Search Results

Search found 19923 results on 797 pages for 'instance variables'.

Page 708/797 | < Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >

  • Catch a PHP Object Instantiation Error

    - by Rob Wilkerson
    It's really irking me that PHP considers the failure to instantiate an object a Fatal Error (which can't be caught) for the application as a whole. I have set of classes that aren't strictly necessary for my application to function--they're really a convenience. I have a factory object that attempts to instantiate the class variant that's indicated in a config file. This mechanism is being deployed for message storage and will support multiple store types: DatabaseMessageStore FileMessageStore MemcachedMessageStore etc. A MessageStoreFactory class will read the application's preference from a config file, instantiate and return an instance of the appropriate class. It might be easy enough to slap a conditional around the instantiation to ensure that class_exists(), but MemcachedMessageStore extends PHP's Memcached class. As a result, the class_exists() test will succeed--though instantiation will fail--if the memcached bindings for PHP aren't installed. Is there any other way to test whether a class can be instantiated properly? If it can't, all I need to do is tell the user which features won't be available to them, but let them continue one with the application. Thanks.

    Read the article

  • What changed in the DataGrid that means it won't work anymore?

    - by Jeff Yates
    I have a Silverlight app with a DataGrid containing some custom columns and all was working well. Then I updated to Silverlight 3 tools for VS 2008 SP1 and rebuilt it. Now it has the following problems: Rows aren't added when the collection is modified. The ItemsSource property is (and always has been) set to an ObservableCollection instance, which notifies when its contents change. This worked fine for Silverlight 2. However, in Silverlight 3 to get this working at all, I now have to null and then re-set ItemsSource - this seems like I'm hiding a bigger issue but I can't work out what that might be. I cannot select a row or a cell anymore. If I'm lucky, I can select one whole row before it stops working. I can't edit anything. I suspect this is related to the previous point. I'll post some source when I am able, but first I have to strip it down to the bare minimum. In the meantime, I was hoping someone might have some idea of what may be going on here. My gut feeling on the second two points is that my bindings are no longer working, but that's just a guess and if it is the case, I have no idea which ones. Thanks for any help anyone might be able to provide. Update So, I finally reduced my problem down to a simple works/doesn't work comparison. The problem seems to occur if I override Equals in my element type. As soon as I do that, something happens strangely in the ObservableCollection that contains that type, it seems, and my application breaks. To make it more interesting, there is a check to make sure that duplicate items don't even get close to being added to the collection. I don't exactly know why ObservableCollection needs to compare equality when inserting items (the stack trace indicates it is using IndexAt) but this seems to cause the issue. So, any thoughts?

    Read the article

  • Retrieving a unique result set with Core Data

    - by randombits
    I have a core data based app that manages a bunch of entities. I'm looking to be able to do the following. I have an entity "SomeEntity" with the attributes: name, type, rank, foo1, foo2. Now, SomeEntity has several rows if when we're speaking strictly in SQL terms. What I'm trying to accomplish is to retrieve only available types, even though each instance can have duplicate types. I also need them returned in order according to rank. So in SQL, what I'm looking for is the following: SELECT DISTINCT(type) ORDER BY rank ASC Here is the code I have so far that's breaking: NSError *error = NULL; NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; [fetchRequest setReturnsDistinctResults:YES]; [fetchRequest setPropertiesToFetch:[NSArray arrayWithObjects:@"type", @"rank", nil]]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"SomeEntity" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // sort by rank NSSortDescriptor *rankDescriptor = [[NSSortDescriptor alloc] initWithKey:@"rank" ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:rankDescriptor,nil]; [fetchRequest setSortDescriptors:sortDescriptors]; [sortDescriptors release]; [rankDescriptor release]; NSArray *fetchResults = [managedObjectContext executeFetchRequest:fetchRequest error:&error]; [fetchRequest release]; return fetchResults; Right now that is crashing with the following: Invalid keypath section passed to setPropertiesToFetch:

    Read the article

  • Re-authentication required for registered-path links (to ASP.NET site) coming to IE from PowerPoint

    - by Daniel Halsey
    We're using URL routing based on Phil Haack's example, with config modifications based on MSDN Library article #CC668202, to provide "shareable" links for a ASP.NET forms site, and have run into a strange issue: For users attempting to open links from PowerPoint presentations, and who have IE set as their default browser, using one of these links forces (forms-based) re-authentication, even in the same browser instance with a live session. Info: We know the session is still alive. (Page returns information for the currently logged-in user; confirmed via debug watches) This doesn't happen with other browsers (FF, Chrome) or with other programs (Notepad++) as the URL source. We do not have a default path set, as this caused issues with root path handling at initial login. This primarily happens with PowerPoint, but will also happen in Word and OCS. On some machines, even after changing the default browser, Office apps will continue to use IE for these links, forcing this error. (A potential registry fix for this failed, but even if it had worked, we can't control default browser choice for our users.) We can't figure out if this is an Office oddity or is being caused by our decision to use app-level URL routing (rather than IIS rewriting). Has anyone else encountered this and found a solution?

    Read the article

  • c# wpf command pattern

    - by evan
    I have a wpf gui which displays a list of information in separate window and in a separate thread from the main application. As the user performs actions in the main window the side window is updated. (For example if you clicked page down in the main window a listbox in the side window would page down). Right now the architecture for this application feels very messy and I'm sure there is a cleaner way to do it. It looks like this: Main Window contains a singleton SideWindowControl which communicates with an instance of the SideWindowDisplay using events - so, for example, the pagedown button would work like: 1) the event handler of the button on the main window calls SideWindowControl.PageDown() 2) in the PageDown() function a event is created and thrown. 3) finally the gui, ShowSideWindowDisplay is subscribing to the SideWindowControl.Actions event handles the event and actually scrolls the listbox down - note because it is in a different thread it has to do that by running the command via Dispatcher.Invoke() This just seems like a very messy way to this and there must be a clearer way (The only part that can't change is that the main window and the side window must be on different threads). Perhaps using WPF commands? I'd really appreciate any suggestions!! Thanks

    Read the article

  • PHP Form - Empty input enter this text - Validation

    - by James Skelton
    No doubt very simple question for someone with php knowledge. I have a form with a datepicker, all is fine when a user has selected a date the email is send with: Date: 2012 04 10 But i would like if the user has skipped this and left blank (as i have not made this required) to send as: Date: Not Entered (<-- Or something) Instead at the minute of course it reads: Date: Form input <input type="text" class="form-control" id="datepicker" name="datepicker" size="50" value="Date Of Wedding" /> This is the validator $(document).ready(function(){ //validation contact form $('#submit').click(function(event){ event.preventDefault(); var fname = $('#name').val(); var validInput = new RegExp(/^[a-zA-Z0-9\s]+$/); var email = $('#email').val(); var validEmail = new RegExp(/^([a-zA-Z0-9_\.\-])+\@(([a-zA-Z0-9\-])+\.)+([a-zA-Z0-9]{2,4})+$/); var message = $('#message').val(); if(fname==''){ showError('<div class="alert alert-danger">Please enter your name.</div>', $('#name')); $('#name').addClass('required'); return;} if(!validInput.test(fname)){ showError('<div class="alert alert-danger">Please enter a valid name.</div>', $('#name')); $('#name').addClass('required'); return;} if(email==''){ showError('<div class="alert alert-danger">Please enter an email address.</div>', $('#email')); $('#email').addClass('required'); return;} if(!validEmail.test(email)){ showError('<div class="alert alert-danger">Please enter a valid email.</div>', $('#email')); $('#email').addClass('required'); return;} if(message==''){ showError('<div class="alert alert-danger">Please enter a message.</div>', $('#message')); $('#message').addClass('required'); return;} // setup some local variables var request; var form = $(this).closest('form'); // serialize the data in the form var serializedData = form.serialize(); // fire off the request to /contact.php request = $.ajax({ url: "contact.php", type: "post", data: serializedData }); // callback handler that will be called on success request.done(function (response, textStatus, jqXHR){ $('.contactWrap').show( 'slow' ).fadeIn("slow").html(' <div class="alert alert-success centered"><h3>Thank you! Your message has been sent.</h3></div> '); }); // callback handler that will be called on failure request.fail(function (jqXHR, textStatus, errorThrown){ // log the error to the console console.error( "The following error occured: "+ textStatus, errorThrown ); }); }); //remove 'required' class and hide error $('input, textarea').keyup( function(event){ if($(this).hasClass('required')){ $(this).removeClass('required'); $('.error').hide("slow").fadeOut("slow"); } }); // show error showError = function (error, target){ $('.error').removeClass('hidden').show("slow").fadeIn("slow").html(error); $('.error').data('target', target); $(target).focus(); console.log(target); console.log(error); return; } });

    Read the article

  • a reusable query with modifications?

    - by fusion
    i'm using this mysql query alongwith php to search for multiple keywords: $query = "SELECT cQuotes, vAuthor, cArabic, vReference FROM ".$table." WHERE ("; $countFields = count($arrayFields); while ($a < $countFields) { while ($b < $countSearch) { $query = $query."$arrayFields[$a] LIKE '%$arraySearch[$b]%'"; $b++; if ($b < $countSearch) { $query = $query." AND "; } } $b = 0; $a++; if ($a < $countFields) { $query = $query.") OR ("; } } $query = $query.")"; $result = mysql_query($query, $conn) i'd like to reuse this query with a few modifications to it (for instance, the WHERE clause remains the same, while i query the number of rows using COUNT), but it doesn't seem practical to repeat the code again for a few additions. any suggestions?

    Read the article

  • Silverlight: Button template with texttrimming cut off

    - by dex3703
    I'm replacing the default Button template's ContentPresenter with a TextBlock, so the text can be trimmed when it's too long. Works fine in WPF. In Silverlight the text gets pushed to one edge and cut off on the left, even when there's space on the right: Template is nothing special, just replaced the ContentPresenter with the TextBlock: <Border x:Name="bdrBackground" BorderBrush="{TemplateBinding BorderBrush}" BorderThickness="{TemplateBinding BorderThickness}" Background="{TemplateBinding Background}" /> <Rectangle x:Name="rectMouseOverVisualElement" Opacity="0"> <Rectangle.Fill> <SolidColorBrush x:Name="rectMouseOverColor" Color="{StaticResource MouseOverItemBgColor}"/> </Rectangle.Fill> </Rectangle> <Rectangle x:Name="rectPressedVisualElement" Opacity="0" Style="{TemplateBinding Tag}"/> <TextBlock x:Name="textblock" Text="{TemplateBinding Content}" TextTrimming="WordEllipsis" TextWrapping="NoWrap" HorizontalAlignment="{TemplateBinding HorizontalContentAlignment}" Margin="{TemplateBinding Padding}" VerticalAlignment="{TemplateBinding VerticalContentAlignment}"/> <Rectangle x:Name="rectDisabledVisualElement" Opacity="0" Style="{StaticResource RectangleDisabledStyle}"/> <Rectangle x:Name="rectFocusVisualElement" Opacity="0" Style="{StaticResource RectangleFocusStyle}"/> </Grid> </ControlTemplate> How do I fix this? More info: With the latest comment about HorizontalAlignment, it's clear that SL's implementation of TextTrimming differs from WPF's. In SL, TextTrimming only really works if the text is aligned left. SL isn't smart enough to align the text the way WPF does. For instance: WPF button: SL button with the textblock horizontalalignment = left: SL button with textblock horizontalalignment = center:

    Read the article

  • Is it getting to be time for C# to support compile-time macros?

    - by Robert Rossney
    Thus far, Microsoft's C# team has resisted adding formal compile-time macro capabilities to the language. There are aspects of programming with WPF that seem (to me, at least) to be creating some compelling use cases for macros. Dependency properties, for instance. It would be so nice to just be able to do something like this: [DependencyProperty] public string Foo { get; set; } and have the body of the Foo property and the static FooProperty property be generated automatically at compile time. Or, for another example an attribute like this: [NotifyPropertyChanged] public string Foo { get; set; } that would make the currently-nonexistent preprocessor produce this: private string _Foo; public string Foo { get { return _Foo; } set { _Foo = value; OnPropertyChanged("Foo"); } } You can implement change notification with PostSharp, and really, maybe PostSharp is a better answer to the question. I really don't know. Assuming that you've thought about this more than I have, which if you've thought about it at all you probably have, what do you think? (This is clearly a community wiki question and I've marked it accordingly.)

    Read the article

  • NullReferenceExeption when reading from a file

    - by Whitey
    I need to read a file structured like this: 01000 00030 00500 03000 00020 And put it in an array like this: int[,] iMap = new int[iMapHeight, iMapWidth] { {0, 1, 0, 0, 0}, {0, 0, 0, 3, 0}, {0, 0, 5, 0, 0}, {0, 3, 0, 0, 0}, {0, 0, 0, 2, 0}, }; Hopefully you see what I'm trying to do here. I was confused how to do this so I asked here on SO, but the code I got from it gets this error: Object reference not set to an instance of an object. I'm pretty new to this so I have no idea how to fix it... I only barely know the code: protected void ReadMap(string mapPath) { using (var reader = new StreamReader(mapPath)) { for (int i = 0; i < iMapHeight; i++) { string line = reader.ReadLine(); for (int j = 0; j < iMapWidth; j++) { iMap[i, j] = (int)(line[j] - '0'); } } } } The line I get the error on is this: iMap[i, j] = (int)(line[j] - '0'); Can anyone provide a solution? Thank you. :)

    Read the article

  • Is is possible to do an end-run around generics covariance in C# < 4 in this hypothetical situation?

    - by John Feminella
    Suppose I have a small inheritance hierarchy of Animals: public interface IAnimal { string Speak(); } public class Animal : IAnimal { public Animal() {} public string Speak() { return "[Animal] Growl!"; } } public class Ape : IAnimal { public string Speak() { return "[Ape] Rawrrrrrrr!"; } } public class Bat : IAnimal { public string Speak() { return "[Bat] Screeeeeee!"; } } Next, here's an interface offering a way to turn strings into IAnimals. public interface ITransmogrifier<T> where T : IAnimal { T Transmogrify(string s); } And finally, here's one strategy for doing that: public class Transmogrifier<T> : ITransmogrifier<T> where T : IAnimal, new() { public T Transmogrify(string s) { T t = default(T); if (typeof(T).Name == s) t = new T(); return t; } } Now, the question. Is it possible to replace the sections marked [1], [2], and [3] such that this program will compile and run correctly? If you can't do it without touching parts other than [1], [2], and [3], can you still get an IAnimal out of each instance of a Transmogrifier in a collection containing arbitrary implementations of an IAnimal? Can you even form such a collection to begin with? static void Main(string[] args) { var t = new Transmogrifier<Ape>(); Ape a = t.Transmogrify("Ape"); Console.WriteLine(a.Speak()); // Works! // But can we make an arbitrary collection of such animals? var list = new List<Transmogrifier< [1] >>() { // [2] }; // And how about we call Transmogrify() on each one? foreach (/* [3] */ transmogrifier in list) { IAnimal ia = transmogrifier.Transmogrify("Bat"); } } }

    Read the article

  • How can I spot subtle Lisp syntax mistakes?

    - by Marius Andersen
    I'm a newbie playing around with Lisp (actually, Emacs Lisp). It's a lot of fun, except when I seem to run into the same syntax mistakes again and again. For instance, here's something I've encountered several times. I have some cond form, like (cond ((foo bar) (qux quux)) ((or corge (grault warg)) (fred) (t xyzzy))) and the default clause, which returns xyzzy, is never carried out, because it's actually nested inside the previous clause: (cond ((foo bar) (qux quux)) ((or corge (grault warg)) (fred)) (t xyzzy)) It's difficult for me to see such errors when the difference in indentation is only one space. Does this get easier with time? I also have problems when there's a large distance between the (mal-)indented line and the line it should be indented against. let forms with a lot of complex bindings, for example, or an unless form with a long conditional: (defun test () (unless (foo bar (qux quux) (or corge (grault warg) (fred)))) xyzzy) It turns out xyzzy was never inside the unless form at all: (defun test () (unless (foo bar (qux quux) (or corge (grault warg) (fred))) xyzzy)) I auto-indent habitually and use parenthesis highlighting to avoid counting parentheses. For the most part it works like a breeze, but occasionally, I discover my syntax mistakes only by debugging. What can I do?

    Read the article

  • Mercurial Subrepos, how to control which changeset I want to use for a subrepo?

    - by Lasse V. Karlsen
    I am reading up on subrepos, and have been running some tests locally, seems to work OK so far, but I have one question. How do I specify/control which changeset I want to use for a particular subrepo? For instance, let's say I have the following two projects: class library application o fourth commit o second commit, added a feature | | o third commit o initial commit | | o second commit |/ o initial commit Now, I want the class library as a subrepo of my application, but due to the immaturity of the longest branch (the one ending up as fourth commit), I want to temporarily use the "second commit" tip. How do I go about configuring that, assuming it is even possible? Here's a batch file that sets up the above two repos + adds the library as a subrepo. If you run the batch file, it will output: [C:\Temp] :test ... v4 As you can see from that last line there, it verifies the contents of the file in the class library, which is "v4" from the fourth commit. I'd like it to be "v2", and persist as "v2" until I'm ready to pull down a newer version from the class library repository. Can anyone tell me if it is possible to do what I want, and if so, what I need to do in order to lock my subrepo to the right changeset? Batch-file: @echo off if exist app rd /s /q app if exist lib rd /s /q lib if exist app-clone rd /s /q app-clone rem == app == hg init app cd app echo program>main.txt hg add main.txt hg commit -m "initial commit" echo program+feature1>main.txt hg commit -m "second commit, added a feature" cd .. rem == lib == hg init lib cd lib echo v1>lib.txt hg add lib.txt hg commit -m "initial commit" echo v2>lib.txt hg commit -m "second commit" hg update 0 echo v3>lib.txt hg commit -m "third commit" echo v4>lib.txt hg commit -m "fourth commit" cd .. rem == subrepos == cd app hg clone ..\lib lib echo lib = ..\lib >.hgsub hg add .hgsub hg commit -m "added subrepo" cd .. rem == clone == hg clone app app-clone type app-clone\lib\lib.txt

    Read the article

  • Permutations distinct under given symmetry (Mathematica 8 group theory)

    - by Yaroslav Bulatov
    Given a list of integers like {2,1,1,0} I'd like to list all permutations of that list that are not equivalent under given group. For instance, using symmetry of the square, the result would be {{2, 1, 1, 0}, {2, 1, 0, 1}}. Approach below (Mathematica 8) generates all permutations, then weeds out the equivalent ones. I can't use it because I can't afford to generate all permutations, is there a more efficient way? Update: actually, the bottleneck is in DeleteCases. The following list {2, 2, 2, 2, 2, 2, 2, 1, 1, 1, 1, 1, 1, 0, 0, 0} has about a million permutations and takes 0.1 seconds to compute. Apparently there are supposed to be 1292 orderings after removing symmetries, but my approach doesn't finish in 10 minutes removeEquivalent[{}] := {}; removeEquivalent[list_] := ( Sow[First[list]]; equivalents = Permute[First[list], #] & /@ GroupElements[group]; DeleteCases[list, Alternatives @@ equivalents] ); nonequivalentPermutations[list_] := ( reaped = Reap@FixedPoint[removeEquivalent, Permutations@list]; reaped[[2, 1]] ); group = DihedralGroup[4]; nonequivalentPermutations[{2, 1, 1, 0}]

    Read the article

  • SQL Server 2008 - Full Text Query

    - by user208662
    Hello, I have two tables in a SQL Server 2008 database in my company. The first table represents the products that my company sells. The second table contains the product manufacturer’s details. These tables are defined as follows: Product ------- ID Name ManufacturerID Description Manufacturer ------------ ID Name As you can imagine, I want to make this as easy as possible for our customers to query this data. However, I’m having problems writing a forgiving, yet powerful search query. For instance, I’m anticipating people to search based on phonetical spellings. Because of this, the data may not match the exact data in my database. In addition, I think some individuals will search by manufacturer’s name first, but I want the matching product names to appear first. Based on these requirements, I’m currently working on the following query: select p.Name as 'ProductName', m.Name as 'Manufacturer', r.Rank as 'Rank' from Product p inner join Manufacturer m on p.ManufacturerID=m.ID inner join CONTAINSTABLE(Product, Name, @searchQuery) as r Oddly, this query is throwing an error. However, I have no idea why. Squiggles appear to the right of the last parenthesis in management studio. The tool tip says "An expression of non-boolean type specified in a context where a condition is expected". I understand what this statement means. However, I guess I do not know how COntainsTable works. What am I doing wrong? Thank you

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Create SQL parameters programmatically

    - by Neo
    Another annoying one for me but probably something simple. I have a number of possible where clauses for a query based on user input, my question is how can I add these programmatically? For instance: wherequery = @"WHERE fieldname = @p_FieldName AND "; if (txtValue.textLength > 0){ wherequery += "fieldname2 = @p_FieldName2 AND "; } query = @"SELECT * FROM tabe" + wherequery; sql = connection.CreateCommand(); sql.CommandText = query; How would I go about doing the parameters for that? I've tried ArrayLists, Dictionaries and a few other methods but can't find a way of doing it. Ideally I'd want to do something like this: SqlParameter[] sqlparams; wherequery = @"WHERE fieldname = @p_FieldName AND "; if (txtValue.textLength > 0){ wherequery += "fieldname2 = @p_FieldName2 AND "; sqlparams.Parameters.Add("@p_FieldName2 ", SqlDbType.VarChar).Value = txtValue.text; } query = @"SELECT * FROM tabe" + wherequery; sql = connection.CreateCommand(); sql.CommandText = query; sql.Parameters.Add(sqlparams);

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • "java.lang.OutOfMemoryError: Java heap space" in image and array storage

    - by totalconscience
    I am currently working on an image processing demonstration in java (Applet). I am running into the problem where my arrays are too large and I am getting the "java.lang.OutOfMemoryError: Java heap space" error. The algorithm I run creates an NxD float array where: N is the number of pixel in the image and D is the coordinates of each pixel plus the colorspace components of each pixel (usually 1 for grayscale or 3 for RGB). For each iteration of the algorithm it creates one of these NxD float arrays and stores it for later use in a vector, so that the user of the applet may look at the individual steps. My client wants the program to be able to load a 500x500 RGB image and run as the upper bound. There are about 12 to 20 iterations per run so that means I need to be able to store a 12x500x500x5 float in some fashion. Is there a way to process all of this data and, if possible, how? Example of the issue: I am loading a 512 by 512 Grayscale image and even before the first iteration completes I run out of heap space. The line it points me to is: Y.add(new float[N][D]) where Y is a Vector and N and D are described as above. This is the second instance of the code using that line.

    Read the article

  • rc.local on ubuntu on ec2 will not work

    - by Tampa
    Below are the contents of my rc.local file. When I run sudo /etc/rc.local it works fine. When I boot up and instance. I expect monit to be installed but it is not. I am at a total loss. I usually use rc.local but this is rather confunsing. #!/bin/sh -e # # rc.local # # This script is executed at the end of each multiuser runlevel. # Make sure that the script will "exit 0" on success or any other # value on error. # # In order to enable or disable this script just change the execution # bits. # # By default this script does nothing. apt-get -y install monit /etc/init.d/monit stop cd /home/ubuntu/workspace/rtbopsConfig/ git fetch git checkout origin/master rtb_ec2_boot/ec2_boot.py git checkout origin/master config/ cp /home/ubuntu/workspace/rtbopsConfig/config/monit/redis/monitrc /etc/monit/ /usr/bin/python /home/ubuntu/workspace/rtbopsConfig/rtb_ec2_boot/ec2_boot.py >> /home/ubuntu/workspace/ec2_boot.txt 2>&1 /etc/init.d/monit start chkconfig monit on exit 0

    Read the article

  • Ultra-grand super acts_as_tree rails query

    - by Bloudermilk
    Right now I'm dealing with an issue regarding an intense acts_as_tree MySQL query via rails. The model I am querying is Foo. A Foo can belong to any one City, State or Country. My goal is to query Foos based on their location. My locations table is set up like so: I have a table in my database called locations I use a combination of acts_as_tree and polymorphic associations to store each individual location as either a City, State or Country. (This means that my table consists of the rows id, name, parent_id, type) Let's say for instance, I want to query Foos in the state "California". Beside Foos that directly belong to "California", I should get all Foos that belong every City in "California" like Foos in "Los Angeles" and "San Francisco". Not only that, but I should get any Foos that belong to the Country that "California" is in, "United States". I've tried a few things with associations to no avail. I feel like I'm missing some super-helpful Rails-fu here. Any advice?

    Read the article

  • C#: How to get all public (both get and set) string properties of a type

    - by Svish
    I am trying to make a method that will go through a list of generic objects and replace all their properties of type string which is either null or empty with a replacement. How is a good way to do this? I have this kind of... shell... so far: public static void ReplaceEmptyStrings<T>(List<T> list, string replacement) { var properties = typeof(T).GetProperties( -- What BindingFlags? -- ); foreach(var p in properties) { foreach(var item in list) { if(string.IsNullOrEmpty((string) p.GetValue(item, null))) p.SetValue(item, replacement, null); } } } So, how do I find all the properties of a type that are: Of type string Has public get Has public set ? I made this test class: class TestSubject { public string Public; private string Private; public string PublicPublic { get; set; } public string PublicPrivate { get; private set; } public string PrivatePublic { private get; set; } private string PrivatePrivate { get; set; } } The following does not work: var properties = typeof(TestSubject) .GetProperties(BindingFlags.Instance|BindingFlags.Public) .Where(ø => ø.CanRead && ø.CanWrite) .Where(ø => ø.PropertyType == typeof(string)); If I print out the Name of those properties I get there, I get: PublicPublic PublicPrivate PrivatePublic In other words, I get two properties too much. Note: This could probably be done in a better way... using nested foreach and reflection and all here... but if you have any great alternative ideas, please let me know cause I want to learn!

    Read the article

  • ActionScript MovieClip moves to the left, but not the right

    - by Defcon
    I have a stage with a movie clip with the instance name of "mc". Currently I have a code that is suppose to move the player left and right, and when the left or right key is released, the "mc" slides a little bit. The problem I'm having is that making the "mc" move to the left works, but the exact some code used for the right doesn't. All of this code is present on the Main Stage - Frame One //Variables var mcSpeed:Number = 0;//MC's Current Speed var mcJumping:Boolean = false;//if mc is Jumping var mcFalling:Boolean = false;//if mc is Falling var mcMoving:Boolean = false;//if mc is Moving var mcSliding:Boolean = false;//if mc is sliding var mcSlide:Number = 0;//Stored for use when creating slide var mcMaxSlide:Number = 1.6;//Max Distance the object will slide. //Player Move Function p1Move = new Object(); p1Move = function (dir:String, maxSpeed:Number) { if (dir == "left" && _root.mcSpeed<maxSpeed) { _root.mcSpeed += .2; _root.mc._x -= _root.mcSpeed; } else if (dir == "right" && _root.mcSpeed<maxSpeed) { _root.mcSpeed += .2; _root.mc._x += _root.mcSpeed; } else if (dir == "left" && speed>=maxSpeed) { _root.mc._x -= _root.mcSpeed; } else if (dir == "right" && _root.mcSpeed>=maxSpeed) { _root.mc._x += _root.mcSpeed; } } //onEnterFrame for MC mc.onEnterFrame = function():Void { if (Key.isDown(Key.LEFT)) { if (_root.mcMoving == false && _root.mcSliding == false) { _root.mcMoving = true; } else if (_root.mcMoving == true && _root.mcSliding == false) { _root.p1Move("left",5); } } else if (!Key.isDown(Key.LEFT)) { if (_root.mcMoving == true && _root.mcSliding == false) { _root.mcSliding = true; } else if (_root.mcMoving == true && _root.mcSliding == true && _root.mcSlide<_root.mcMaxSlide) { _root.mcSlide += .2; this._x -= .2; } else if (_root.mcMoving == true && _root.mcSliding == true && _root.mcSlide>=_root.mcMaxSlide) { _root.mcMoving = false; _root.mcSliding = false; _root.mcSlide = 0; _root.mcSpeed = 0; } } else if (Key.isDown(Key.RIGHT)) { if (_root.mcMoving == false && _root.mcSliding == false) { _root.mcMoving = true; } else if (_root.mcMoving == true && _root.mcSliding == false) { _root.p1Move("right",5); } } else if (!Key.isDown(Key.RIGHT)) { if (_root.mcMoving == true && _root.mcSliding == false) { _root.mcSliding = true; } else if (_root.mcMoving == true && _root.mcSliding == true && _root.mcSlide<_root.mcMaxSpeed) { _root.mcSlide += .2; this._x += .2; } else if (_root.mcMoving == true && _root.mcSliding == true && _root.mcSlide>=_root.mcMax) { _root.mcMoving = false; _root.mcSliding = false; _root.mcSlide = 0; _root.mcSpeed = 0; } } }; I just don't get why when you press the left arrow its works completely fine, but when you press the right arrow it doesn't respond. It is literally the same code.

    Read the article

  • Session scoped bean as class attribute of Spring MVC Controller

    - by Sotirios Delimanolis
    I have a User class: @Component @Scope("session") public class User { private String username; } And a Controller class: @Controller public class UserManager { @Autowired private User user; @ModelAttribute("user") private User createUser() { return user; } @RequestMapping(value = "/user") public String getUser(HttpServletRequest request) { Random r = new Random(); user.setUsername(new Double(r.nextDouble()).toString()); request.getSession().invalidate(); request.getSession(true); return "user"; } } I invalidate the session so that the next time i got to /users, I get another user. I'm expecting a different user because of user's session scope, but I get the same user. I checked in debug mode and it is the same object id in memory. My bean is declared as so: <bean id="user" class="org.synchronica.domain.User"> <aop:scoped-proxy/> </bean> I'm new to spring, so I'm obviously doing something wrong. I want one instance of User for each session. How?

    Read the article

  • Ruby on Rails - pass variable to nested form

    - by Krule
    I am trying to build a multilingual site using Rails, but I can't figure out how to pass variable to nested form. Right now I am creating nested form like this. @languages.each do @article.article_locale.build(:language_id => language.id) end But i would like to pass value of language to it so i can distinguish fields. Something like this. @languages.each do |language| @language = language @article.article_locale.build(:language_id => language.id) end However, I always end up with language of the last loop iteration. Any way to pass this variable? -- edit -- In the end, since I've got no answer I have solved this problem so it, at least, works as it should. Following code is my partial solution. In model: def self.languages Language.all end def self.language_name language = [] self.languages.each_with_index do |lang, i| language[i] = lang.longname end return language end In Controller: def new @article = Article.new Article.languages.each do |language| @article.article_locale.build(:language_id => language.id) end end In HAML View: -count = 0 -f.fields_for :article_locale do |al| %h3= Article.language_name[count] -count+=1 -field_set_tag do %p =al.label :name, t(:name) =al.text_field :name %p =al.label :description, t(:description) =al.text_area :description =al.hidden_field :language_id It's not the most elegant solution I suppose, but it works. I would really love if I could get rid of counter in view for instance.

    Read the article

< Previous Page | 704 705 706 707 708 709 710 711 712 713 714 715  | Next Page >