Search Results

Search found 19212 results on 769 pages for 'side projects'.

Page 720/769 | < Previous Page | 716 717 718 719 720 721 722 723 724 725 726 727  | Next Page >

• css coding on Myspace - Problem

  - by Frederik Wessberg

  Hey Folks. I've read what I could, and I'm certainly no master, but I'm fixing up a colleagues profile on myspace.com, and im working with 2 divs in each side of the screen, and I want them to align so that they are next to each other. I've tried float: left; and float: right;, and I've tried margin: right; on div 1 and such. Could you help? Here's the site: http://www.myspace.com/jonasjohansen This is info for div1: <div class="textBox" align="left" style="width: 290px; word-wrap:break-word"> <span class="orangetext15"> BANDS </span> <b>MOVE</b><br /> Fredrik ....balbalbalbla </div> <style> .textBox { position: relative; left:-320px; top:0px; width: 290px; height: 350px; overflow-y: visible; overflow-x: visible; top: YYYpx; z-index: 3; background-color: transparent; border:none; } </style> This is info for div2: <style>.i {display:none;}{!-eliminate bio header!-}table table td.text table td.text {display:none;}{!-recover in shows and friends-!}table table td.text div table td.text,table table td.text table.friendSpace td.text {display:inline;}{! move up our custom section. You may change px value !}div.myDivR {position:relative; top:0px; margin-bottom:-300px; }{! you can apply style to the custom div !}div.myDivR {background-color:white; border:2px solid; border-color:darkgreen; float: right;}</style></td></tr></table></td></tr></table><span class="off">Re-Open Bio Table give it our own Class </span><table class="myBio" style="width:435px;"><tr><i class="i"></i><td class="myBioHead" valign="center" align="left" width="auto" bgcolor="ffcc99" height="17"> &nbsp;&nbsp;<span class="orangetext15"> ABOUT JONAS JOHANSEN</span> </td></tr><tr><td><table class="myBioI"><tr><td><span class="off"></span> blalbalbalbalbla <span class="off">END Bio Content </span>

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

  - by dommer

  I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

  Read the article

• Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

  - by Vatsala

  Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

  Read the article

• How to reduce redundant code when adding new c++0x rvalue reference operator overloads

  - by Inverse

  I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

  Read the article

• Where are the function literals in c++?

  - by academicRobot

  First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

  Read the article

• How do I do distributed UML development (à la FOSS)?

  - by James A. Rosen

  I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

  Read the article

• Is this BlockingQueue susceptible to deadlock?

  - by unforgiven3

  I've been using this code as a queue that blocks on Dequeue() until an element is enqueued. I've used this code for a few years now in several projects, all with no issues... until now. I'm seeing a deadlock in some code I'm writing now, and in investigating the problem, my 'eye of suspicion' has settled on this BlockingQueue<T>. I can't prove it, so I figured I'd ask some people smarter than me to review it for potential issues. Can you guys see anything that might cause a deadlock in this code? public class BlockingQueue<T> { private readonly Queue<T> _queue; private readonly ManualResetEvent _event; /// <summary> /// Constructor /// </summary> public BlockingQueue() { _queue = new Queue<T>(); _event = new ManualResetEvent(false); } /// <summary> /// Read-only property to get the size of the queue /// </summary> public int Size { get { int count; lock (_queue) { count = _queue.Count; } return count; } } /// <summary> /// Enqueues element on the queue /// </summary> /// <param name="element">Element to enqueue</param> public void Enqueue(T element) { lock (_queue) { _queue.Enqueue(element); _event.Set(); } } /// <summary> /// Dequeues an element from the queue /// </summary> /// <returns>Dequeued element</returns> public T Dequeue() { T element; while (true) { if (Size == 0) { _event.Reset(); _event.WaitOne(); } lock (_queue) { if (_queue.Count == 0) continue; element = _queue.Dequeue(); break; } } return element; } /// <summary> /// Clears the queue /// </summary> public void Clear() { lock (_queue) { _queue.Clear(); } } }

  Read the article

• Working with friends. Poor career choice?

  - by a_person

  Hi all, Hope you can help me solve somewhat of a moral dilemma. Some time ago, after just a few years of living in U.S. and having to take any job I could get my hands on a friend of mine submitted recommended me for an open position at the company that he was working for. I could have not been happier. I do not have a degree of any sort, however, by being passionate about CS and with constant drive for self education I've became a somewhat of a strong generalist. Every place I worked for recognized me for that quality and used me on various projects where set of technology in hand had no overlap with set of knowledge of the team members. Rapidly I've advanced to Sr. Programmer position and the trend of me following a friend from one place to another have started and continued on for a few years. My friend's goal always been to become an IT Director, mine is to become the best programmer I can be. To my knowledge I've accommodated his goals as much as I could by taking a back seat, and letting him take the lead. Fast forward to today. He's a manager, and I am on his team. I am unhappy and I in considerable amount of suffering. I am not being utilized to my potential, it's almost exact opposite, I am being micromanaged to an unhealthy extent, my decisions, and suggestions are constantly met with negative connotation. Last week I had to hear about how my friend is a better programmer than I am. My ego was ecstatic about this one /s. In addition to that working in the field of BI have exhausted itself for most parts. The only pleasure of my work is being derived from making everything as dynamic and parameter driven as possible. This is the only area where a friend of mine does not feel competent enough to actually micromanage. Because of my situation I feel a fair amount of guilt and ever growing resentment. I need your advice, maybe you've dealt with this expression of ego before, needs of self vs the needs of your friend. Is working with a friend a poor choice? Thank you for reading in.

  Read the article

• compressed archive with quick access to individual file

  - by eric.frederich

  I need to come up with a file format for new application I am writing. This file will need to hold a bunch other text files which are mostly text but can be other formats as well. Naturally, a compressed tar file seems to fit the bill. The problem is that I want to be able to retrieve some data from the file very quickly and getting just a particular file from a tar.gz file seems to take longer than it should. I am assumeing that this is because it has to decompress the entire file even though I just want one. When I have just a regular uncompressed tar file I can get that data real quick. Lets say the file I need quickly is called data.dat For example the command... tar -x data.dat -zf myfile.tar.gz ... is what takes a lot longer than I'd like. MP3 files have id3 data and jpeg files have exif data that can be read in quickly without opening the entire file. I would like my data.dat file to be available in a similar way. I was thinking that I could leave it uncompressed and seperate from the rest of the files in myfile.tar.gz I could then create a tar file of data.dat and myfile.tar.gz and then hopefully that data would be able to be retrieved faster because it is at the head of outer tar file and is uncompressed. Does this sound right?... putting a compressed tar inside of a tar file? Basically, my need is to have an archive type of file with quick access to one particular file. Tar does this just fine, but I'd also like to have that data compressed and as soon as I do that, I no longer have quick access. Are there other archive formats that will give me that quick access I need? As a side note, this application will be written in Python. If the solution calls for a re-invention of the wheel with my own binary format I am familiar with C and would have no problem writing the Python module in C. Idealy I'd just use tar, dd, cat, gzip, etc though. Thanks, ~Eric

  Read the article

• How to implement a caching model without violating MVC pattern?

  - by RPM1984

  Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

  Read the article

• What are the pros and cons of using manual list iteration vs recursion through fail

  - by magus

  I come up against this all the time, and I'm never sure which way to attack it. Below are two methods for processing some season facts. What I'm trying to work out is whether to use method 1 or 2, and what are the pros and cons of each, especially large amounts of facts. methodone seems wasteful since the facts are available, why bother building a list of them (especially a large list). This must have memory implications too if the list is large enough ? And it doesn't take advantage of Prolog's natural backtracking feature. methodtwo takes advantage of backtracking to do the recursion for me, and I would guess would be much more memory efficient, but is it good programming practice generally to do this? It's arguably uglier to follow, and might there be any other side effects? One problem I can see is that each time fail is called, we lose the ability to pass anything back to the calling predicate, eg. if it was methodtwo(SeasonResults), since we continually fail the predicate on purpose. So methodtwo would need to assert facts to store state. Presumably(?) method 2 would be faster as it has no (large) list processing to do? I could imagine that if I had a list, then methodone would be the way to go.. or is that always true? Might it make sense in any conditions to assert the list to facts using methodone then process them using method two? Complete madness? But then again, I read that asserting facts is a very 'expensive' business, so list handling might be the way to go, even for large lists? Any thoughts? Or is it sometimes better to use one and not the other, depending on (what) situation? eg. for memory optimisation, use method 2, including asserting facts and, for speed use method 1? season(spring). season(summer). season(autumn). season(winter). % Season handling showseason(Season) :- atom_length(Season, LenSeason), write('Season Length is '), write(LenSeason), nl. % ------------------------------------------------------------- % Method 1 - Findall facts/iterate through the list and process each %-------------------------------------------------------------- % Iterate manually through a season list lenseason([]). lenseason([Season|MoreSeasons]) :- showseason(Season), lenseason(MoreSeasons). % Findall to build a list then iterate until all done methodone :- findall(Season, season(Season), AllSeasons), lenseason(AllSeasons), write('Done'). % ------------------------------------------------------------- % Method 2 - Use fail to force recursion %-------------------------------------------------------------- methodtwo :- % Get one season and show it season(Season), showseason(Season), % Force prolog to backtrack to find another season fail. % No more seasons, we have finished methodtwo :- write('Done').

  Read the article

• Getting rid of "static" references in C#

  - by DevEight

  Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

  Read the article

• boost.asio error on read from socket.

  - by niXman

  The following code of the client: typedef boost::array<char, 10> header_packet; header_packet header; boost::system::error_code error; ... /** send header */ boost::asio::write( _socket, boost::asio::buffer(header, header.size()), boost::asio::transfer_all(), error ); /** send body */ boost::asio::write( _socket, boost::asio::buffer(buffer, buffer.length()), boost::asio::transfer_all(), error ); of the server: struct header { boost::uint32_t header_length; boost::uint32_t id; boost::uint32_t body_length; }; static header unpack_header(const header_packet& data) { header hdr; sscanf(data.data(), "%02d%04d%04d", &hdr.header_length, &hdr.id, &hdr.body_length); return hdr; } void connection::start() { boost::asio::async_read( _socket, boost::asio::buffer(_header, _header.size()), boost::bind( &connection::read_header_handler, shared_from_this(), boost::asio::placeholders::error ) ); } /***************************************************************************/ void connection::read_header_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed header: " << _header.c_array() << std::endl; std::cout << constants::unpack_header(_header); boost::asio::async_read( _socket, boost::asio::buffer(_body, constants::unpack_header(_header).body_length), boost::bind( &connection::read_body_handler, shared_from_this(), boost::asio::placeholders::error ) ); } else { /** report error */ std::cout << "read header finished with error: " << e.message() << std::endl; } } /***************************************************************************/ void connection::read_body_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed body: " << _body.c_array() << std::endl; start(); } else { /** report error */ std::cout << "read body finished with error: " << e.message() << std::endl; } } On the server side the method read_header_handler() is called, but the method read_body_handler() is never called. Though the client has written down the data in a socket. The header is readed and decoded successfully. What's the error?

  Read the article

• ADO Exception in HQL query

  - by Yoav

  I have 2 classes: Project and DataStructure. Class Project contains member List<DataStructure. My goal is to load a Project and all its DataStructures in one call. public class Project { public virtual string Id { get { } set { } } public virtual string Name { get { } set { } } public virtual ISet<DataStructure> DataStructures { get { } set { } } } public class DataStructure { public virtual string Id { get { } set { } } public virtual string Name { get { } set { } } public virtual string Description { get { } set { } } public virtual Project Project { get { } set { } } public virtual IList<DataField> Fields { get { } set { } } } Note that DataStructure also contains a list of class DataField but I don’t want to load these right now. Mapping in Fluent NHibernate: public class ProjectMap : ClassMap<Project> { public ProjectMap() { Table("PROJECTS"); Id(x => x.Pk, "PK"); Map(x => x.Id, "ID"); Map(x => x.Name, "NAME"); HasMany<DataStructure>(x => x.DataStructures).KeyColumn("FK_PROJECT"); } } public class DataStructureMap : ClassMap<DataStructure> { public DataStructureMap() { Table("DATA_STRUCTURES"); Map(x => x.Id, "ID"); Map(x => x.Name, "NAME"); Map(x => x.Description, "DESCRIPTION"); References<Project>(x => x.Project, "FK_PROJECT"); HasMany<DataField>(x => x.Fields).KeyColumn("FK_DATA_STRUCTURE"); } } This is my query: using (ISession session = SessionFactory.OpenSession()) { IQuery query = session.CreateQuery("from Project pr left join pr.DataStructure"); project = query.List<Project>(); } query.List() returns this exception: NHibernate.Exceptions.GenericADOException: Could not execute query[SQL: SQL not available] ---> System.ArgumentException: The value "System.Object[]" is not of type "Project" and cannot be used in this generic collection.

  Read the article

• jQuery UI dialog + WebKit + HTML response with script

  - by Anthony Koval'

  Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

  Read the article

• Strategies for "Always-Connected" Windows Client Data Architecture

  - by magz2010

  Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

  Read the article

• Is a Multi-DAL Approach the way to go here?

  - by Krisc

  Working on the data access / model layer in this little MVC2 project and trying to think things out to future projects. I have a database with some basic tables and I have classes in the model layer that represent them. I obviously need something to connect the two. The easiest is to provide some sort of 'provider' that can run operations on the database and return objects. But this is for a website that would potentially be used "a lot" (I know, very general) so I want to cache results from the data layer and keep the cache updated as new data is generated. This question deals with how best to approach this problem of dual DALS. One that returns cached data when possible and goes to the data layer when there is a cache miss. But more importantly, how to integrate the core provider (thing that goes into database) with the caching layer so that it too can rely on cached objects rather than creating new ones. Right now I have the following interfaces: IDataProvider is used to reach the database. It doesn't concern itself with the meaning of the objects it produces, but simply the way to produce them. interface IDataProvider{ // Select, Update, Create, et cetera access IEnumerable<Entry> GetEntries(); Entry GetEntryById(int id); } IDataManager is a layer that sits on top of the IDataProvider layer and manages the cache interface IDataManager : IDataProvider{ void ClearCache(); } Note that in practice the IDataManager implementation will have useful helper functions to add objects to their related cache stores. (In the future I may define other functions on the interface) I guess what I am looking for is the best way to approach a loop back from the IDataProvider implementations so that they can access the cache. Or a different approach entirely may be in order? I am not very interested in 3rd party products at the moment as I am interested in the design of these things much more than this specific implementation. Edit: I realize the title may be a bit misleading. I apologize for that... not sure what to call this question.

  Read the article

• Template function as a template argument

  - by Kos

  I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

  Read the article

• Creating multiple heads in remote repository

  - by Jab

  We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

  Read the article

• SQL Invalid Object Name 'AddressType'

  - by salvationishere

  I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

  Read the article

• NHibernate unable to create SessionFactory

  - by Tyler

  I'm having a bit of trouble setting up NHibernate, and I'm not too sure what the problem is exactly. I'm attempting to save a domain object to the database (Oracle 10g XE). However, I'm getting a TypeInitializationException while trying to create the ISessionFactory. Here is what my hibernate.cfg.xml looks like: <?xml version="1.0" encoding="utf-8"?> <hibernate-configuration xmlns="urn:nhibernate-configuration-2.2" > <session-factory name="MyProject.DataAccess"> <property name="connection.driver_class">NHibernate.Driver.OracleClientDriver</property> <property name="connection.connection_string"> User ID=myid;Password=mypassword;Data Source=localhost </property> <property name="show_sql">true</property> <property name="dialect">NHibernate.Dialect.OracleDialect</property> <property name="proxyfactory.factory_class">NHibernate.ByteCode.LinFu.ProxyFactoryFactory, NHibernate.ByteCode.LinFu</property> <mapping resource="MyProject/Domain/User.hbm.xml"/> </session-factory> </hibernate-configuration> I created a DAO which I will use to persist domain objects to the database. The DAO uses a HibernateUtil class that creates the SessionFactory. Both classes are in the DataAccess namespace along with the Hibernate configuration. This is where the exception is occuring. Here's that class: public class HibernateUtil { private static ISessionFactory SessionFactory = BuildSessionFactory(); private static ISessionFactory BuildSessionFactory() { try { // This seems to be where the problem occurs return new Configuration().Configure().BuildSessionFactory(); } catch (TypeInitializationException ex) { Console.WriteLine("Initial SessionFactory creation failed." + ex); throw new Exception("Unable to create SessionFactory."); } } public static ISessionFactory GetSessionFactory() { return SessionFactory; } } The DataAccess namespace references the NHibernate DLLs. This is virtually the same setup I've used with Hibernate in Java, so I'm not entirely sure what I'm doing wrong here. Any ideas? Edit The innermost exception is the following: "Could not find file 'C:\Users\Tyler\Documents\Visual Studio 2010\Projects\MyProject\MyProject\ConsoleApplication\bin\Debug\hibernate.cfg.xml'." ConsoleApplication contains the entry point where I've created a User object and am trying to persist it with my DAO. Why is it looking for the configuration file there? The actual persisting takes place in the DAO, which is in DataAccess. Also, when I add the configuration file to ConsoleApplication, it still does not find it.

  Read the article

• Maximum nametable char count exceeded

  - by doc

  I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

  Read the article

• Define Javascript slider hit/rollover area

  - by Rob

  Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

  Read the article

• Simple html page using Bootstrap

  - by Athashri

  I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

  Read the article

< Previous Page | 716 717 718 719 720 721 722 723 724 725 726 727  | Next Page >