Search Results

Search found 49554 results on 1983 pages for 'database users'.

Page 736/1983 | < Previous Page | 732 733 734 735 736 737 738 739 740 741 742 743  | Next Page >

  • Deployment of SQL compact Edition (SDF files) using Setup project

    - by Emad
    Hi, I have a C#.NET desktop application using SQL Compact edition as data store. The application should be used by any user on the machine and all should be seeing the same data ( data should not different per user). I am wondering where should I deploy the SDF file? User's Personal data folder (My Documents) means each user will have a separate database. Deploying on the same folder as the application causes vista to copy the file to \USers\Appdata\local\VirtualStore\ and it seems to make different copies for each user. Where is it best to deploy the SDF file to ensure all users are looking at the same data?

    Read the article

  • Amazon Web Services (AWS) Plug-in for Oracle Enterprise Manager

    - by Anand Akela
    v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} Contributed by Sunil Kunisetty and Daniel Chan Introduction and ArchitectureAs more and more enterprises deploy some of their non-critical workload on Amazon Web Services (AWS), it’s becoming critical to monitor those public AWS resources along side with their on-premise resources. Oracle recently announced Oracle Enterprise Manager Plug-in for Amazon Web Services (AWS) allows you to achieve that goal. The on-premise Oracle Enterprise Manager (EM12c) acts as a single tool to get a comprehensive view of your public AWS resources as well as your private cloud resources.  By deploying the plug-in within your Cloud Control environment, you gain the following management features: Monitor EBS, EC2 and RDS instances on Amazon Web Services Gather performance metrics and configuration details for AWS instances Raise alerts and violations based on thresholds set on monitoring Generate reports based on the gathered data Users of this Plug-in can leverage the rich Enterprise Manager features such as system promotion, incident generation based on thresholds, integration with 3rd party ticketing applications etc. AWS Monitoring via this Plug-in is enabled via Amazon CloudWatch API and the users of this Plug-in are responsible for supplying credentials for accessing AWS and the CloudWatch API. This Plug-in can only be deployed on an EM12C R2 platform and agent version should be at minimum 12c R2.Here is a pictorial view of the overall architecture: Amazon Elastic Block Store (EBS) Amazon Elastic Compute Cloud (EC2) Amazon Relational Database Service (RDS) Here are a few key features: Rich and exhaustive list of metrics. Metrics can be gathered from an Agent running outside AWS. Critical configuration information. Custom Home Pages with charts and AWS configuration information. Generate incidents based on thresholds set on monitoring data. Discovery and Monitoring AWS instances can be added to EM12C either via the EM12c User Interface (UI) or the EM12c Command Line Interface ( EMCLI)  by providing the AWS credentials (Secret Key and Access Key Id) as well as resource specific properties as target properties. Here is a quick mapping of target types and properties for each AWS resources AWS Resource Type Target Type Resource specific properties EBS Resource Amazon EBS Service CloudWatch base URI, EC2 Base URI, Period, Volume Id, Proxy Server and Port EC2 Resource Amazon EC2 Service CloudWatch base URI, EC2 Base URI, Period, Instance  Id, Proxy Server and Port RDS Resource Amazon RDS Service CloudWatch base URI, RDS Base URI, Period, Instance  Id, Proxy Server and Port Proxy server and port are optional and are only needed if the agent is within the firewall. Here is an emcli example to add an EC2 target. Please read the Installation and Readme guide for more details and step-by-step instructions to deploy  the plugin and adding the AWS the instances. ./emcli add_target \       -name="<target name>" \       -type="AmazonEC2Service" \       -host="<host>" \       -properties="ProxyHost=<proxy server>;ProxyPort=<proxy port>;EC2_BaseURI=http://ec2.<region>.amazonaws.com;BaseURI=http://monitoring.<region>.amazonaws.com;InstanceId=<EC2 instance Id>;Period=<data point periond>"  \     -subseparator=properties="=" ./emcli set_monitoring_credential \                 -set_name="AWSKeyCredentialSet"  \                 -target_name="<target name>"  \                 -target_type="AmazonEC2Service" \                 -cred_type="AWSKeyCredential"  \                 -attributes="AccessKeyId:<access key id>;SecretKey:<secret key>" Emcli utility is found under the ORACLE_HOME of EM12C install. Once the instance is discovered, the target will show up under the ‘All Targets’ list under “Amazon EC2 Service’. Once the instances are added, one can navigate to the custom homepages for these resource types. The custom home pages not only include critical metrics, but also vital configuration parameters and incidents raised for these instances.  By mapping the configuration parameters as instance properties, we can slice-and-dice and group various AWS instance by leveraging the EM12C Config search feature. The following configuration properties and metrics are collected for these Resource types. Resource Type Configuration Properties Metrics EBS Resource Volume Id, Volume Type, Device Name, Size, Availability Zone Response: Status Utilization: QueueLength, IdleTime Volume Statistics: ReadBrandwith, WriteBandwidth, ReadThroughput, WriteThroughput Operation Statistics: ReadSize, WriteSize, ReadLatency, WriteLatency EC2 Resource Instance ID, Owner Id, Root Device type, Instance Type. Availability Zone Response: Status CPU Utilization: CPU Utilization Disk I/O:  DiskReadBytes, DiskWriteBytes, DiskReadOps, DiskWriteOps, DiskReadRate, DiskWriteRate, DiskIOThroughput, DiskReadOpsRate, DiskWriteOpsRate, DiskOperationThroughput Network I/O : NetworkIn, NetworkOut, NetworkInRate, NetworkOutRate, NetworkThroughput RDS Resource Instance ID, Database Engine Name, Database Engine Version, Database Instance Class, Allocated Storage Size, Availability Zone Response: Status Disk I/O:  ReadIOPS, WriteIOPS, ReadLatency, WriteLatency, ReadThroughput, WriteThroughput DB Utilization:  BinLogDiskUsage, CPUUtilization, DatabaseConnections, FreeableMemory, ReplicaLag, SwapUsage Custom Home Pages As mentioned above, we have custom home pages for these target types that include basic configuration information,  last 24 hours availability, top metrics and the incidents generated. Here are few snapshots. EBS Instance Home Page: EC2 Instance Home Page: RDS Instance Home Page: Further Reading: 1)      AWS Plugin download 2)      Installation and  Read Me. 3)      Screenwatch on SlideShare 4)      Extensibility Programmer's Guide 5)      Amazon Web Services

    Read the article

  • File upload iis7

    - by maxwell
    Hi, I have a website and my users can browse the website for general information. If user wants to post any data, they need to register in the website. At the time of registration (in registration form) they can upload their photo. Once registration process is completed they can even modify the previously uploaded photo. My users are facing problem while they uploading their photo at the time of registration. I have given write permission to uploading files folder. But it is giving "Access denied" error. There should be a provision to upload files with or without logging into application. How can we achieve this?

    Read the article

  • In a Rails unit test, how can I get a User fixture to load its associated Profile?

    - by MikeJ
    In the documentation concerning Fixtures (http://api.rubyonrails.org/classes/Fixtures.html) they provide the following example of using label references for associations: ### in pirates.yml reginald: name: Reginald the Pirate monkey: george ### in monkeys.yml george: name: George the Monkey pirate: reginald So following their lead, I have a User model that has_one :profile, a Profile model that belongs_to :user, and tried to set up fixtures per their example: ### in users.yml reginald: id: 1 login: reginald ### in profiles.yml reginalds_profile: id: 1 name: Reginald the Pirate user: reginald (Note: since my association is one-way, the User fixture doesn't have a "profile: reginalds_profile" association--putting it in causes an error because the SQL table has no profile_id attribute.) The problem is, in my unit tests everything seems to load correctly, but users(:reginald).profile is always nil. What am I missing?

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • Thank You for a Great Welcome for Oracle GoldenGate 11g Release 2

    - by Irem Radzik
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yesterday morning we had two launch webcasts for Oracle GoldenGate 11g Release 2. I had the pleasure to present, as well as moderate the Q&A panels in both of these webcasts. Both events had hundreds of live attendees, sending us over 150 questions. Even though we left 30 minutes for Q&A, it was not nearly enough time to address for all the insightful questions our audience sent. Our product management team and I really appreciate the interaction we had yesterday and we are starting to respond back with outstanding questions today. Oracle GoldenGate’s new release launch also had great welcome from the media. You can find the links for various articles on the new release below: ITBusinessEdge Oracle Embraces Cross-Platform Data Integration Information Week: Oracle Real-Time Advance Taps Compressed Data Integration Developer News, Oracle GoldenGate Adds Deeper Oracle Integration, Extends Real-Time Performance CIO, Oracle GoldenGate Buddies Up with Sibling Software DBTA, Real-Time Data Integration: Oracle GoldenGate 11g Release 2 Now Available CBR Oracle unveils GoldenGate 11g Release 2 real-time data integration application In this blog, I want to address some of the frequently asked questions that came up during the webcasts. You can find the top questions and their answers along with related resources below. We will continue to address frequently asked questions via future blogs. Q: Will the new Integrated Capture for Oracle Database replace the Classic Capture? If not, which one do I use when? A: No, Classic Capture will be around for long time. Core platform specific features, bug fixes, and patches will be available for both Capture processes.Oracle Database specific features will be only available in the Integrated Capture. The Integrated Capture for Oracle Database is an option for users that need to capture data from compressed tables or need support for XML data types, XA on RAC. Users who don’t leverage these features should continue to use our Classic Capture. For more information on Oracle GoldenGate 11g Release 2 I recommend to check out the White paper: Oracle GoldenGate 11gR2 New Features as well as other technical white papers we have on OTN.                                                         For those of you coming to OpenWorld, please attend the related session: Extracting Data in Oracle GoldenGate Integrated Capture Mode, Monday Oct 1st 1:45pm Moscone South – 102 to learn more about this new feature. Q: What is new in Conflict Detection and Resolution? And how does it work? A: There are now pre-built functions to identify the conditions under which an error occurs and how to handle the record when the condition occurs. Error conditions handled include inserts into a target table where the row already exists, updates or deletes to target table rows that exist, but the original source data (before columns) do not match the existing data in the target row, and updates or deletes where the row does not exist in the target database table.Foreach of these conditions a method to handle the error is specified.  Please check out our recent blog on this topic and the White paper: Oracle GoldenGate 11gR2 New Features white paper.  Also, for those attending OpenWorld please attend the session: Best Practices for Conflict Detection and Resolution in Oracle GoldenGate for Active/Active-  Wednesday Oct 3rd  3:30pm Mascone 3000 Q: Does Oracle GoldenGate Veridata and the Management Pack require additional licenses, or is it incorporated with the GoldenGate license? A: Oracle GoldenGate Veridata and Oracle Management Pack for Oracle GoldenGate are additional products and require separate licenses. Please check out Oracle's price list here. Q: Does GoldenGate - Oracle Enterprise Manager Plug-in require additional license? A: Oracle Enterprise Manager Plug-in is included in the Oracle Management Pack for Oracle GoldenGate license, which is separate from Oracle GoldenGate license. There is no separate license for the Enterprise Manager Plug-in by itself. Oracle GoldenGate Monitor, Oracle GoldenGate Director, and Enterprise Manager Plug-in are included in the Management Pack for Oracle GoldenGate license. Please check out Management Pack for Oracle GoldenGate data sheet for more info on this product bundle. Q: Is Oracle GoldenGate replacing Oracle Streams product? A: Oracle GoldenGate is the strategic data replication product. Therefore, Oracle Streams will continue to be supported, but will not be actively enhanced. Rather, the best elements of Oracle Streams will be added to Oracle GoldenGate. Conflict management is one of them and with the latest release Oracle GoldenGate has a more advanced conflict management offering. Current customers depending on Oracle Streams will continue to be fully supported. Q: How is Oracle GoldenGate different than Oracle Data Integrator? A: Oracle Data Integrator is designed for fast bulk data movement and transformation between heterogeneous systems, while GoldenGate is designed for real-time movement of transactions between heterogeneous systems. These two products are completely complementary where GoldenGate provides low-impact real-time change data capture and delivery to a staging area on the target. And Oracle Data Integrator transforms this data and loads the DW tables. In fact, Oracle Data Integrator integrates with GoldenGate to use GoldenGate’s Capture process as one option for its CDC mechanism. We have several customers that deployed GoldenGate and ODI together to feed real-time data to their data warehousing solutions. Please also check out Oracle Data Integrator Changed Data Capture with Oracle GoldenGate Data Sheet (PDF). Thank you again very much for welcoming Oracle GoldenGate 11g Release 2 and stay in touch with us for more exciting news, updates, and events.

    Read the article

  • atomic writes to ehcache

    - by Jacques René Mesrine
    Context I am storing a java.util.List inside ehcache. Key(String) --> List<UserDetail> The ordered List contains a Top 10 ranking of my most active users. Problem Concurrent 3rd party clients might be requesting for this list. I have a requirement to be as current as possible with regards to the ranking. Thus if the ranking is changed due the activities of users, the ordered List in the cache must not be left stale for very long. Once I've recalculated a new List, I want to replace the one in cache immediately. Consider a busy scenario whereby multiple concurrent clients are requesting for the ranking; how can I replace the cache item in an fashion such that: Clients can continue to pull a possibly stale snapshot. They should never get a null value. There will only be 1 server thread that writes to the cache.

    Read the article

  • Updating Lucene index from two different threads in a web application

    - by Jimmy
    Hi, I've a .net web application which uses Lucene.net for company search functionality. When registered users add a new company,it is saved to database and also gets indexed in Lucene based company search index in real time. When adding company in Lucene index, how do I handle use case of two or more logged-in users posting a new company at the same time?Also, will both these companies get indexed without any file lock, lock time out, etc. related issues? Would appreciate if i could help with code as well. Thanks.

    Read the article

  • iPhone - Web Access Authentication

    - by Terry
    I am building a secure app for our exec's... here is my setup. It's a somewhat Macgyver approach, but bear with me :) There are only 10 users, I have a record of each uniqueIdentifier on my backend in a database table. (This is internal only for our users, so I don't believe I am breaking the public user registration rule mentioned in the API docs) Through adhoc distribution I install my app on all 10 devices My app is simply composed of a UIWebView. When the app starts it does a POST to our https site sending the uniqueIdentifier. (Thanks to this answer) The server page that recieves the POST, checks the uniqueIdentifier and if found sets a session cookie that automatically logs them into the site. This way the user doesn't have to enter in their credentials every time. So what do you think, is there a security hole with this? Thanks

    Read the article

  • Crontab + rails3 + bundler

    - by mendelbenjamin
    I'm running a crontab that executes a rake task. I'm getting the following error (with MAILTO from crontab): rake aborted! no such file to load -- bundler /Users/Mendel/Sites/misnooit/Rakefile:4 (See full trace by running task with --trace) I'm using rvm with: ruby: ruby 1.9.1p378 rails: Rails 3.0.0.beta $GEM_HOME: /Users/Mendel/.rvm/gems/ruby-1.9.1-p378 bundler: bundler (0.9.11) The error is pretty self explanatory but I'm not able to fix it.. Is there someone with more knowledge about this matter? Thanks in advance.

    Read the article

  • LVDiff not working in Git

    - by Tanner
    I'm trying to get lvdiff from meta-diff suite to work with Git. My .gitconfig looks like this: [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabVIEW 3-Way Merge driver = 'C:/Program Files/National Instruments/Shared/LabVIEW Merge/LVMerge.exe' 'C:/Program Files/National Instruments/LabVIEW 8.6/LabVIEW.exe' %O %B %A %A recursive = binary [diff "lvdiff"] #command = 'C:/Program Files/meta-diff suite/lvdiff.exe' external = C:/Users/Tanner/Desktop/FIRST 2010 Beta/lvdiff.sh [core] autocrlf = true lvdiff.sh looks like this: #!/bin/sh "C:/Program Files/meta-diff suite/lvdiff.exe" "$2" "%5" | cat And my .gitattributes file looks like this: #Use a cusstom driver to merge LabVIEW files *.vi merge=labview #Use lvdiff as the externel diff program for LabVIEW files *.vi diff=lvdiff But everytime I do a diff, all Git returns is: diff --git a/Build DashBoard Data.vi b/Build DashBoard Data.vi index fd50547..662237f 100644 Binary files a/Build DashBoard Data.vi and b/Build DeashBoard Data.vi differ It is like it is not using it or even recognizing my changes. Any ideas?

    Read the article

  • Using dynamic parameters in email publisher subjectSettings block with CruiseControl.Net

    - by Joe
    I am trying to get dynamic parameters to be used in the email publisher's subjectSettings block. For example, <project> ... <parameters> <textParameter> <name>version</name> <display>Version to install</display> <description>The version to install.</description> <required>true</required> </textParameter> </parameters> <tasks> ... </tasks> <publishers> .... <email includeDetails="TRUE"> <from>buildmaster</from> <mailhost>localhost</mailhost> <users> <user name="Joe" group="buildmaster" address="jdavies" /> </users> <groups> <group name="buildmaster"> <notifications> <notificationType>Always</notificationType> </notifications> </group> <group name="users"> <notifications> <notificationType>Success</notificationType> <notificationType>Fixed</notificationType> </notifications> </group> </groups> <subjectSettings> <subject buildResult="Success" value="Version ${version} installed." /> <subject buildResult="Fixed" value="Version ${version} fixed and installed." /> </subjectSettings> <modifierNotificationTypes> <notificationType>Success</notificationType> </modifierNotificationTypes> </email> </project> I have tried using ${version} and $[version]. When I use $[version], the entire subject line is empty! Are dynamic parameters supported in this case, and if so, what am I doing wrong?

    Read the article

  • Macports sudo expands ~ to /var/root in python

    - by calavera
    This might be a bit dev-heavy for the site... but here goes. I installed the macports version of sudo. All is well, except for one thing. Using python 2.6 to expand ~ to the user's home directory results in a different output than the version of sudo that comes with Snow Leopard. For example consider the following python code: #expand_home_dir.py import os os.path.expanduser('~') Below are 3 different calls of the code listed above. The first call using sudo is using the Macports version because my $PATH begins with /opt/local/bin: robert$ python2.6 expand_home_dir.py /Users/robert robert$ sudo python2.6 expand_home_dir.py /var/root robert$ /usr/bin/sudo python2.6 expand_home_dir.py /Users/robert Any idea why this is happening?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Pre-rentrée Oracle Open World 2012 : à vos agendas

    - by Eric Bezille
    A maintenant moins d'un mois de l’événement majeur d'Oracle, qui se tient comme chaque année à San Francisco, fin septembre, début octobre, les spéculations vont bon train sur les annonces qui vont y être dévoilées... Et sans lever le voile, je vous engage à prendre connaissance des sujets des "Key Notes" qui seront tenues par Larry Ellison, Mark Hurd, Thomas Kurian (responsable des développements logiciels) et John Fowler (responsable des développements systèmes) afin de vous donner un avant goût. Stratégie et Roadmaps Oracle Bien entendu, au-delà des séances plénières qui vous donnerons  une vision précise de la stratégie, et pour ceux qui seront sur place, je vous engage à ne pas manquer les séances d'approfondissement qui auront lieu dans la semaine, dont voici quelques morceaux choisis : "Accelerate your Business with the Oracle Hardware Advantage" avec John Fowler, le lundi 1er Octobre, 3:15pm-4:15pm "Why Oracle Softwares Runs Best on Oracle Hardware" , avec Bradley Carlile, le responsable des Benchmarks, le lundi 1er Octobre, 12:15pm-13:15pm "Engineered Systems - from Vision to Game-changing Results", avec Robert Shimp, le lundi 1er Octobre 1:45pm-2:45pm "Database and Application Consolidation on SPARC Supercluster", avec Hugo Rivero, responsable dans les équipes d'intégration matériels et logiciels, le lundi 1er Octobre, 4:45pm-5:45pm "Oracle’s SPARC Server Strategy Update", avec Masood Heydari, responsable des développements serveurs SPARC, le mardi 2 Octobre, 10:15am - 11:15am "Oracle Solaris 11 Strategy, Engineering Insights, and Roadmap", avec Markus Flier, responsable des développements Solaris, le mercredi 3 Octobre, 10:15am - 11:15am "Oracle Virtualization Strategy and Roadmap", avec Wim Coekaerts, responsable des développement Oracle VM et Oracle Linux, le lundi 1er Octobre, 12:15pm-1:15pm "Big Data: The Big Story", avec Jean-Pierre Dijcks, responsable du développement produits Big Data, le lundi 1er Octobre, 3:15pm-4:15pm "Scaling with the Cloud: Strategies for Storage in Cloud Deployments", avec Christine Rogers,  Principal Product Manager, et Chris Wood, Senior Product Specialist, Stockage , le lundi 1er Octobre, 10:45am-11:45am Retours d'expériences et témoignages Si Oracle Open World est l'occasion de partager avec les équipes de développement d'Oracle en direct, c'est aussi l'occasion d'échanger avec des clients et experts qui ont mis en oeuvre  nos technologies pour bénéficier de leurs retours d'expériences, comme par exemple : "Oracle Optimized Solution for Siebel CRM at ACCOR", avec les témoignages d'Eric Wyttynck, directeur IT Multichannel & CRM  et Pascal Massenet, VP Loyalty & CRM systems, sur les bénéfices non seulement métiers, mais également projet et IT, le mercredi 3 Octobre, 1:15pm-2:15pm "Tips from AT&T: Oracle E-Business Suite, Oracle Database, and SPARC Enterprise", avec le retour d'expérience des experts Oracle, le mardi 2 Octobre, 11:45am-12:45pm "Creating a Maximum Availability Architecture with SPARC SuperCluster", avec le témoignage de Carte Wright, Database Engineer à CKI, le mercredi 3 Octobre, 11:45am-12:45pm "Multitenancy: Everybody Talks It, Oracle Walks It with Pillar Axiom Storage", avec le témoignage de Stephen Schleiger, Manager Systems Engineering de Navis, le lundi 1er Octobre, 1:45pm-2:45pm "Oracle Exadata for Database Consolidation: Best Practices", avec le retour d'expérience des experts Oracle ayant participé à la mise en oeuvre d'un grand client du monde bancaire, le lundi 1er Octobre, 4:45pm-5:45pm "Oracle Exadata Customer Panel: Packaged Applications with Oracle Exadata", animé par Tim Shetler, VP Product Management, mardi 2 Octobre, 1:15pm-2:15pm "Big Data: Improving Nearline Data Throughput with the StorageTek SL8500 Modular Library System", avec le témoignage du CTO de CSC, Alan Powers, le jeudi 4 Octobre, 12:45pm-1:45pm "Building an IaaS Platform with SPARC, Oracle Solaris 11, and Oracle VM Server for SPARC", avec le témoignage de Syed Qadri, Lead DBA et Michael Arnold, System Architect d'US Cellular, le mardi 2 Octobre, 10:15am-11:15am "Transform Data Center TCO with Oracle Optimized Servers: A Customer Panel", avec les témoignages notamment d'AT&T et Liberty Global, le mardi 2 Octobre, 11:45am-12:45pm "Data Warehouse and Big Data Customers’ View of the Future", avec The Nielsen Company US, Turkcell, GE Retail Finance, Allianz Managed Operations and Services SE, le lundi 1er Octobre, 4:45pm-5:45pm "Extreme Storage Scale and Efficiency: Lessons from a 100,000-Person Organization", le témoignage de l'IT interne d'Oracle sur la transformation et la migration de l'ensemble de notre infrastructure de stockage, mardi 2 Octobre, 1:15pm-2:15pm Echanges avec les groupes d'utilisateurs et les équipes de développement Oracle Si vous avez prévu d'arriver suffisamment tôt, vous pourrez également échanger dès le dimanche avec les groupes d'utilisateurs, ou tous les soirs avec les équipes de développement Oracle sur des sujets comme : "To Exalogic or Not to Exalogic: An Architectural Journey", avec Todd Sheetz - Manager of DBA and Enterprise Architecture, Veolia Environmental Services, le dimanche 30 Septembre, 2:30pm-3:30pm "Oracle Exalytics and Oracle TimesTen for Exalytics Best Practices", avec Mark Rittman, de Rittman Mead Consulting Ltd, le dimanche 30 Septembre, 10:30am-11:30am "Introduction of Oracle Exadata at Telenet: Bringing BI to Warp Speed", avec Rudy Verlinden & Eric Bartholomeus - Managers IT infrastructure à Telenet, le dimanche 30 Septembre, 1:15pm-2:00pm "The Perfect Marriage: Sun ZFS Storage Appliance with Oracle Exadata", avec Melanie Polston, directeur, Data Management, de Novation et Charles Kim, Managing Director de Viscosity, le dimanche 30 Septembre, 9:00am-10am "Oracle’s Big Data Solutions: NoSQL, Connectors, R, and Appliance Technologies", avec Jean-Pierre Dijcks et les équipes de développement Oracle, le lundi 1er Octobre, 6:15pm-7:00pm Testez et évaluez les solutions Et pour finir, vous pouvez même tester les technologies au travers du Oracle DemoGrounds, (1133 Moscone South pour la partie Systèmes Oracle, OS, et Virtualisation) et des "Hands-on-Labs", comme : "Deploying an IaaS Environment with Oracle VM", le mardi 2 Octobre, 10:15am-11:15am "Virtualize and Deploy Oracle Applications in Minutes with Oracle VM: Hands-on Lab", le mardi 2 Octobre, 11:45am-12:45pm (il est fortement conseillé d'avoir suivi le "Hands-on-Labs" précédent avant d'effectuer ce Lab. "x86 Enterprise Cloud Infrastructure with Oracle VM 3.x and Sun ZFS Storage Appliance", le mercredi 3 Octobre, 5:00pm-6:00pm "StorageTek Tape Analytics: Managing Tape Has Never Been So Simple", le mercredi 3 Octobre, 1:15pm-2:15pm "Oracle’s Pillar Axiom 600 Storage System: Power and Ease", le lundi 1er Octobre, 12:15pm-1:15pm "Enterprise Cloud Infrastructure for SPARC with Oracle Enterprise Manager Ops Center 12c", le lundi 1er Octobre, 1:45pm-2:45pm "Managing Storage in the Cloud", le mardi 2 Octobre, 5:00pm-6:00pm "Learn How to Write MapReduce on Oracle’s Big Data Platform", le lundi 1er Octobre, 12:15pm-1:15pm "Oracle Big Data Analytics and R", le mardi 2 Octobre, 1:15pm-2:15pm "Reduce Risk with Oracle Solaris Access Control to Restrain Users and Isolate Applications", le lundi 1er Octobre, 10:45am-11:45am "Managing Your Data with Built-In Oracle Solaris ZFS Data Services in Release 11", le lundi 1er Octobre, 4:45pm-5:45pm "Virtualizing Your Oracle Solaris 11 Environment", le mardi 2 Octobre, 1:15pm-2:15pm "Large-Scale Installation and Deployment of Oracle Solaris 11", le mercredi 3 Octobre, 3:30pm-4:30pm En conclusion, une semaine très riche en perspective, et qui vous permettra de balayer l'ensemble des sujets au coeur de vos préoccupations, de la stratégie à l'implémentation... Cette semaine doit se préparer, pour tailler votre agenda sur mesure, à travers les plus de 2000 sessions dont je ne vous ai fait qu'un extrait, et dont vous pouvez retrouver l'ensemble en ligne.

    Read the article

  • Software to create a knowledge base/FAQ system

    - by H1Man
    Our company is looking to build a web-based knowledge base system that can be used by our clients/end users to reduce the amount of support calls. Couple important notes: This is aimed at our end users, in other words, non-techies. So the UI has to be easy to use Should have the excellent (fast, accurate) search Should have ability to rate and comment on articles This will only be maintained by one or 2 people, so security isn't a big concern Something similar to what Microsoft is doing with their Knowledge Base. http://support.microsoft.com/search/ Does anyone have any recommendations on what software I can use? Thanks, H. Edit: I should have made this clear before but I don't mean build as in having our developers build a support/kb system from the ground up. I am looking to use a existing software package/solution that can be used to implement a knowledge base/support site.

    Read the article

  • Very simple Error handling with NServiceBus

    - by andy
    hey guys, here's a simple scenario NServiceBus Client/Server setup. The "Message" is a custom Class I wrote. The Client sends a request message. The Server receives the message, and the server does this: Bus.Reply(new UserDataResponseMessage { ID = Guid.NewGuid(), Response = users }); Then nothing. The Client never receives a response. Exception: By trawling through the log4net NServiceBus logs I find an exception, and it turns out that my customs class "users" is not marked as Serializable. Ok, how does one got about "throwing" or "handling" that kind of error? NServiceBus seems to promote the idea of not handling errors, but in this scenario its obvious to see some kind of "throw" would have saved a lot of time. How do I handle such exceptions, where do they occur, where do they go?

    Read the article

  • Jersey, Spring, Tomcat and Security Annotations

    - by jr
    I need to secure a simple jersey RESTful API in a Tomcat 6.0.24 container. I'd like to keep the authentication with Basic Authentication using the tomcat-users.xml file to define the users and roles (this is for now, like I said its small). Now, for authorization I'd like to be able to use the JSR 250 annotations like @RolesAllowed, @PermitAll, @DenyAll, etc. I cannot for the life of me figure out how to wire this all up together. I really don't want to go spring-security route, since I need something very simple at the current time. Can someone point me in the right direction.

    Read the article

  • Co-Authors Wordpress Plugin: coauthors_wp_list_authors function not working correctly

    - by rayne
    The Co-Authors Plus Plugin for Wordpress has a very annoying bug. The custom function coauthors_wp_list_authors lists authors the same way the wordpress function wp_list_authors does, but it does not include authors in the list who don't have a post of their own - if they have only entries in which they are listed as co-author but not as author, they will not be included in the list. That is of course missing a very important point. I've looked at the faulty SQL statement, but unfortunately my knowledge of advanced SQL, especially when it comes to JOINs, as well as my knowledge of the wp database structure is too limited and I remain clueless. There is a topic in the WP support forum, but unfortunately the information there is very outdated and the fix is not applicable anymore. I couldn't find any other, more current solutions on the internet. I'd be glad if somewhere here could help fix the SQL statement so it also lists co-authors who don't have posts where they're the sole author, as well as display the correct post count for all authors. Here's the entire function for reference purposes with a comment marking the SQL statement: function coauthors_wp_list_authors($args = '') { global $wpdb, $coauthors_plus; $defaults = array( 'optioncount' => false, 'exclude_admin' => true, 'show_fullname' => false, 'hide_empty' => true, 'feed' => '', 'feed_image' => '', 'feed_type' => '', 'echo' => true, 'style' => 'list', 'html' => true ); $r = wp_parse_args( $args, $defaults ); extract($r, EXTR_SKIP); $return = ''; $authors = $wpdb->get_results("SELECT ID, user_nicename from $wpdb->users " . ($exclude_admin ? "WHERE user_login <> 'admin' " : '') . "ORDER BY display_name"); $author_count = array(); # this is the SQL statement which doesn't work correctly: $query = "SELECT DISTINCT $wpdb->users.ID AS post_author, $wpdb->terms.name AS user_name, $wpdb->term_taxonomy.count AS count"; $query .= " FROM $wpdb->posts"; $query .= " INNER JOIN $wpdb->term_relationships ON ($wpdb->posts.ID = $wpdb->term_relationships.object_id)"; $query .= " INNER JOIN $wpdb->term_taxonomy ON ($wpdb->term_relationships.term_taxonomy_id = $wpdb->term_taxonomy.term_taxonomy_id)"; $query .= " INNER JOIN $wpdb->terms ON ($wpdb->term_taxonomy.term_id = $wpdb->terms.term_id)"; $query .= " INNER JOIN $wpdb->users ON ($wpdb->terms.name = $wpdb->users.user_login)"; $query .= " WHERE post_type = 'post' AND " . get_private_posts_cap_sql( 'post' ); $query .= " AND $wpdb->term_taxonomy.taxonomy = '$coauthors_plus->coauthor_taxonomy'"; $query .= " GROUP BY post_author"; foreach ((array) $wpdb->get_results($query) as $row) { $author_count[$row->post_author] = $row->count; } foreach ( (array) $authors as $author ) { $link = ''; $author = get_userdata( $author->ID ); $posts = (isset($author_count[$author->ID])) ? $author_count[$author->ID] : 0; $name = $author->display_name; if ( $show_fullname && ($author->first_name != '' && $author->last_name != '') ) $name = "$author->first_name $author->last_name"; if( !$html ) { if ( $posts == 0 ) { if ( ! $hide_empty ) $return .= $name . ', '; } else $return .= $name . ', '; continue; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= '<li>'; if ( $posts == 0 ) { if ( ! $hide_empty ) $link = $name; } else { $link = '<a href="' . get_author_posts_url($author->ID, $author->user_nicename) . '" title="' . esc_attr( sprintf(__("Posts by %s", 'co-authors-plus'), $author->display_name) ) . '">' . $name . '</a>'; if ( (! empty($feed_image)) || (! empty($feed)) ) { $link .= ' '; if (empty($feed_image)) $link .= '('; $link .= '<a href="' . get_author_feed_link($author->ID) . '"'; if ( !empty($feed) ) { $title = ' title="' . esc_attr($feed) . '"'; $alt = ' alt="' . esc_attr($feed) . '"'; $name = $feed; $link .= $title; } $link .= '>'; if ( !empty($feed_image) ) $link .= "<img src=\"" . esc_url($feed_image) . "\" style=\"border: none;\"$alt$title" . ' />'; else $link .= $name; $link .= '</a>'; if ( empty($feed_image) ) $link .= ')'; } if ( $optioncount ) $link .= ' ('. $posts . ')'; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= $link . '</li>'; else if ( ! $hide_empty ) $return .= $link . ', '; } $return = trim($return, ', '); if ( ! $echo ) return $return; echo $return; }

    Read the article

  • Psexec , cmd and batch file

    - by user311130
    Hello. I have a batch file named a.bat on a winserver2008 Desktop. That batch file only write the SessionID (from environment variable) to a local eventlog. I want to execute it remotely using cmd (otherwise the SessionName doesn't appear). so I have tried c:\PsTools\psexec.exe \\<Server> -u test2 -p <Password> -i 2 cmd "c:\Users\test-2\Desktop\a" or c:\PsTools\psexec.exe \\<server> -u test2 -p <Password> -i 2 "cmd \"c:\Users\test-2\Desktop\a\"";exit all of these just open a terminal on the remote machine but don't execute the batch. Any ides? Best Regards,

    Read the article

  • Internet Explorer blocked this website from displaying content with security certificate errors

    - by Tabrez
    I have a security certificate linked to a CDN's server. The main website is https:www.connect4fitness.com When I pull the site up in firefox or chrome, everything works fine. But in IE I get the following error: "Internet Explorer blocked this website from displaying content with security certificate errors." On IE 9 it shows the button "Display Content" and you can get past the error by clicking on the button. On older versions on I the error message is much more cryptic and is confusing users. Please note that I don't have the option of asking end users to add the site to Trusted Sources as some folks use the site from their work computers and do not have that access. Also, some people don't bother to call once they hit the error. I have looked at the content and all my links are "https" only. I had one namespace link and I got rid of it. Any idea about how I can find what is triggering this message?

    Read the article

  • UIKit/UiKit.h missing, on a newer version

    - by letsee
    Dear Everyone, I've a application which has been written for 2.1. Now I'm running that app on xcode 3.2.5 and SDK 4.2. Here's the problem, When I try to Build and Run, I get the following error: UIKit.framework/UIKit.h: No such file or directory In file included from users/.../classes/Radio.m UIKit.framework/UIKit.h: no such file or directory in users/.../classes/Radio.h I don't know why I'm facing that error, because the UIKit.framework is included in my projects "Frameworks" group. I've updated the OS target and other similar options, and application runs clearly without UIKit. I would appreciate it if anyone could help me through. Regards,

    Read the article

  • How to embed PDF in a web page using Acrobat Reader instead of Acrobat.

    - by Lachlan Roche
    I have a pdf form that uses Acrobat 8 features. The form contains Javascript that interacts with the hosting web page. Some of my Windows users have both Adobe Acrobat and Acrobat Reader installed, and need Adobe Acrobat to be the default handler for pdf files. The users with Adobe Acrobat 7 are unable to use the form, even though they might have Acrobat Reader 8 or 9 installed. Currently, the PDF is embedded like this: <object id="host" data="/path/to/document.pdf" type="application/pdf" width="900" height="550" ></object>

    Read the article

  • MySQL Cluster 7.3 Labs Release – Foreign Keys Are In!

    - by Mat Keep
    0 0 1 1097 6254 Homework 52 14 7337 14.0 Normal 0 false false false EN-US JA X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:12.0pt; font-family:Cambria; mso-ascii-font-family:Cambria; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Cambria; mso-hansi-theme-font:minor-latin; mso-ansi-language:EN-US;} Summary (aka TL/DR): Support for Foreign Key constraints has been one of the most requested feature enhancements for MySQL Cluster. We are therefore extremely excited to announce that Foreign Keys are part of the first Labs Release of MySQL Cluster 7.3 – available for download, evaluation and feedback now! (Select the mysql-cluster-7.3-labs-June-2012 build) In this blog, I will attempt to discuss the design rationale, implementation, configuration and steps to get started in evaluating the first MySQL Cluster 7.3 Labs Release. Pace of Innovation It was only a couple of months ago that we announced the General Availability (GA) of MySQL Cluster 7.2, delivering 1 billion Queries per Minute, with 70x higher cross-shard JOIN performance, Memcached NoSQL key-value API and cross-data center replication.  This release has been a huge hit, with downloads and deployments quickly reaching record levels. The announcement of the first MySQL Cluster 7.3 Early Access lab release at today's MySQL Innovation Day event demonstrates the continued pace in Cluster development, and provides an opportunity for the community to evaluate and feedback on new features they want to see. What’s the Plan for MySQL Cluster 7.3? Well, Foreign Keys, as you may have gathered by now (!), and this is the focus of this first Labs Release. As with MySQL Cluster 7.2, we plan to publish a series of preview releases for 7.3 that will incrementally add new candidate features for a final GA release (subject to usual safe harbor statement below*), including: - New NoSQL APIs; - Features to automate the configuration and provisioning of multi-node clusters, on premise or in the cloud; - Performance and scalability enhancements; - Taking advantage of features in the latest MySQL 5.x Server GA. Design Rationale MySQL Cluster is designed as a “Not-Only-SQL” database. It combines attributes that enable users to blend the best of both relational and NoSQL technologies into solutions that deliver web scalability with 99.999% availability and real-time performance, including: Concurrent NoSQL and SQL access to the database; Auto-sharding with simple scale-out across commodity hardware; Multi-master replication with failover and recovery both within and across data centers; Shared-nothing architecture with no single point of failure; Online scaling and schema changes; ACID compliance and support for complex queries, across shards. Native support for Foreign Key constraints enables users to extend the benefits of MySQL Cluster into a broader range of use-cases, including: - Packaged applications in areas such as eCommerce and Web Content Management that prescribe databases with Foreign Key support. - In-house developments benefiting from Foreign Key constraints to simplify data models and eliminate the additional application logic needed to maintain data consistency and integrity between tables. Implementation The Foreign Key functionality is implemented directly within MySQL Cluster’s data nodes, allowing any client API accessing the cluster to benefit from them – whether using SQL or one of the NoSQL interfaces (Memcached, C++, Java, JPA or HTTP/REST.) The core referential actions defined in the SQL:2003 standard are implemented: CASCADE RESTRICT NO ACTION SET NULL In addition, the MySQL Cluster implementation supports the online adding and dropping of Foreign Keys, ensuring the Cluster continues to serve both read and write requests during the operation. An important difference to note with the Foreign Key implementation in InnoDB is that MySQL Cluster does not support the updating of Primary Keys from within the Data Nodes themselves - instead the UPDATE is emulated with a DELETE followed by an INSERT operation. Therefore an UPDATE operation will return an error if the parent reference is using a Primary Key, unless using CASCADE action, in which case the delete operation will result in the corresponding rows in the child table being deleted. The Engineering team plans to change this behavior in a subsequent preview release. Also note that when using InnoDB "NO ACTION" is identical to "RESTRICT". In the case of MySQL Cluster “NO ACTION” means “deferred check”, i.e. the constraint is checked before commit, allowing user-defined triggers to automatically make changes in order to satisfy the Foreign Key constraints. Configuration There is nothing special you have to do here – Foreign Key constraint checking is enabled by default. If you intend to migrate existing tables from another database or storage engine, for example from InnoDB, there are a couple of best practices to observe: 1. Analyze the structure of the Foreign Key graph and run the ALTER TABLE ENGINE=NDB in the correct sequence to ensure constraints are enforced 2. Alternatively drop the Foreign Key constraints prior to the import process and then recreate when complete. Getting Started Read this blog for a demonstration of using Foreign Keys with MySQL Cluster.  You can download MySQL Cluster 7.3 Labs Release with Foreign Keys today - (select the mysql-cluster-7.3-labs-June-2012 build) If you are new to MySQL Cluster, the Getting Started guide will walk you through installing an evaluation cluster on a singe host (these guides reflect MySQL Cluster 7.2, but apply equally well to 7.3) Post any questions to the MySQL Cluster forum where our Engineering team will attempt to assist you. Post any bugs you find to the MySQL bug tracking system (select MySQL Cluster from the Category drop-down menu) And if you have any feedback, please post them to the Comments section of this blog. Summary MySQL Cluster 7.2 is the GA, production-ready release of MySQL Cluster. This first Labs Release of MySQL Cluster 7.3 gives you the opportunity to preview and evaluate future developments in the MySQL Cluster database, and we are very excited to be able to share that with you. Let us know how you get along with MySQL Cluster 7.3, and other features that you want to see in future releases. * Safe Harbor Statement This information is intended to outline our general product direction. It is intended for information purposes only, and may not be incorporated into any contract. It is not a commitment to deliver any material, code, or functionality, and should not be relied upon in making purchasing decisions. The development, release, and timing of any features or functionality described for Oracle’s products remains at the sole discretion of Oracle.

    Read the article

  • Why does Akonadi on KDE 4.6.0 refuse to start?

    - by Patches
    Akonadi refuses to start on my fresh installation of KDE 4.6.0 from the kubuntu-backports PPA on Ubuntu 10.10 Maverick Meerkat, preventing me from usking KMail. Here is the full error output: patches@pleistocene:~/.local/share$ akonadictl start Starting Akonadi Server... done. patches@pleistocene:~/.local/share$ Connecting to deprecated signal QDBusConnectionInterface::serviceOwnerChanged(QString,QString,QString) search paths: ("/home/patches/bin", "/usr/local/sbin", "/usr/local/bin", "/usr/sbin", "/usr/bin", "/sbin", "/bin", "/usr/games", "/usr/sbin", "/usr/local/sbin", "/usr/local/libexec", "/usr/libexec", "/opt/mysql/libexec", "/opt/local/lib/mysql5/bin", "/opt/mysql/sbin") Found mysql_install_db: "/usr/bin/mysql_install_db" Found mysqlcheck: "/usr/bin/mysqlcheck" Database process exited unexpectedly during initial connection! executable: "/usr/sbin/mysqld-akonadi" arguments: ("--defaults-file=/home/patches/.local/share/akonadi//mysql.conf", "--datadir=/home/patches/.local/share/akonadi/db_data/", "--socket=/home/patches/.local/share/akonadi/socket-pleistocene/mysql.socket") stdout: "" stderr: "Could not open required defaults file: /home/patches/.local/share/akonadi//mysql.conf Fatal error in defaults handling. Program aborted 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld-akonadi: Can't find file: './mysql/plugin.frm' (errno: 13) 110209 16:41:12 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 110209 16:41:12 InnoDB: Operating system error number 13 in a file operation. InnoDB: The error means mysqld does not have the access rights to InnoDB: the directory. InnoDB: File name ./ibdata1 InnoDB: File operation call: 'create'. InnoDB: Cannot continue operation. " exit code: 1 process error: "Unknown error" "[ 0: akonadiserver(_Z11akBacktracev+0x35) [0x8086055] 1: akonadiserver() [0x8086516] 2: [0xb772e400] 3: [0xb772e416] 4: /lib/libc.so.6(gsignal+0x51) [0xb6e9f941] 5: /lib/libc.so.6(abort+0x182) [0xb6ea2e42] 6: /usr/lib/libQtCore.so.4(_Z17qt_message_output9QtMsgTypePKc+0x8c) [0xb74d62dc] 7: akonadiserver(_ZN15FileDebugStream9writeDataEPKcx+0xc4) [0x8087574] 8: /usr/lib/libQtCore.so.4(_ZN9QIODevice5writeEPKcx+0x8e) [0xb757168e] 9: /usr/lib/libQtCore.so.4(+0x103425) [0xb7581425] 10: /usr/lib/libQtCore.so.4(_ZN11QTextStreamD1Ev+0x3d) [0xb758295d] 11: akonadiserver(_ZN6QDebugD1Ev+0x43) [0x8081b73] 12: akonadiserver(_ZN13DbConfigMysql19startInternalServerEv+0x1c27) [0x810c177] 13: akonadiserver(_ZN7Akonadi13AkonadiServer20startDatabaseProcessEv+0xe3) [0x8087a23] 14: akonadiserver(_ZN7Akonadi13AkonadiServerC1EP7QObject+0xca) [0x8088b6a] 15: akonadiserver(_ZN7Akonadi13AkonadiServer8instanceEv+0x48) [0x808a1d8] 16: akonadiserver(main+0x364) [0x8080fb4] 17: /lib/libc.so.6(__libc_start_main+0xe7) [0xb6e8bce7] 18: akonadiserver() [0x8080b81] ] " ProcessControl: Application 'akonadiserver' returned with exit code 255 (Unknown error) search paths: ("/home/patches/bin", "/usr/local/sbin", "/usr/local/bin", "/usr/sbin", "/usr/bin", "/sbin", "/bin", "/usr/games", "/usr/sbin", "/usr/local/sbin", "/usr/local/libexec", "/usr/libexec", "/opt/mysql/libexec", "/opt/local/lib/mysql5/bin", "/opt/mysql/sbin") Found mysql_install_db: "/usr/bin/mysql_install_db" Found mysqlcheck: "/usr/bin/mysqlcheck" Database process exited unexpectedly during initial connection! executable: "/usr/sbin/mysqld-akonadi" arguments: ("--defaults-file=/home/patches/.local/share/akonadi//mysql.conf", "--datadir=/home/patches/.local/share/akonadi/db_data/", "--socket=/home/patches/.local/share/akonadi/socket-pleistocene/mysql.socket") stdout: "" stderr: "Could not open required defaults file: /home/patches/.local/share/akonadi//mysql.conf Fatal error in defaults handling. Program aborted 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld-akonadi: Can't find file: './mysql/plugin.frm' (errno: 13) 110209 16:41:12 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 110209 16:41:12 InnoDB: Operating system error number 13 in a file operation. InnoDB: The error means mysqld does not have the access rights to InnoDB: the directory. InnoDB: File name ./ibdata1 InnoDB: File operation call: 'create'. InnoDB: Cannot continue operation. " exit code: 1 process error: "Unknown error" "[ 0: akonadiserver(_Z11akBacktracev+0x35) [0x8086055] 1: akonadiserver() [0x8086516] 2: [0xb77ae400] 3: [0xb77ae416] 4: /lib/libc.so.6(gsignal+0x51) [0xb6f1f941] 5: /lib/libc.so.6(abort+0x182) [0xb6f22e42] 6: /usr/lib/libQtCore.so.4(_Z17qt_message_output9QtMsgTypePKc+0x8c) [0xb75562dc] 7: akonadiserver(_ZN15FileDebugStream9writeDataEPKcx+0xc4) [0x8087574] 8: /usr/lib/libQtCore.so.4(_ZN9QIODevice5writeEPKcx+0x8e) [0xb75f168e] 9: /usr/lib/libQtCore.so.4(+0x103425) [0xb7601425] 10: /usr/lib/libQtCore.so.4(_ZN11QTextStreamD1Ev+0x3d) [0xb760295d] 11: akonadiserver(_ZN6QDebugD1Ev+0x43) [0x8081b73] 12: akonadiserver(_ZN13DbConfigMysql19startInternalServerEv+0x1c27) [0x810c177] 13: akonadiserver(_ZN7Akonadi13AkonadiServer20startDatabaseProcessEv+0xe3) [0x8087a23] 14: akonadiserver(_ZN7Akonadi13AkonadiServerC1EP7QObject+0xca) [0x8088b6a] 15: akonadiserver(_ZN7Akonadi13AkonadiServer8instanceEv+0x48) [0x808a1d8] 16: akonadiserver(main+0x364) [0x8080fb4] 17: /lib/libc.so.6(__libc_start_main+0xe7) [0xb6f0bce7] 18: akonadiserver() [0x8080b81] ] " ProcessControl: Application 'akonadiserver' returned with exit code 255 (Unknown error) search paths: ("/home/patches/bin", "/usr/local/sbin", "/usr/local/bin", "/usr/sbin", "/usr/bin", "/sbin", "/bin", "/usr/games", "/usr/sbin", "/usr/local/sbin", "/usr/local/libexec", "/usr/libexec", "/opt/mysql/libexec", "/opt/local/lib/mysql5/bin", "/opt/mysql/sbin") Found mysql_install_db: "/usr/bin/mysql_install_db" Found mysqlcheck: "/usr/bin/mysqlcheck" Database process exited unexpectedly during initial connection! executable: "/usr/sbin/mysqld-akonadi" arguments: ("--defaults-file=/home/patches/.local/share/akonadi//mysql.conf", "--datadir=/home/patches/.local/share/akonadi/db_data/", "--socket=/home/patches/.local/share/akonadi/socket-pleistocene/mysql.socket") stdout: "" stderr: "Could not open required defaults file: /home/patches/.local/share/akonadi//mysql.conf Fatal error in defaults handling. Program aborted 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld-akonadi: Can't find file: './mysql/plugin.frm' (errno: 13) 110209 16:41:12 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 110209 16:41:12 InnoDB: Operating system error number 13 in a file operation. InnoDB: The error means mysqld does not have the access rights to InnoDB: the directory. InnoDB: File name ./ibdata1 InnoDB: File operation call: 'create'. InnoDB: Cannot continue operation. " exit code: 1 process error: "Unknown error" "[ 0: akonadiserver(_Z11akBacktracev+0x35) [0x8086055] 1: akonadiserver() [0x8086516] 2: [0xb778b400] 3: [0xb778b416] 4: /lib/libc.so.6(gsignal+0x51) [0xb6efc941] 5: /lib/libc.so.6(abort+0x182) [0xb6effe42] 6: /usr/lib/libQtCore.so.4(_Z17qt_message_output9QtMsgTypePKc+0x8c) [0xb75332dc] 7: akonadiserver(_ZN15FileDebugStream9writeDataEPKcx+0xc4) [0x8087574] 8: /usr/lib/libQtCore.so.4(_ZN9QIODevice5writeEPKcx+0x8e) [0xb75ce68e] 9: /usr/lib/libQtCore.so.4(+0x103425) [0xb75de425] 10: /usr/lib/libQtCore.so.4(_ZN11QTextStreamD1Ev+0x3d) [0xb75df95d] 11: akonadiserver(_ZN6QDebugD1Ev+0x43) [0x8081b73] 12: akonadiserver(_ZN13DbConfigMysql19startInternalServerEv+0x1c27) [0x810c177] 13: akonadiserver(_ZN7Akonadi13AkonadiServer20startDatabaseProcessEv+0xe3) [0x8087a23] 14: akonadiserver(_ZN7Akonadi13AkonadiServerC1EP7QObject+0xca) [0x8088b6a] 15: akonadiserver(_ZN7Akonadi13AkonadiServer8instanceEv+0x48) [0x808a1d8] 16: akonadiserver(main+0x364) [0x8080fb4] 17: /lib/libc.so.6(__libc_start_main+0xe7) [0xb6ee8ce7] 18: akonadiserver() [0x8080b81] ] " ProcessControl: Application 'akonadiserver' returned with exit code 255 (Unknown error) search paths: ("/home/patches/bin", "/usr/local/sbin", "/usr/local/bin", "/usr/sbin", "/usr/bin", "/sbin", "/bin", "/usr/games", "/usr/sbin", "/usr/local/sbin", "/usr/local/libexec", "/usr/libexec", "/opt/mysql/libexec", "/opt/local/lib/mysql5/bin", "/opt/mysql/sbin") Found mysql_install_db: "/usr/bin/mysql_install_db" Found mysqlcheck: "/usr/bin/mysqlcheck" Database process exited unexpectedly during initial connection! executable: "/usr/sbin/mysqld-akonadi" arguments: ("--defaults-file=/home/patches/.local/share/akonadi//mysql.conf", "--datadir=/home/patches/.local/share/akonadi/db_data/", "--socket=/home/patches/.local/share/akonadi/socket-pleistocene/mysql.socket") stdout: "" stderr: "Could not open required defaults file: /home/patches/.local/share/akonadi//mysql.conf Fatal error in defaults handling. Program aborted 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Warning] Can't create test file /home/patches/.local/share/akonadi/db_data/pleistocene.lower-test 110209 16:41:12 [Note] Plugin 'FEDERATED' is disabled. /usr/sbin/mysqld-akonadi: Can't find file: './mysql/plugin.frm' (errno: 13) 110209 16:41:12 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 110209 16:41:12 InnoDB: Operating system error number 13 in a file operation. InnoDB: The error means mysqld does not have the access rights to InnoDB: the directory. InnoDB: File name ./ibdata1 InnoDB: File operation call: 'create'. InnoDB: Cannot continue operation. " exit code: 1 process error: "Unknown error" "[ 0: akonadiserver(_Z11akBacktracev+0x35) [0x8086055] 1: akonadiserver() [0x8086516] 2: [0xb784e400] 3: [0xb784e416] 4: /lib/libc.so.6(gsignal+0x51) [0xb6fbf941] 5: /lib/libc.so.6(abort+0x182) [0xb6fc2e42] 6: /usr/lib/libQtCore.so.4(_Z17qt_message_output9QtMsgTypePKc+0x8c) [0xb75f62dc] 7: akonadiserver(_ZN15FileDebugStream9writeDataEPKcx+0xc4) [0x8087574] 8: /usr/lib/libQtCore.so.4(_ZN9QIODevice5writeEPKcx+0x8e) [0xb769168e] 9: /usr/lib/libQtCore.so.4(+0x103425) [0xb76a1425] 10: /usr/lib/libQtCore.so.4(_ZN11QTextStreamD1Ev+0x3d) [0xb76a295d] 11: akonadiserver(_ZN6QDebugD1Ev+0x43) [0x8081b73] 12: akonadiserver(_ZN13DbConfigMysql19startInternalServerEv+0x1c27) [0x810c177] 13: akonadiserver(_ZN7Akonadi13AkonadiServer20startDatabaseProcessEv+0xe3) [0x8087a23] 14: akonadiserver(_ZN7Akonadi13AkonadiServerC1EP7QObject+0xca) [0x8088b6a] 15: akonadiserver(_ZN7Akonadi13AkonadiServer8instanceEv+0x48) [0x808a1d8] 16: akonadiserver(main+0x364) [0x8080fb4] 17: /lib/libc.so.6(__libc_start_main+0xe7) [0xb6fabce7] 18: akonadiserver() [0x8080b81] ] " ProcessControl: Application 'akonadiserver' returned with exit code 255 (Unknown error) "akonadiserver" crashed too often and will not be restarted! I tried moving the ~/.local/share/akonadi folder and running it fresh, and I also tried starting Akonadi from a brand new user, all to no avail. Requested by @djeikyb: patches@pleistocene:~$ ls -ld ~/.local drwxrwx--- 3 patches patches 4096 2011-02-07 03:15 /home/patches/.local patches@pleistocene:~$ mysql_upgrade Looking for 'mysql' as: mysql Looking for 'mysqlcheck' as: mysqlcheck Running 'mysqlcheck' with connection arguments: '--port=3306' '--socket=/var/run/mysqld/mysqld.sock' mysqlcheck: Got error: 2002: Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock' (2) when trying to connect FATAL ERROR: Upgrade failed patches@pleistocene:~$ mysql_upgrade -S ~/.local/share/akonadi/socket-pleistocene/ Looking for 'mysql' as: mysql Looking for 'mysqlcheck' as: mysqlcheck Running 'mysqlcheck' with connection arguments: '--port=3306' '--socket=/var/run/mysqld/mysqld.sock' '--socket=/home/patches/.local/share/akonadi/socket-pleistocene/' mysqlcheck: Got error: 2002: Can't connect to local MySQL server through socket '/home/patches/.local/share/akonadi/socket-pleistocene/' (111) when trying to connect FATAL ERROR: Upgrade failed

    Read the article

< Previous Page | 732 733 734 735 736 737 738 739 740 741 742 743  | Next Page >