default, so that the data entered in start date get copied automatically as check box is checked by default... so what event should be called here in jquery script? please help me in resolving this issue...

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Drupal Ubercart: error in passing values back to the Content Type after checkout

    - by user512826
    I am trying to set up event registration in a drupal site using Ubercart + the UC Node Checkout Module. I have followed the instructions provided in http://drupaleasy.com/blogs/ultimike/2009/03/event-registration-ubercart. However I seem to be unable to pass the Order ID and Payment Status back to the node. I have created a conditional action that on node checkout executes the following PHP code: I am using the following code to update the node on checkout - but nothing happens: if (isset($order)) { foreach ($order->products as $product) { if (isset($product->data['node_checkout_nid'])) { $node = node_load($product->data['node_checkout_nid']); $node->field_status['0']['value'] = 1; $node->field_orderid['0']['value'] = $order->order_id; node_save($node); } } } I know the conditional action is working because it prints dsm('hello world') messages on node checkout - however when I include a dsm($node) or dsm($product) in the PHP code, they return blank. Also when I go back to my product and click the 'Devel' tab, the 'data' string contains the following characters: a:1:{s:13:"form_build_id";s:37:"form-3ccc03345f4832c69666a89c560de940";} In this link http://www.ubercart.org/forum/support/10951/node_checkout_issue I found someone else with the same issue, but I have been unable to replicate his solution. Can anybody please help? Thanks so much!

    Read the article

  • How can I bind multiple Jquery UI Slider with "year" Select?

    - by arthur_br
    Hi, I'm trying to render sliders instead of select components. Each page has several select components marked with class='jqselect' and all of them will have decreasing year values (some years may be missing). Eg. a select may have values [2010, 2009, 2006, 2005, 2004]. I have tried binding it both following the examples in the jQuery UI doc (but ignoring the missing years) and using selectToUISlider by filamentgroup (http://www.filamentgroup.com/lab/update_jquery_ui_slider_from_a_select_element_now_with_aria_support//). None of them work. Here is what I've done so far: Binding selects with following slider container divs: $('#content div.jqslider').slider({ animate: true, min: $(this).prev().children().last().val(), max: $(this).prev().children().first().val(), slide: function(event, ui) { var select = $(this).prev(); select.val($(this).slider('option', 'value')); console.log($(this).slider('option', 'value')); //debug } }); This renders the slider, but console logs values from 0 to 100 and selects obviously does not change with the event. Using selectToUISlider: $('#content select.jqselect').selectToUISlider(); This does not even render the slider, throwing an error 'b is undefined' in jquery-min.js (line 30, v1.4.2). If I pass the identifier of only one of the sliders, it is rendered but very buggy. Please, I'm stucked in the by two days and any help is much appreciated. Regards, Arthur

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • Elegant code question: How to avoid creating unneeded object

    - by SeaDrive
    The root of my question is that the C# compiler is too smart. It detects a path via which an object could be undefined, so demands that I fill it. In the code, I look at the tables in a DataSet to see if there is one that I want. If not, I create a new one. I know that dtOut will always be assigned a value, but the the compiler is not happy unless it's assigned a value when declared. This is inelegant. How do I rewrite this in a more elegant way? System.Data.DataTable dtOut = new System.Data.DataTable(); . . // find table with tablename = grp // if none, create new table bool bTableFound = false; foreach (System.Data.DataTable d1 in dsOut.Tables) { string d1_name = d1.TableName; if (d1_name.Equals(grp)) { dtOut = d1; bTableFound = true; break; } } if (!bTableFound) dtOut = RptTable(grp);

    Read the article

  • CAML query soap SharePoint

    - by robScott
    I'm trying to access a SharePoint list and return the calendar dates for a custom webpart I made. It was working fine, then I decided to only retrieve the date selected rather than the whole calendar, so I wanted to add a where clause. I've tried 'yyyy-MM-dd', 'yyyy-MM-ddThh:mm:ssZ', and 'yyyy-MM-dd hh:mm:ssZ' as string formats I've also tried MM/dd/yyyy as a date format. I'm using jQuery, and I do have list items in the calendar. I'm assuming my date is not in the correct format. var date = $(this).attr('date'); var sharepointDate = Date.parse(date).toString('yyyy-mm-ddT00:00:01Z'); var soapEnv = "<soapenv:Envelope xmlns:soapenv='http://schemas.xmlsoap.org/soap/envelope/'> \ <soapenv:Body> \ <GetListItems xmlns='http://schemas.microsoft.com/sharepoint/soap/'> \ <listName>CorporateCalendar</listName> \ <viewFields> \ <ViewFields> \ <FieldRef Name='Title' /> \ </ViewFields> \ </viewFields> \ <query><Query><Where><Geq><FieldRef Name='EventDate' /><Value Type='DateTime'>" + sharepointDate + "</Value></Geq></Where></Query></query> \ <rowLimit>500</rowLimit> \ </GetListItems> \ </soapenv:Body> \ </soapenv:Envelope>"; If I take the where clause out I receive all the items in the calendar. If the query is in there, I receive no results. Thanks in advance

    Read the article

  • Optimizing a "set in a string list" to a "set as a matrix" operation

    - by Eric Fournier
    I have a set of strings which contain space-separated elements. I want to build a matrix which will tell me which elements were part of which strings. For example: "" "A B C" "D" "B D" Should give something like: A B C D 1 2 1 1 1 3 1 4 1 1 Now I've got a solution, but it runs slow as molasse, and I've run out of ideas on how to make it faster: reverseIn <- function(vector, value) { return(value %in% vector) } buildCategoryMatrix <- function(valueVector) { allClasses <- c() for(classVec in unique(valueVector)) { allClasses <- unique(c(allClasses, strsplit(classVec, " ", fixed=TRUE)[[1]])) } resMatrix <- matrix(ncol=0, nrow=length(valueVector)) splitValues <- strsplit(valueVector, " ", fixed=TRUE) for(cat in allClasses) { if(cat=="") { catIsPart <- (valueVector == "") } else { catIsPart <- sapply(splitValues, reverseIn, cat) } resMatrix <- cbind(resMatrix, catIsPart) } colnames(resMatrix) <- allClasses return(resMatrix) } Profiling the function gives me this: $by.self self.time self.pct total.time total.pct "match" 31.20 34.74 31.24 34.79 "FUN" 30.26 33.70 74.30 82.74 "lapply" 13.56 15.10 87.86 97.84 "%in%" 12.92 14.39 44.10 49.11 So my actual questions would be: - Where are the 33% spent in "FUN" coming from? - Would there be any way to speed up the %in% call? I tried turning the strings into factors prior to going into the loop so that I'd be matching numbers instead of strings, but that actually makes R crash. I've also tried going for partial matrix assignment (IE, resMatrix[i,x] <- 1) where i is the number of the string and x is the vector of factors. No dice there either, as it seems to keep on running infinitely.

    Read the article

  • Is there a way to load an existing connection string for Linq to SQL from an app.config file?

    - by Brian Surowiec
    I'm running into a really annoying problem with my Linq to SQL project. When I add everything in under the web project everything goes as expected and I can tell it to use my existing connection string stored in the web.config file and the Linq code pulls directly from the ConfigurationManager. This all turns ugly once I move the code into its own project. I’ve created an app.config file, put the connection string in there as it was in the web.config but when I try to add another table in the IDE keeps forcing me to either hardcode the connection string or creates a Settings file and puts it in there, which then adds a new entry into the app.config file with a new name. Is there a way keep my Linq code in its own project yet still refer back to my config file without the IDE continuously hardcoding the connection string or creating the Settings file? I’m converting part of my DAL over to use Linq to SQL so I’d like to use the existing connection string that our old code is using as well as keep the value in a common location, and one spot, instead of in a number of spots. Manually changing the mode to WebSettings instead of AppSettings works untill I try to add a new table, then it goes back to hardcoding the value or recreating the Settings file. I also tried to switch the project type to be a web project and then rename my app.config to web.config and then everything works as I’d like it to. I’m just not sure if there are any downfalls to keeping this as a web project since it really isn't one. The project only contains the Linq to SQL code and an implementation of my repository classes. My project layout looks like this Website -connectionString.config -web.config (refers to connectionString.config) Middle Tier -Business Logic -Repository Interfaces -etc. DAL -Linq to SQL code -Existing SPROC code -connectionString.config (linked from the web poject) -app.config (refers to connectionString.config)

    Read the article

  • Passing a outside variable into a <asp:sqldatasource> tag. ASP.NET 2.0

    - by MadMAxJr
    I'm designing some VB based ASP.NET 2.0, and I am trying to make more use of the various ASP tags that visual studio provides, rather than hand writing everything in the code-behind. I want to pass in an outside variable from the Session to identify who the user is for the query. <asp:sqldatasource id="DataStores" runat="server" connectionstring="<%$ ConnectionStrings:MY_CONNECTION %>" providername="<%$ ConnectionStrings:MY_CONNECTION.ProviderName %>" selectcommand="SELECT THING1, THING2 FROM DATA_TABLE WHERE (THING2 IN (SELECT THING2 FROM RELATED_DATA_TABLE WHERE (USERNAME = @user)))" onselecting="Data_Stores_Selecting"> <SelectParameters> <asp:parameter name="user" defaultvalue ="" /> </SelectParameters> </asp:sqldatasource> And on my code behind I have: Protected Sub Data_Stores_Selecting(ByVal sender As Object, ByVal e As System.Web.UI.WebControls.SqlDataSourceSelectingEventArgs) Handles Data_Stores.Selecting e.Command.Parameters("user").Value = Session("userid") End Sub Oracle squaks at me with ORA-01036, illegal variable name. Am I declaring the variable wrong in the query? I thought external variables share the same name with a @ prefixed. from what I understand, this should be placing the value I want into the query when it executes the select. EDIT: Okay, thanks for the advice so far, first error was corrected, I need to use : and not @ for the variable declaration in the query. Now it generates an ORA-01745 invalid host/bind variable name. EDIT AGAIN: Okay, looks like user was a reserved word. It works now! Thanks for other points of view on this one. I hadn't thought of that approach.

    Read the article

  • Generic Constraints And Type Parameters Mess

    - by Dummy01
    Hi everyone, I have the following base abstract class defined as: public abstract class BaseObject<T> : IComparable, IComparable<T>, IEquatable<T> {} I also have an interface defined as: public interface ICode<T> where T : struct { T Code { get; } } Now I want to derive a class that is inherited from BaseObject<T> and includes interface ICode<T>. I tried to define it like that: public class DerivedObject<T, U> : BaseObject<T>, ICode<U> where T : DerivedObject<T, U> where U : struct { public DerivedObject(U code) { Code = code; } // From BaseObject protected override int InstanceCompareTo(T obj) { return Code.CompareTo(obj.Code); } // From BaseObject protected override bool InstanceEquals(T obj) { return Code.Equals(obj.Code); } // From ICode U _Code; public U Code { get { return _Code; } protected set { _Code = value; } } } The only error that comes from the compiler is for Code.CompareTo(obj.Code) with the message: 'U' does not contain a definition for 'CompareTo' and no extension method 'CompareTo' accepting a first argument of type 'U' could be found. But U is a value type and should know CompareTo. Have you any idea what I am doing wrong, or if I do all wrong? My final aim is to derive classes such these: public class Account : DerivedObject<Account, int> public class ItemGroup : DerivedObject<ItemGroup, string> Big Thanks In Advance!

    Read the article

  • Help with AJAX, Using PHP and hiding elements.

    - by ryan
    Hey, This is my first time with AJAX, so I'm a bit confused and need your help. I have four div id's and want to toggle hide/show between them based on result from database. Sounds simple, eh! But it is hard to implement for me. HELP!. This is my code - <div id="1">HEya</div> <div id="2">What's up?</div> <input type="submit" id='approve' name="action" value="Approve" onclick="a()" class="approve" /> <input type="submit" id='reject' value="Reject" name="action" onclick="r()" class="reject"/> <script language="javascript" type="text/javascript"> //if cookie exists, at the beginning the form should be hidden if (<?php $responseanswer['response']=='approve'; ?> ){ document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display = 'inline'; } //if user clicks reject, hide one element dislay another else if (<?php $responseanswer['response']=='reject'; ?>){ //if cookie exists document.getElementById('2').style.display = 'none'; document.getElementById('1').style.display = 'block'; } else { function a() { var a = document.getElementById('2'); document.getElementById('1').style.display= 'block'; } //on reject creating a new cookie function r() { var a = document.getElementById('reject'); document.getElementById('1').style.display = 'none'; document.getElementById('2').style.display= 'block'; } } </script> Eveything is fine, but the div is not hiding.

    Read the article

  • Help Optimizing MySQL Table (~ 500,000 records) and PHP Code.

    - by Pyrite
    I have a MySQL table that collects player data from various game servers (Urban Terror). The bot that collects the data runs 24/7, and currently the table is up to about 475,000+ records. Because of this, querying this table from PHP has become quite slow. I wonder what I can do on the database side of things to make it as optomized as possible, then I can focus on the application to query the database. The table is as follows: CREATE TABLE IF NOT EXISTS `people` ( `id` bigint(20) unsigned NOT NULL AUTO_INCREMENT, `name` varchar(40) NOT NULL, `ip` int(4) unsigned NOT NULL, `guid` varchar(32) NOT NULL, `server` int(4) unsigned NOT NULL, `date` int(11) NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `Person` (`name`,`ip`,`guid`), KEY `server` (`server`), KEY `date` (`date`), KEY `PlayerName` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 COMMENT='People that Play on Servers' AUTO_INCREMENT=475843 ; I'm storying the IPv4 (ip and server) as 4 byte integers, and using the MySQL functions NTOA(), etc to encode and decode, I heard that this way is faster, rather than varchar(15). The guid is a md5sum, 32 char hex. Date is stored as unix timestamp. I have a unique key on name, ip and guid, as to avoid duplicates of the same player. Do I have my keys setup right? Is the way I'm storing data efficient? Here is the code to query this table. You search for a name, ip, or guid, and it grabs the results of the query and cross references other records that match the name, ip, or guid from the results of the first query, and does it for each field. This is kind of hard to explain. But basically, if I search for one player by name, I'll see every other name he has used, every IP he has used and every GUID he has used. <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> Search: <input type="text" name="query" id="query" /><input type="submit" name="btnSubmit" value="Submit" /> </form> <?php if (!empty($_POST['query'])) { ?> <table cellspacing="1" id="1up_people" class="tablesorter" width="300"> <thead> <tr> <th>ID</th> <th>Player Name</th> <th>Player IP</th> <th>Player GUID</th> <th>Server</th> <th>Date</th> </tr> </thead> <tbody> <?php function super_unique($array) { $result = array_map("unserialize", array_unique(array_map("serialize", $array))); foreach ($result as $key => $value) { if ( is_array($value) ) { $result[$key] = super_unique($value); } } return $result; } if (!empty($_POST['query'])) { $query = trim($_POST['query']); $count = 0; $people = array(); $link = mysql_connect('localhost', 'mysqluser', 'yea right!'); if (!$link) { die('Could not connect: ' . mysql_error()); } mysql_select_db("1up"); $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name LIKE \"%$query%\" OR INET_NTOA(ip) LIKE \"%$query%\" OR guid LIKE \"%$query%\")"; $result = mysql_query($sql, $link); if (!$result) { die(mysql_error()); } // Now take the initial results and parse each column into its own array while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } // now for each name, ip, guid in results, find additonal records $people2 = array(); foreach ($people AS $person) { $ip = $person['ip']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (ip = \"$ip\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people2[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people3 = array(); foreach ($people AS $person) { $guid = $person['guid']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (guid = \"$guid\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people3[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people4 = array(); foreach ($people AS $person) { $name = $person['name']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name = \"$name\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people4[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } // Combine people and people2 into just people $people = array_merge($people, $people2); $people = array_merge($people, $people3); $people = array_merge($people, $people4); $people = super_unique($people); foreach ($people AS $person) { $date = ($person['date']) ? date("M d, Y", $person['date']) : 'Before 8/1/10'; echo "<tr>\n"; echo "<td>".$person['id']."</td>"; echo "<td>".$person['name']."</td>"; echo "<td>".$person['ip']."</td>"; echo "<td>".$person['guid']."</td>"; echo "<td>".$person['server']."</td>"; echo "<td>".$date."</td>"; echo "</tr>\n"; $count++; } // Find Total Records //$result = mysql_query("SELECT id FROM 1up_people", $link); //$total = mysql_num_rows($result); mysql_close($link); } ?> </tbody> </table> <p> <?php echo $count." Records Found for \"".$_POST['query']."\" out of $total"; ?> </p> <?php } $time_stop = microtime(true); print("Done (ran for ".round($time_stop-$time_start)." seconds)."); ?> Any help at all is appreciated! Thank you.

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Runtime Error 1004 using Select with several workbooks

    - by Johaen
    I have an Excel workbook which pulls out data from two other workbooks. Since the data changes hourly there is the possibility that this macro is used more than one time a day for the same data. So I just want to select all previous data to this date period and want to delete them. Later on the data will be copied in anyway. But as soon as I want to use WBSH.Range(Cells(j, "A"), Cells(lastRow - 1, "M")).Select the code stopes with Error 1004 Application-defined or object-defined error. Followed just a snippet of the code with the relevant part. What is wrong here? 'Set source workbook Dim currentWb As Workbook Set currentWb = ThisWorkbook Set WBSH = currentWb.Sheets("Tracking") 'Query which data from the tracking files shoud get pulled out to the file CheckDate = Application.InputBox(("From which date you want to get data?" & vbCrLf & "Format: yyyy/mm/dd "), "Tracking data", Format(Date - 1, "yyyy/mm/dd")) 'states the last entry which is done ; know where to start ; currentWb File With currentWb.Sheets("Tracking") lastRow = .Range("D" & .Rows.Count).End(xlUp).Row lastRow = lastRow + 1 End With 'just last 250 entries get checked since not so many entries are made in one week j = lastRow - 250 'Check if there is already data to the look up date in the analyses sheet and if so deletes these records Do j = j + 1 'Exit Sub if there is no data to compare to prevent overflow If WBSH.Cells(j + 1, "C").Value = "" Then Exit Do End If Loop While WBSH.Cells(j, "C").Value < CheckDate If j <> lastRow - 1 Then 'WBSH.Range(Cells(j, "A"), Cells(lastRow - 1, "M")).Select 'Selection.ClearContents End If Thank you!

    Read the article

  • Serialization of Queue type not working

    - by Soham
    Consider this piece of code: private Queue Date=new Queue(); //other declarations public DateTime _Date { get { return (DateTime)Date.Peek();} set { Date.Enqueue(value); } } //other properties and stuff.... public void UpdatePosition(...) { //other code IFormatter formatter = new BinaryFormatter(); Stream Datestream = new MemoryStream(); formatter.Serialize(Datestream, Date); byte[] Datebin = new byte[2048]; Datestream.Read(Datebin,0,2048); //Debug-Bug Console.WriteLine(Convert.ToString(this._Date)); Console.WriteLine(BitConverter.ToString(Datebin, 0, 3)); //other code } The output of the first WriteLine is perfect. I.e to check if really the Queue is initialised or not. It is. The right variables are stored etc. (I inserted a value in that Queue, that part of the code is not shown.) But the second WriteLine is not giving the right expected answer: It serializes the entire Queue to 00-00-00.

    Read the article

  • Enlist a table's columns in other component

    - by bungrudi
    The main goal is to have a dropdown menu where each of its menuItems represents one column of a <rich:extendedDataTable />. Above the table I have this: <rich:dropDownMenu value="Column visibility" submitMode="none" direction="bottom-right"> <c:forEach var="columnConfigVO" items="#{gridConfigurationManager.getColumnConfigs(listId)}"> <rich:menuItem value="columnConfigVO.columnId" /> </c:forEach> </rich:dropDownMenu> And then bellow that I have the usual <rich:extendedDataTable /> with its columns. I register the table columns to gridConfigurationManager component by overriding beforeRenderResponse() in ExtendedDataTable class. The problem is that <c:forEach /> is executing before renderResponse phase, thus gridConfigurationManager.getColumnConfigs(listId) return empty. The question is, how do I register the columns in gridConfigurationManager component before <c:forEach /> start executing? Or, anyone know a different approach to accomplish this? Thanks.

    Read the article

  • Forming triangles from points and relations

    - by SiN
    Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

    Read the article

  • Identity alternative for SQL Azure Federation : are Azure Queues or Service Bus Queues a good choice?

    - by JYL
    As many of developers, I'm looking for a way to integrate my existing app to SQL Azure Federations, and replacing the Identity columns (the primary keys of my tables) is a big problem. For many reasons, I do NOT want use GUID for my primary keys (please don't open the debate about the GUID or not, it's not my question : i just don't want a GUID, period). So I need to build a key provider to replace the "identity" feature of a standard SQL database. I'm using Entity Framework, so i can easily find one place to set the Id value just before the insert (by overriding the SaveChanges method of my ObjectContext class). I just need to find a "not too complicated" implementation for getting the current Id, which is "farm-ready". I've read this SO post : "ID Generation for Sharded Database (Azure Federated Database)" and "Synchronizing Multiple Nodes in Windows Azure from MSDN Magazine", but this solution sounds a bit complicated for me. I'm thinking about creating (automatically) one azure queue for each SQL table, which contain a pre-loaded list of consecutive integer. When I want an Id value, I just have to get a message from the queue (which becomes invisible and is deleted on the way), which give me the current available Id. About the choice between "Windows Azure Queues" and "Windows Azure Service Bus Queues", I prefere "Windows Azure Queues", due to the "high" latency of Service Bus Queues. I don't think that the lack of "ordering garantee" of Azure Queues is a problem. What do you think about that idea of using Azure Queues to provide Id values ? Do you see any argument to give up that idea ? Do you have a better idea, or even a good practice, to provider integer ids in SQL Azure Federation databases ? Thanks.

    Read the article

  • wpf progress bar slows 10x times serial port communications... how could be possible that?

    - by D_Guidi
    I know that this could look a dumb question, but here's my problem. I have a worker dialog that "hides" a backgroundworker, so in a worker thread I do my job, I report the progress in a standard way and then I show the results in my WPF program. The dialog contains a simply animated gif and a standard wpf progress bar, and when a progress is notified I set Value property. All lokks as usual and works well for any kind of job, like web service calls, db queries, background elaboration and so on. For my job we use also many "couplers", card readers that reads data from smart card, that are managed with native C code that access to serial port (so, I don't use .NET SerialPort object). I have some nunit tests and I read a sample card in 10 seconds, but using my actual program, under the backgroundworker and showing my worker dialog, I need 1.30 minutes to do the SAME job. I struggled into problem for days until I decide to remove the worker dialog, and without dialog I obtain the same performances of the tests! So I investigated, and It's not the dialog, not the animated gif, but the wpf progress bar! Simply the fact that a progress bar is shown (so, no animation, no Value set called, nothing of nothing) slows serialport communicatitons. Looks incredible? I've tested this behavior and it's exactly what happens.

    Read the article

< Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >