Search Results

Search found 19923 results on 797 pages for 'instance variables'.

Page 705/797 | < Previous Page | 701 702 703 704 705 706 707 708 709 710 711 712  | Next Page >

  • jQuery: Adding li element only if it not already there?

    - by Legend
    I am constructing an <li> element like this: var element = $("<li></li>") .html(mHTML) .attr('id', "elemid"); I am trying to add this element to a <ul> element only if it doesn't already exist. Any ideas on how to do this? Am I supposed to use contains() to see if the ul element contain the html and then decide? For instance, <ul id="elemul"> <li id="elemli1">Element 1</li> <li id="elemli2">Element 2</li> <li id="elemli3">Element 3</li> </ul> If I try adding Element 1, it should not add it. What should I do if its a longer string (not really long but about 150 characters). Do I go about using hashmaps?

    Read the article

  • Stuck trying to get Log4Net to work with Dependency Injection

    - by Pure.Krome
    I've got a simple winform test app i'm using to try some Log4Net Dependency Injection stuff. I've made a simple interface in my Services project :- public interface ILogging { void Debug(string message); // snip the other's. } Then my concrete type will be using Log4Net... public class Log4NetLogging : ILogging { private static ILog Log4Net { get { return LogManager.GetLogger( MethodBase.GetCurrentMethod().DeclaringType); } } public void Debug(string message) { if (Log4Net.IsDebugEnabled) { Log4Net.Debug(message); } } } So far so good. Nothing too hard there. Now, in a different project (and therefore namesapce), I try and use this ... public partial class Form1 : Form { public Form1() { FileInfo fileInfo = new FileInfo("Log4Net.config"); log4net.Config.XmlConfigurator.Configure(fileInfo); } private void Foo() { // This would be handled with DI, but i've not set it up // (on the constructor, in this code example). ILogging logging = new Log4NetLogging(); logging.Debug("Test message"); } } Ok .. also pretty simple. I've hardcoded the ILogging instance but that is usually dependency injected via the constructor. Anyways, when i check this line of code... return LogManager.GetLogger(MethodBase.GetCurrentMethod().DeclaringType); the DeclaringType type value is of the Service namespace, not the type of the Form (ie. X.Y.Z.Form1) which actually called the method. Without passing the type INTO method as another argument, is there anyway using reflection to figure out the real method that called it?

    Read the article

  • Consuming PHP webservice with .Net C#, error with array

    - by Faber
    I've a problem calling a PHP Web Service from .Net application. This is the XML response and I think there is a problem with the return node <?xml version="1.0" encoding="ISO-8859-1"?> <SOAP-ENV:Envelope SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/"> <SOAP-ENV:Body> <ns1:infoprodottoResponse xmlns:ns1="http://wan3.edc.it"> <result xsi:type="SOAP-ENC:Array" SOAP-ENC:arrayType=":[0]"></result> <error xsi:type="xsd:string">8u9lvDe3RBiGuXyL9lvM2tODlRMtcN77ya3S2LDEWEetBeRz/k4mXkK4hSqpgZOKilHYXgycj6Jtu8iBTfR1FQ==</error> <token xsi:type="xsd:string">5o58H00T96AWedhG1tnSc4xR+yXg7PQfQzXYVpri2AY=</token> </ns1:infoprodottoResponse> </SOAP-ENV:Body> In result node the SOAP-ENC:arrayType attribute hasn't declared the array type. The array type must be declare if the SOAP-ENC:arrayType is present, isn't it? It must be declared also if the array is empty?

    Read the article

  • Jumping onto next string when the condition is met

    - by user98235
    This was a problem related to one of the past topcoder exam problems called HowEasy. Let's assume that we're given a sentence, for instance, "We a1re really awe~~~some" I just wanted to take get rid of every word in the sentence that doesn't contain alphabet characters, so in the above sentence, the desired output would be "We really" The below is the code I wrote (incomplete), and I don't know how to move on to the next string when the condition (the string contains a character that's not alphabet) is met. Could you suggest some revisions or methods that would allow me to do that? vect would be the vector of strings containing the desired output string param; cin>>param; stringstream ss(param); vector<string> vect; string c; while(ss >> c){ for(int i=0; i < c.length(); i++){ if(!(97<=int(c[i])&&int(c[i])<=122) && !(65<=int(c[i])&&int(c[i])<=90)){ //I want to jump onto next string once the above condition is met //and ignore string c; } vect.push_back(c); if (ss.peek() == ' '){ ss.ignore(); } } }

    Read the article

  • Sharing a global/static variable between a process and DLL

    - by minjang
    I'd like to share a static/global variable only between a process and a dll that is invoked by the process. The exe and dll are in the same memory address space. I don't want the variable to be shared among other processes. Elaboration of the problem: Say that there is a static/global variable x in a.cpp. Both the exe foo.exe and the dll bar.dll have a.cpp, so the variable x is in both images. Now, foo.exe dynamically loads (or statically) bar.dll. Then, the problem is whether the variable x is shared by the exe and dll, or not. In Windows, these two guys never share the x: the exe and dll will have a separate copy of x. However, in Linux, the exe and dll do share the variable x. Unfortunately, I want the behavior of Linux. I first considered using pragma data_seg on Windows. However, even if I correctly setup the shared data segment, foo.exe and bar.dll never shares the x. Recall that bar.dll is loaded into the address space of foo.exe. However, if I run another instance of foo.exe, then x is shared. But, I don't want x to be shared by different processes. So, using data_seg was failed. I may it use a memory-mapped file by making an unique name between exe and dll, which I'm trying now. Two questions: Why the behavior of Linux and Windows is different? Can anyone explain more about this? What would be most easiest way to solve this problem on Windows?

    Read the article

  • Is there really such a thing as "being good at math"?

    - by thezhaba
    Aside from gifted individuals able to perform complex calculations in their head, I'm wondering if proficiency in mathematics, namely calculus and algebra, has really got to do with one's natural inclination towards sciences, if you can put it that way. A number of students in my calculus course pick up material in seemingly no time whereas I, personally, have to spend time thinking about and understanding most concepts. Even then, if a question that requires a bit more 'imagination' comes up I don't always recognize the concepts behind it, as is the case with calculus proofs, for instance. Nevertheless, I refuse to believe that I'm simply not made for it. I do very well in programming and software engineering courses where a lot of students struggle. At first I could not grasp what they found to be so difficult, but eventually I realized that having previous programming experience is a great asset -- once I've seen and made practical use of the programming concepts learning about them in depth in an academic setting became much easier as I have then already seen their use "in the wild". I suppose I'm hoping that something similar happens with mathematics -- perhaps once the practical idea behind a concept (which authors of textbooks sure do a great job of concealing..) is evident, understanding the seemingly dry and symbolic ideas and proofs would be more obvious? I'm really not sure. All I'm sure of is I'd like to get better at calculus, but I don't yet understand why some of us pick it up easily while others have to spend considerable amounts of time on it and still not have complete understanding if an unusual problem is given.

    Read the article

  • PyGTK: Manually render an existing widget at a given Rectangle? (TextView in a custom CellRenderer)

    - by NicDumZ
    Hello! I am trying to draw a TextView into the cell of a TreeView. (Why? I would like to have custom tags on text, so they can be clickable and trigger different actions/popup menus depending on where user clicks). I have been trying to write a customized CellRenderer for this purpose, but so far I failed because I find it extremely difficult to find generic documentation on rendering design in gtk. More than an answer at the specific question (that might be hard/not doable, and I'm not expecting you to do everything for me), I am first looking for documentation on how a widget is rendered, to understand how one is supposed to implement a CellRenderer. Can you share any link that explains, either for gtk or for pygtk, the rendering mechanism? More specifically: size allocation mechanism (should I say protocol?). I understand that a window has a defined size, and then queries its children, saying "my size is w x h, what would be your ideal size, buddy?", and then sometimes shrinks children when all children cant fit together at their ideal sizes. Any specific documentation on that, and on particular on when this happens during rendering? How are rendered "builtin" widgets? What kind of methods do they call on Widget base class? On the parent Window? When? Do they use pango.Layout? can you manually draw a TextView onto a pango.Layout object? This link gives an interesting example showing how you can draw content in a pango.Layout object and use it in a CellRenderer. I guess that I could adapt it if only I understood how TextView widget are rendered. Or perhaps, to put it more simply: given an existing widget instance, how does one render it at a specific gdk.Rectangle? Thanks a lot.

    Read the article

  • WPF ObservableCollection in xaml

    - by Cloverness
    Hi, I have created an ObservableCollection in the code behind of a user control. It is created when the window loads: private void UserControl_Loaded(object sender, RoutedEventArgs e) { Entities db = new Entities(); ObservableCollection<Image> _imageCollection = new ObservableCollection<Image>(); IEnumerable<library> libraryQuery = from c in db.ElectricalLibraries select c; foreach (ElectricalLibrary c in libraryQuery) { Image finalImage = new Image(); finalImage.Width = 80; BitmapImage logo = new BitmapImage(); logo.BeginInit(); logo.UriSource = new Uri(c.url); logo.EndInit(); finalImage.Source = logo; _imageCollection.Add(finalImage); } } I need to get the ObservableCollection of images which are created based on the url saved in a database. But I need a ListView or other ItemsControl to bind to it in XAML file like this: But I can't figure it out how to pass the ObservableCollection to the ItemsSource of that control. I tried to create a class and then create an instance of a class in xaml file but it did not work. Should I create a static resource somehow Any help will be greatly appreciated.

    Read the article

  • Object Design catalog and resources

    - by Tauren
    I'm looking for web sites, books, or other resources that provide a catalog of object designs used in common scenarios. I'm not looking for generic design patterns, but for samples of actual object designs that were used to solve real problems. For instance, I'm about to build an internal messaging system for a web application, similar to Facebook's messaging system. This system will allow administrators to send messages to all members, to selected groups of members, or to individuals. Members can send messages to other members or groups of members. Fairly common stuff and a feature that I'm sure thousands of web applications require. I know each situation is different and there are a million ways to design this solution. Although this scenario isn't really all that complex, I'm sure the basic design of the necessary objects and relationships for a system like this has already been done many times. It would be nice to review other similar designs before building my own. Is there a place where people can share their designs and others can browse/search through the catalog to review and provide feedback on them? StackOverflow could be used to a degree for this, but doesn't really provide a catalog of designs. Any other resources that would relate?

    Read the article

  • Read from plist insted of Code array

    - by BoSoud
    Hi Guys am Using [URL="http://www.iphonesdkarticles.com/2009/01/uitableview-searching-table-view.html"]UITableView - Searching table view[/URL] its really nice easy tutorial but i really have bad time try to read from plist that what i did change - (void)viewDidLoad { [super viewDidLoad]; //Initialize the array. listOfItems = [[NSMutableArray alloc] init]; TableViewAppDelegate *AppDelegate = (TableViewAppDelegate *)[[UIApplication sharedApplication] delegate]; listOfItems = [AppDelegate.data objectForKey:@"Countries"]; //Initialize the copy array. copyListOfItems = [[NSMutableArray alloc] init]; //Set the title self.navigationItem.title = @"Countries"; //Add the search bar self.tableView.tableHeaderView = searchBar; searchBar.autocorrectionType = UITextAutocorrectionTypeNo; searching = NO; letUserSelectRow = YES; } and This How i read plist from My AppDelegate.m - (void)applicationDidFinishLaunching:(UIApplication *)application { NSString *Path = [[NSBundle mainBundle] bundlePath]; NSString *DataPath = [Path stringByAppendingPathComponent:@"Data.plist"]; NSDictionary *tempDict = [[NSDictionary alloc] initWithContentsOfFile:DataPath]; self.data = tempDict; [tempDict release]; // Configure and show the window [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } and this my plist <plist version="1.0"> <dict> <key>Countries</key> <array> <array> <string>USA</string> </array> <dict/> </array> </dict> </plist> and i get this error *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFArray objectForKey:]: unrecognized selector sent to instance 0x1809dc0' help please am stock with this

    Read the article

  • Linq-to-XML explicit casting in a generic method

    - by vlad
    I've looked for a similar question, but the only one that was close didn't help me in the end. I have an XML file that looks like this: <Fields> <Field name="abc" value="2011-01-01" /> <Field name="xyz" value="" /> <Field name="tuv" value="123.456" /> </Fields> I'm trying to use Linq-to-XML to get the values from these fields. The values can be of type Decimal, DateTime, String and Int32. I was able to get the fields one by one using a relatively simple query. For example, I'm getting the 'value' from the field with the name 'abc' using the following: private DateTime GetValueFromAttribute(IEnumerable<XElement> fields, String attName) { return (from field in fields where field.Attribute("name").Value == "abc" select (DateTime)field.Attribute("value")).FirstOrDefault() } this is placed in a separate function that simply returns this value, and everything works fine (since I know that there is only one element with the name attribute set to 'abc'). however, since I have to do this for decimals and integers and dates, I was wondering if I can make a generic function that works in all cases. this is where I got stuck. here's what I have so far: private T GetValueFromAttribute<T>(IEnumerable<XElement> fields, String attName) { return (from field in fields where field.Attribute("name").Value == attName select (T)field.Attribute("value").Value).FirstOrDefault(); } this doesn't compile because it doesn't know how to convert from String to T. I tried boxing and unboxing (i.e. select (T) (Object) field.Attribute("value").Value but that throws a runtime Specified cast is not valid exception as it's trying to convert the String to a DateTime, for instance. Is this possible in a generic function? can I put a constraint on the generic function to make it work? or do I have to have separate functions to take advantage of Linq-to-XML's explicit cast operators?

    Read the article

  • Working with PHP and MySQL - need a good and secure design with OO design

    - by Andrew
    I am new to PHP- first time developer. I am working on my web application and it is nearly done; nevertheless, most of my sql was done directly via code using direct mysql requests. This is the way I approached it: In classes_db.php I declared the db settings and created methods that I use to open and close DB connections. I declare those objects on my regular pages: class classes_db { public $dbserver = 'server; public $dbusername = 'user'; public $dbpassword = 'pass'; public $dbname = 'db'; function openDb() { $dbhandle = mysql_connect($this->dbserver, $this->dbusername, $this->dbpassword); if (!$dbhandle) { die('Could not connect: ' . mysql_error()); } $selected = mysql_select_db($this->dbname, $dbhandle) or die("Could not select the database"); return $dbhandle; } function closeDb($con) { mysql_close($con); } } On my regular page, I do this: <?php require 'classes_db.php'; session_start(); //create instance of the DB class $db = new classes_db(); //get dbhandle $dbhandle = $db->openDb(); //process query $result = mysql_query("update user set username = '" . $usernameFromForm . "' where iduser= " . $_SESSION['user']->iduser); //close the connection if (isset($dbhandle)) { $db->closeDb($dbhandle); } ?> My questions is: how to do it right and make it OO and secure? I know that I need incorporate prepared queries- how to do it the best way? Please provide some code

    Read the article

  • How to check at runtime if a class implements certain interface?

    - by mare
    Let's say I have some content classes like Page, TabGroup, Tab, etc. Certain of those will be implementing my IWidgetContainer interface - it means they will geet an additional field named ContainedItems from the interface and some methods for manipulating this field. Now I need to reflect the fact that some class implements this interface by rendering out some special custom controls in my ASP.NET MVC Views (like jQuery Add/Remove/Move/Reorder buttons). For instance, TabGroup will implement IWidgetContainer because it will contain tabs but a tab will not implement it because it won't have the ability to contain anything. So I have to somehow check in my view, when I render my content objects (The problem is, I use my base class as strong type in my view not concrete classes), whether it implements IWidgetContainer. How is that possible or have I completely missed something? To rephrase the question, how do you reflect some special properties of a class (like interface implementation) in the UI in general (not necessarily ASP.NET MVC)? Here's my code so far: [DataContract] public class ContentClass { [DataMember] public string Slug; [DataMember] public string Title; [DataMember] protected ContentType Type; } [DataContract] public class Group : ContentClass, IWidgetContainer { public Group() { Type = ContentType.TabGroup; } public ContentList ContainedItems { get; set; } public void AddContent(ContentListItem toAdd) { throw new NotImplementedException(); } public void RemoveContent(ContentListItem toRemove) { throw new NotImplementedException(); } } [DataContract] public class GroupElement : ContentClass { public GroupElement() { Type = ContentType.Tab; } } Interface: interface IWidgetContainer { [DataMember] ContentList ContainedItems { get; set; } void AddContent(ContentListItem toAdd); void RemoveContent(ContentListItem toRemove); }

    Read the article

  • Sql Server Replication: Snapshot vs Merge

    - by Zyphrax
    Background information Let's say I have two database servers, both SQL Server 2008. One is in my LAN (ServerLocal), the other one is on a remote hosting environment (ServerRemote). I have created a database on ServerLocal and have an exact copy of that database on ServerRemote. The database on ServerRemote is part of a web application and I would like to keep it's data up-to-date with the data in the database ServerLocal. ServerLocal is able to communicate with ServerRemote, this is one-way traffic. Communication from ServerRemote to ServerLocal isn't available. Current solution I thought it would be a nice solution to use replication. So I've made ServerLocal a publisher and subscriptions are pushed to the ServerRemote. This works fine, when a snapshot is transfered to ServerRemote the existing data will be purged and the ServerRemote database is once again an exact replica of the database on ServerLocal. The problem Records that exist on ServerRemote that don't exist on ServerLocal are removed. This doesn't matter for most of my tables but in some of my tables I'd like to keep the existing data (aspnet_users for instance), and update the records if necessary. What kind of replication fits my problem?

    Read the article

  • Automatically creating DynaActionForms in Mockrunner via struts-config.xml

    - by T Reddy
    I'm switching from MockStrutsTestCase to Mockrunner and I'm finding that having to manually re-create all of my DynaActionForms in Mockrunner is a pain...there has to be an easier way?! Can somebody offer a tip to simplify this process? For instance, this form bean definition in struts-config.xml: <form-bean name="myForm" type="org.apache.struts.action.DynaActionForm"> <form-property name="property" type="java.lang.String"/> </form-bean> results in this code in Mockrunner: //define form config FormBeanConfig config = new FormBeanConfig(); config.setName("myForm"); config.setType(DynaActionForm.class.getName()); FormPropertyConfig property = new FormPropertyConfig(); property.setName("property"); property.setType("java.lang.String"); config.addFormPropertyConfig(property); //create mockrunner objects ActionMockObjectFactory factory = new ActionMockObjectFactory(); ActionTestModule module = new ActionTestModule(factory); DynaActionForm form = module.createDynaActionForm(config); Now imagine that I have dozens of DynaActionForms with dozens of attributes...that stinks!

    Read the article

  • how to add multiple filters to pagination?

    - by ClarkSKent
    Hey, I am trying to allow multiple filters to be selected for my pagination script. So in my pagination, when a user clicks the 'marketing' button(link) it queries the database just for the category that = marketing. The same goes for the other 2 filter buttons as seen in the script below. (automotive, sports). The problem is, I want to be able to select multiple filters like only marketing and auomotive or automotive and sports, for example if I click the marketing filter and then the automotive, it would display the categories that equal marketing, and automotive. I have no idea how to accomplish this, so I have come to the experts to help me out. This is the script I am working on (I am very new to PHP and programming in general): <h3>Filter results by:</h3> <a href='pagi_test.php?category=marketing'>marketing</a> <a href='pagi_test.php?category=automotive'>automotive</a> <a href='pagi_test.php?category=sports'>sports</a> <br /> <h3>Results:</h3> <?php //connecting to the database $error = "Could not connect to the database"; mysql_connect('localhost','root','root') or die($error); mysql_select_db('ajax_demo') or die($error); //max displayed per page $per_page = 3; //get start variable $start = $_GET['start']; $category = mysql_real_escape_string($_GET['category']); //count records $record_count = mysql_num_rows(mysql_query("SELECT * FROM explore WHERE category='$category'")); //count max pages $max_pages = $record_count / $per_page; //may come out as decimal if (!$start) $start = 0; //display data $get = mysql_query("SELECT * FROM explore WHERE category='$category' LIMIT $start, $per_page"); ?> <table width="800px"> <?php while ($row = mysql_fetch_assoc($get)) { // get data $id = $row['id']; $site_name = $row['site_name']; $site_description = $row['site_description']; ?> <tr> <td><?php echo $id; ?></td> <td><?php echo $site_name; ?></td> <td><?php echo $site_description; ?></td> </tr> <?php } //setup prev and next variables $prev = $start - $per_page; $next = $start + $per_page; //show prev button if (!($start<=0)) echo "<a href='pagi_test.php?category=$category&start=$prev'>Prev</a> "; //show page numbers //set variable for first page $i=1; for ($x=0;$x<$record_count;$x=$x+$per_page) { if ($start!=$x) echo " <a href='pagi_test.php?category=$category&start=$x'>$i</a> "; else echo " <a href='pagi_test.php?category=$category&start=$x'><b>$i</b></a> "; $i++; } //show next button if (!($start>=$record_count-$per_page)) echo " <a href='pagi_test.php?category=$category&start=$next'>Next</a>"; ?>

    Read the article

  • jquery tabbed interface breaks when using images

    - by Steve
    hello all, using jquery to create a tabbed interface. coding is quite typical: html: <div id="tabbed-interface"> <ul> <li><a href="#option1">Option1</a></li> <li><a href="#option2">Option2</a></li> <li><a href="#option3">Option3</a></li> </ul> </div> jquery: $(document).ready(function(){ $('#tabbed-interface li:first').addClass('active'); $('#tabbed-interface div').not(':first').hide(); $('#tabbed-interface>ul>li>a').click(function(event){ $('#tabbed-interface>ul>li').removeClass('active'); $(event.target).parent().addClass('active'); $('#tabbed-interface>div').fadeOut().filter(this.hash).fadeIn(250); return false;});}); css: ul li {background: #232323; list-style: none; border: 1px solid #616161; } ul li.active {background: none; list-style: none; border: 1px solid: #616161; border-bottom: 1px solid #121212; z-index: 1; } as you can see, all this does is add the class 'active' to the li that is clicked, and this corresponds to whether a background is shown or not. this works perfectly with text, but i am required to use non standard fonts. when i try to side step the issue using transparent .png images, it is unreliable. For instance, changing the HTML to: <div id="tabbed-interface"> <ul> <li><a href="#option1"><img src="option1.png" /></a></li>

    Read the article

  • What changed in the DataGrid that means it won't work anymore?

    - by Jeff Yates
    I have a Silverlight app with a DataGrid containing some custom columns and all was working well. Then I updated to Silverlight 3 tools for VS 2008 SP1 and rebuilt it. Now it has the following problems: Rows aren't added when the collection is modified. The ItemsSource property is (and always has been) set to an ObservableCollection instance, which notifies when its contents change. This worked fine for Silverlight 2. However, in Silverlight 3 to get this working at all, I now have to null and then re-set ItemsSource - this seems like I'm hiding a bigger issue but I can't work out what that might be. I cannot select a row or a cell anymore. If I'm lucky, I can select one whole row before it stops working. I can't edit anything. I suspect this is related to the previous point. I'll post some source when I am able, but first I have to strip it down to the bare minimum. In the meantime, I was hoping someone might have some idea of what may be going on here. My gut feeling on the second two points is that my bindings are no longer working, but that's just a guess and if it is the case, I have no idea which ones. Thanks for any help anyone might be able to provide. Update So, I finally reduced my problem down to a simple works/doesn't work comparison. The problem seems to occur if I override Equals in my element type. As soon as I do that, something happens strangely in the ObservableCollection that contains that type, it seems, and my application breaks. To make it more interesting, there is a check to make sure that duplicate items don't even get close to being added to the collection. I don't exactly know why ObservableCollection needs to compare equality when inserting items (the stack trace indicates it is using IndexAt) but this seems to cause the issue. So, any thoughts?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Java program using a class from a JAR file

    - by Myn
    Hi guys, I'll try to phrase this as best I can. I have a program which has an API-like functionality - it uses reflection to dynamically call methods from within a class. In this instance: Server.java public static void main(String[] args) { Class<?> clazz = Class.forName("DiHandler"); StHandler out = (StHandler) clazz; out.read(); DiHandler.java // implements StHandler import edu.ds.*; public void read() { Ds aType = new Ds(); aType = "134"; } So DiHandler has a method read() which can contain anything, it doesn't matter to Server.java after compile time. My problem is: DiHandler.java uses the class Ds from a JAR file. When I'm working on DiHandler.java in Eclipse (in a separate project from the project Server.java is in) I can add this JAR without a problem. But when I move DiHandler.class, after it's compiled, to be used by Server.class, how can it still use the JAR file? I hope this makes some sense, I suppose another way to phrase it would be how can I allow DiHandler to call on a class from the JAR without editing the classpath? Thanks very much in advance and sorry for any confusion or poor phrasing, I can only offer thanks and the customary offer of a pint for any assistance. M

    Read the article

  • How to select table column names in a view and pass to controller in rails?

    - by zachd1_618
    So I am new to Rails, and OO programming in general. I have some grasp of the MVC architecture. My goal is to make a (nearly) completely dynamic plug-and-play plotting web server. I am fairly confused with params, forms, and select helpers. What I want to do is use Rails drop downs to basically pass parameters as strings to my controller, which will use the params to select certain column data from my database and plot it dynamically. I have the latter part of the task working, but I can't seem to pass values from my view to controller. For simplicity's sake, say my database schema looks like this: --------------Plot--------------- |____x____|____y1____|____y2____| | 1 | 1 | 1 | | 2 | 2 | 4 | | 3 | 3 | 9 | | 4 | 4 | 16 | | 5 | 5 | 25 | ... and in my Model, I have dynamic selector scopes that will let me select just certain columns of data: in Plot.rb class Plot < ActiveRecord::Base scope :select_var, lambda {|varname| select(varname)} scope :between_x, lambda {|x1,x2| where("x BETWEEN ? and ?","#{x1}","#{x2}")} So this way, I can call: irb>>@p1 = Plot.select_var(['x','y1']).between_x(1,3) and get in return a class where @p1.x and @p1.y1 are my only attributes, only for values between x=1 to x=4, which I dynamically plot. I want to start off in a view (plot/index), where I can dynamically select which variable names (table column names), and which rows from the database to fetch and plot. The problem is, most select helpers don't seem to work with columns in the database, only rows. So to select columns, I first get an array of column names that exist in my database with a function I wrote. Plots Controller def index d=Plot.first @tags = d.list_vars end So @tags = ['x','y1','y2'] Then in my plot/index.html.erb I try to use a drop down to select wich variables I send back to the controller. index.html.erb <%= select_tag( :variable, options_for_select(@plots.first.list_vars,:name,:multiple=>:true) )%> <%= button_to 'Plot now!', :controller =>"plots/plot_vars", :variable => params[:variable]%> Finally, in the controller again Plots controller ... def plot_vars @plot_data=Plot.select_vars([params[:variable]]) end The problem is everytime I try this (or one of a hundred variations thereof), the params[:variable] is nill. How can I use a drop down to pass a parameter with string variable names to the controller? Sorry its so long, I have been struggling with this for about a month now. :-( I think my biggest problem is that this setup doesn't really match the Rails architecture. I don't have "users" and "articles" as individual entities. I really have a data structure, not a data object. Trying to work with the structure in terms of data object speak is not necessarily the easiest thing to do I think. For background: My actual database has about 250 columns and a couple million rows, and they get changed and modified from time to time. I know I can make the database smarter, but its not worth it on my end. I work at a scientific institute where there are a ton of projects with databases just like this. Each one has a web developer that spends months setting up a web interface and their own janky plotting setups. I want to make this completely dynamic, as a plug-and-play solution so all you have to do is specify your database connection, and this rails setup will automatically show and plot which data you want in it. I am more of a sequential programmer and number cruncher, as are many people here. I think this project could be very helpful in the end, but its difficult to figure out for me right now.

    Read the article

  • How to handle window closed in the middle of a long running operation gracefully?

    - by Marek
    We have the following method called directly from the UI thread: void DoLengthyProcessing() { DoStuff(); var items = DoMoreStuff(); //do even more stuff - 200 lines of code trimmed this.someControl.PrepareForBigThing(); //someControl is a big user control //additional 100 lines of code that access this.someControl this.someControl.Finish(items); } Many of the called methods call Application.DoEvents() (and they do so many times) (do not ask me why, this is black magic written by black magic programmers and it can not be changed because everyone is scared what the impact would be) and there is also an operation running on a background thread involved in the processing. As a result, the window is not fully nonresponsive and can be closed manually during the processing. The Dispose method of the form "releases" the someControl variable by setting it to null. As a result, in case the user closes the window during the lengthy process, a null reference exception is thrown. How to handle this gracefully without just catching and logging the exception caused by disposal? Assigning the someControl instance to a temporary variable in the beginning of the method - but the control contains many subcontrols with similar disposal scheme - sets them to null and this causes null reference exceptions in other place put if (this.IsDisposed) return; calls before every access of the someControl variable. - making the already nasty long method even longer and unreadable. in Closing event, just indicate that we should close and only hide the window. Dispose it at the end of the lengthy operation. This is not very viable because there are many other methods involved (think 20K LOC for a single control) that would need to handle this mechanism as well. How to most effectively handle window disposal (by user action) in the middle of this kind of processing?

    Read the article

  • CREATE VIEW called multiple times not creating all views

    - by theninepoundhammer
    Noticing strange behavior in SQL 2005, both Express and Enterprise Edition: In my code I need to loop through a series of values (about five in a row), and for each value, I need to insert the value into a table and dynamically create a new view using that value as part of the where clause and the name of the view. The code runs pretty quickly, but what I'm noticing is that all the values are inserted into the table correctly but only the LAST view is being created. Every time. For example, if the values I'm using are X1, X2, X3, X4, and X5, I'll run the process, open up Mgmt Studio, and see five rows in the table with the correct five values, but only one view named MyView_x5 that has the correct WHERE clause. At first, I had this loop in an SSIS package as part of a larger data flow. When I started noticing this behavior, I created a stored proc that would create the CREATE VIEW statement dynamically after the insert and called EXECUTE to create the view. Same result. Finally, I created some C# code using the Enterprise Library DAAB, and did the insert and CREATE VIEW statements from my DLL. Same result every time. Most recently, I turned on Profiler while running against the Enterprise Edition and was able to verify that the Batch Started and Batch Completed events were being fired off for each instance of the view. However, like I said, only the last view is actually being created. Does anyone have any idea why this might be happening? Or any suggestions about what else to check or profile? I've profiled for error messages, exceptions, etc. but don't see any in my trace file. My express edition is 9.00.1399.06. Not sure about the Enterprise edition but think it is SP2.

    Read the article

  • Java: Typecasting to Generics

    - by bguiz
    This method that uses method-level generics, that parses the values from a custom POJO, JXlistOfKeyValuePairs (which is exactly that). The only thing is that both the keys and values in JXlistOfKeyValuePairs are Strings. This method wants to taken in, in addition to the JXlistOfKeyValuePairs instance, a Class<T> that defines which data type to convert the values to (assume that only Boolean, Integer and Float are possible). It then outputs a HashMap with the specified type for the values in its entries. This is the code that I have got, and it is obviously broken. private <T extends Object> Map<String, T> fromListOfKeyValuePairs(JXlistOfKeyValuePairs jxval, Class<T> clasz) { Map<String, T> val = new HashMap<String, T>(); List<Entry> jxents = jxval.getEntry(); T value; String str; for (Entry jxent : jxents) { str = jxent.getValue(); value = null; if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } else if (clasz.isAssignableFrom(Float.class)) { value = (T)(Float.parseFloat(str)); } else { logger.warn("Unsupported value type encountered in key-value pairs, continuing anyway: " + clasz.getName()); } val.put(jxent.getKey(), value); } return val; } This is the bit that I want to solve: if (clasz.isAssignableFrom(Boolean.class)) { value = (T)(Boolean.parseBoolean(str)); } else if (clasz.isAssignableFrom(Integer.class)) { value = (T)(Integer.parseInt(str)); } I get: Inconvertible types required: T found: Boolean Also, if possible, I would like to be able to do this with more elegant code, avoiding Class#isAssignableFrom. Any suggestions? Sample method invocation: Map<String, Boolean> foo = fromListOfKeyValuePairs(bar, Boolean.class);

    Read the article

  • `enable_shared_from_this` has a non-virtual destructor

    - by Shtééf
    I have a pet project with which I experiment with new features of the upcoming C++0x standard. While I have experience with C, I'm fairly new to C++. To train myself into best practices, (besides reading a lot), I have enabled some strict compiler parameters (using GCC 4.4.1): -std=c++0x -Werror -Wall -Winline -Weffc++ -pedantic-errors This has worked fine for me. Until now, I have been able to resolve all obstacles. However, I have a need for enable_shared_from_this, and this is causing me problems. I get the following warning (error, in my case) when compiling my code (probably triggered by -Weffc++): base class ‘class std::enable_shared_from_this<Package>’ has a non-virtual destructor So basically, I'm a bit bugged by this implementation of enable_shared_from_this, because: A destructor of a class that is intended for subclassing should always be virtual, IMHO. The destructor is empty, why have it at all? I can't imagine anyone would want to delete their instance by reference to enable_shared_from_this. But I'm looking for ways to deal with this, so my question is really, is there a proper way to deal with this? And: am I correct in thinking that this destructor is bogus, or is there a real purpose to it?

    Read the article

< Previous Page | 701 702 703 704 705 706 707 708 709 710 711 712  | Next Page >