Search Results

Search found 19923 results on 797 pages for 'instance variables'.

Page 756/797 | < Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >

  • How do I check for the existence of an external file with XSL?

    - by LOlliffe
    I've found a lot of examples that reference Java and C for this, but how do I, or can I, check for the existence of an external file with XSL. First, I realize that this is only a snippet, but it's part of a huge stylesheet, so I'm hoping it's enough to show my issue. <!-- Use this template for Received SMSs --> <xsl:template name="ReceivedSMS"> <!-- Set/Declare "SMSname" variable (local, evaluates per instance) --> <xsl:variable name="SMSname"> <xsl:value-of select=" following-sibling::Name"/> </xsl:variable> <fo:table font-family="Arial Unicode MS" font-size="8pt" text-align="start"> <fo:table-column column-width=".75in"/> <fo:table-column column-width="6.75in"/> <fo:table-body> <fo:table-row> <!-- Cell contains "speakers" icon --> <fo:table-cell display-align="after"> <fo:block text-align="start"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> What I'd like to do, is put in an "if" statement, surronding the {$SMSname}.jpg line. That is: <fo:block text-align="start"> <xsl:if test="exists( the external file {$SMSname}.jpg)"> <fo:external-graphic src="../images/{$SMSname}.jpg" content-height="0.6in"/> </xsl:if> <xsl:if test="not(exists( the external file {$SMSname}.jpg))"> <fo:external-graphic src="../images/unknown.jpg" content-height="0.6in"/> </xsl:if> </fo:block> Because of "grouping", etc., I'm using XSLT 2.0. I hope that this is something that can be done. I hope even more that it's something simple. As always, thanks in advance for any help. LO

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How change Castor mapping to remove "xmlns:xsi" and "xsi:type" attributes from element in XML output

    - by Derek Mahar
    How do I change the Castor mapping <?xml version="1.0"?> <!DOCTYPE mapping PUBLIC "-//EXOLAB/Castor Mapping DTD Version 1.0//EN" "http://castor.org/mapping.dtd"> <mapping> <class name="java.util.ArrayList" auto-complete="true"> <map-to xml="ArrayList" /> </class> <class name="com.db.spgit.abstrack.ws.response.UserResponse"> <map-to xml="UserResponse" /> <field name="id" type="java.lang.String"> <bind-xml name="id" node="element" /> </field> <field name="deleted" type="boolean"> <bind-xml name="deleted" node="element" /> </field> <field name="name" type="java.lang.String"> <bind-xml name="name" node="element" /> </field> <field name="typeId" type="java.lang.Integer"> <bind-xml name="typeId" node="element" /> </field> <field name="regionId" type="java.lang.Integer"> <bind-xml name="regionId" node="element" /> </field> <field name="regionName" type="java.lang.String"> <bind-xml name="regionName" node="element" /> </field> </class> </mapping> to suppress the xmlns:xsi and xsi:type attributes in the element of the XML output? For example, instead of the output XML <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:type="UserResponse"> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> I'd prefer <?xml version="1.0" encoding="UTF-8"?> <ArrayList> <UserResponse> <name>Tester</name> <typeId>1</typeId> <regionId>2</regionId> <regionName>US</regionName> </UserResponse> </ArrayList> such that the element name implies the xsi:type.

    Read the article

  • X264 encoding using Opencv

    - by user573193
    I am working with a high resolution camera: 4008x2672. I a writing a simple program which grabs frame from the camera and sends the frame to a avi file. For working with such a high resolution, I found only x264 codec that could do the trick (Suggestions welcome). I am using opencv for most of the image handling stuff. As mentioned in this post http://doom10.org/index.php?topic=1019.0 , I modified the AVCodecContext members as per ffmpeg presets for libx264 (Had to do this to avoid broken ffmpeg defaults settings error). This is output I am getting when I try to run the program [libx264 @ 0x992d040]non-strictly-monotonic PTS 1294846981.526675 1 0 //Timestamp camera_no frame_no 1294846981.621101 1 1 1294846981.715521 1 2 1294846981.809939 1 3 1294846981.904360 1 4 1294846981.998782 1 5 1294846982.093203 1 6 Last message repeated 7 times [avi @ 0x992beb0]st:0 error, non monotone timestamps -614891469123651720 = -614891469123651720 OpenCV Error: Unspecified error (Error while writing video frame) in icv_av_write_frame_FFMPEG, file /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp, line 1034 terminate called after throwing an instance of 'cv::Exception' what(): /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp:1034: error: (-2) Error while writing video frame in function icv_av_write_frame_FFMPEG Aborted Modifications to the AVCodecContext are: if(codec_id == CODEC_ID_H264) { //fprintf(stderr, "Trying to parse a preset file for libx264\n"); //Setting Values manually from medium preset c-me_method = 7; c-qcompress=0.6; c-qmin = 10; c-qmax = 51; c-max_qdiff = 4; c-i_quant_factor=0.71; c-max_b_frames=3; c-b_frame_strategy = 1; c-me_range = 16; c-me_subpel_quality=7; c-coder_type = 1; c-scenechange_threshold=40; c-partitions = X264_PART_I8X8 | X264_PART_I4X4 | X264_PART_P8X8 | X264_PART_B8X8; c-flags = CODEC_FLAG_LOOP_FILTER; c-flags2 = CODEC_FLAG2_BPYRAMID | CODEC_FLAG2_MIXED_REFS | CODEC_FLAG2_WPRED | CODEC_FLAG2_8X8DCT | CODEC_FLAG2_FASTPSKIP; c-keyint_min = 25; c-refs = 3; c-trellis=1; c-directpred = 1; c-weighted_p_pred=2; } I am probably not setting the dts and pts values which I believed ffmpeg should be setting it for me. Any sugggestions welcome. Thanks in advance

    Read the article

  • Is there a reason why a base class decorated with XmlInclude would still throw a type unknown exception when serialized?

    - by Tedford
    I will simplify the code to save space but what is presented does illustrate the core problem. I have a class which has a property that is a base type. There exist 3 dervived classes which could be assigned to that property. If I assign any of the derived classes to the container then the XmlSerializer throws dreaded "The type xxx was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically." exception when attempting to seralize the container. However my base class is already decorated with that attribute so I figure there must be an additional "hidden" requirement. The really odd part is that the default WCF serializer has no issues with this class hierarchy. The Container class [DataContract] [XmlRoot(ElementName = "TRANSACTION", Namespace = Constants.Namespace)] public class PaymentSummaryRequest : CommandRequest { /// <summary> /// Gets or sets the summary. /// </summary> /// <value>The summary.</value> /// <remarks></remarks> [DataMember] public PaymentSummary Summary { get; set; } /// <summary> /// Initializes a new instance of the <see cref="PaymentSummaryRequest"/> class. /// </summary> public PaymentSummaryRequest() { Mechanism = CommandMechanism.PaymentSummary; } } The base class [DataContract] [XmlInclude(typeof(xxxPaymentSummary))] [XmlInclude(typeof(yyyPaymentSummary))] [XmlInclude(typeof(zzzPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(zzzPaymentSummary))] public abstract class PaymentSummary { } One of the derived classes [DataContract] public class xxxPaymentSummary : PaymentSummary { } The serialization code var serializer = new XmlSerializer(typeof(PaymentSummaryRequest)); serializer.Serialize(Console.Out,new PaymentSummaryRequest{Summary = new xxxPaymentSummary{}}); The Exception System.InvalidOperationException: There was an error generating the XML document. --- System.InvalidOperationException: The type xxxPaymentSummary was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically. at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write13_PaymentSummary(String n, String ns, PaymentSummary o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write14_PaymentSummaryRequest(String n, String ns, PaymentSummaryRequest o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write15_TRANSACTION(Object o) --- End of inner exception stack trace --- at System.Xml.Serialization.XmlSerializer.Serialize(XmlWriter xmlWriter, Object o, XmlSerializerNamespaces namespaces, String encodingStyle, String id) at System.Xml.Serialization.XmlSerializer.Serialize(TextWriter textWriter, Object o, XmlSerializerNamespaces namespaces) at UserQuery.RunUserAuthoredQuery() in c:\Users\Tedford\AppData\Local\Temp\uqacncyo.0.cs:line 47

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • How to cache queries in EJB and return result efficient (performance POV)

    - by Maxym
    I use JBoss EJB 3.0 implementation (JBoss 4.2.3 server) At the beginning I created native query all the time using construction like Query query = entityManager.createNativeQuery("select * from _table_"); Of couse it is not that efficient, I performed some tests and found out that it really takes a lot of time... Then I found a better way to deal with it, to use annotation to define native queries: @NamedNativeQuery( name = "fetchData", value = "select * from _table_", resultClass=Entity.class ) and then just use it Query query = entityManager.createNamedQuery("fetchData"); the performance of code line above is two times better than where I started from, but still not that good as I expected... then I found that I can switch to Hibernate annotation for NamedNativeQuery (anyway, JBoss's implementation of EJB is based on Hibernate), and add one more thing: @NamedNativeQuery( name = "fetchData2", value = "select * from _table_", resultClass=Entity.class, readOnly=true) readOnly - marks whether the results are fetched in read-only mode or not. It sounds good, because at least in this case of mine I don't need to update data, I wanna just fetch it for report. When I started server to measure performance I noticed that query without readOnly=true (by default it is false) returns result with each iteration better and better, and at the same time another one (fetchData2) works like "stable" and with time difference between them is shorter and shorter, and after 5 iterations speed of both was almost the same... The questions are: 1) is there any other way to speed query using up? Seems that named queries should be prepared once, but I can't say it... In fact if to create query once and then just use it it would be better from performance point of view, but it is problematic to cache this object, because after creating query I can set parameters (when I use ":variable" in query), and it changes query object (isn't it?). well, is here any way to cache them? Or named query is the best option I can use? 2) any other approaches how to make results retrieveng faster. I mean, for instance I don't need those Entities to be attached, I won't update them, all I need is just fetch collection of data. Maybe readOnly is the only available way, so I can't speed it up, but who knows :) P.S. I don't ask about DB performance, all I need now is how not to create query all the time, so use it efficient, and to "allow" EJB to do less job with the same result concerning data returning.

    Read the article

  • How do you unit test the real world?

    - by Kim Sun-wu
    I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

    Read the article

  • Linux configurations that would affect Java memory usage?

    - by wmacura
    Hi, Background: I have a set of java background workers I start as part of my webapp. I develop locally on Ubuntu 10.10 and deploy to an Ubuntu 10.04LTS server (a media temple (ve) instance). They're both running the same JVM: Sun JVM 1.6.0_22-b04. As part of the initialization script each worker is started with explicit Xmx, Xms, and XX:MaxPermGen settings. Yet somehow locally all 10 workers use 250MB, while on the server they use more than 2.7GB. I don't know how to begin to track this down. I thought the Ubuntu (and thus, kernel) version might make a difference, but I tried an old 10.04 VM and it behaves as expected. I've noticed that the machine does not seem to ever use memory for buffer or cache (according to htop), which seems a bit strange, but perhaps normal for a server? (edited) Some info: (server) root@devel:/app/axir/target# uname -a Linux devel 2.6.18-028stab069.5 #1 SMP Tue May 18 17:26:16 MSD 2010 x86_64 GNU/Linux (local) wiktor@beastie:~$ uname -a Linux beastie 2.6.35-25-generic #44-Ubuntu SMP Fri Jan 21 17:40:44 UTC 2011 x86_64 GNU/Linux (edited) Comparing PS output: (ps -eo "ppid,pid,cmd,rss,sz,vsz") PPID PID CMD RSS SZ VSZ (local) 1588 1615 java -cp axir-distribution. 25484 234382 937528 1615 1631 java -cp /home/wiktor/Code/ 83472 163059 652236 1615 1657 java -cp /home/wiktor/Code/ 70624 89135 356540 1615 1658 java -cp /home/wiktor/Code/ 37652 77625 310500 1615 1669 java -cp /home/wiktor/Code/ 38096 77733 310932 1615 1675 java -cp /home/wiktor/Code/ 37420 61395 245580 1615 1684 java -cp /home/wiktor/Code/ 38000 77736 310944 1615 1703 java -cp /home/wiktor/Code/ 39180 78060 312240 1615 1712 java -cp /home/wiktor/Code/ 38488 93882 375528 1615 1719 java -cp /home/wiktor/Code/ 38312 77874 311496 1615 1726 java -cp /home/wiktor/Code/ 38656 77958 311832 1615 1727 java -cp /home/wiktor/Code/ 78016 89429 357716 (server) 22522 23560 java -cp axir-distribution. 24860 285196 1140784 23560 23585 java -cp /app/axir/target/a 100764 161629 646516 23560 23667 java -cp /app/axir/target/a 72408 92682 370728 23560 23670 java -cp /app/axir/target/a 39948 97671 390684 23560 23674 java -cp /app/axir/target/a 40140 81586 326344 23560 23739 java -cp /app/axir/target/a 39688 81542 326168 They look very similar. In fact, the question now is why, if I add up the virtual memory usage on the server (3.2GB) does it more closely reflect 2.4GB of memory used (according to free), yet locally the virtual memory used adds up to a much more substantial 4.7GB but only actually uses ~250MB. It seems that perhaps memory isn't being shared as aggressively. (if that's even possible) Thank you for your help, Wiktor

    Read the article

  • Why are these two sql statements deadlocking? (Deadlock graph + details included).

    - by Pure.Krome
    Hi folks, I've got the following deadlock graph that describes two sql statements that are deadlocking each other. I'm just not sure how to analyse this and then fix up my sql code to prevent this from happening. Main deadlock graph Click here for a bigger image. Left side, details Click here for a bigger image. Right side, details Click here for a bigger image. What is the code doing? I'm reading in a number of files (eg. lets say 3, for this example). Each file contains different data BUT the same type of data. I then insert data into LogEntries table and then (if required) I insert or delete something from the ConnectedClients table. Here's my sql code. using (TransactionScope transactionScope = new TransactionScope()) { _logEntryRepository.InsertOrUpdate(logEntry); // Now, if this log entry was a NewConnection or an LostConnection, then we need to make sure we update the ConnectedClients. if (logEntry.EventType == EventType.NewConnection) { _connectedClientRepository.Insert(new ConnectedClient { LogEntryId = logEntry.LogEntryId }); } // A (PB) BanKick does _NOT_ register a lost connection .. so we need to make sure we handle those scenario's as a LostConnection. if (logEntry.EventType == EventType.LostConnection || logEntry.EventType == EventType.BanKick) { _connectedClientRepository.Delete(logEntry.ClientName, logEntry.ClientIpAndPort); } _unitOfWork.Commit(); transactionScope.Complete(); } Now each file has it's own UnitOfWork instance (which means it has it's own database connection, transaction and repository context). So i'm assuming this means there's 3 different connections to the db all happening at the same time. Finally, this is using Entity Framework as the repository, but please don't let that stop you from having a think about this problem. Using a profiling tool, the Isolation Level is Serializable. I've also tried ReadCommited and ReadUncommited, but they both error :- ReadCommited: same as above. Deadlock. ReadUncommited: different error. EF exception that says it expected some result back, but got nothing. I'm guessing this is the LogEntryId Identity (scope_identity) value that is expected but not retrieve because of the dirty read. Please help! PS. It's Sql Server 2008, btw.

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • VB.NET looping through XML to store in singleton

    - by rockinthesixstring
    I'm having a problem with looping through an XML file and storing the value in a singleton My XML looks like this <values> <value></value> <value>$1</value> <value>$5,000</value> <value>$10,000</value> <value>$15,000</value> <value>$25,000</value> <value>$50,000</value> <value>$75,000</value> <value>$100,000</value> <value>$250,000</value> <value>$500,000</value> <value>$750,000</value> <value>$1,000,000</value> <value>$1,250,000</value> <value>$1,500,000</value> <value>$1,750,000</value> <value>$2,000,000</value> <value>$2,500,000</value> <value>$3,000,000</value> <value>$4,000,000</value> <value>$5,000,000</value> <value>$7,500,000</value> <value>$10,000,000</value> <value>$15,000,000</value> <value>$25,000,000</value> <value>$50,000,000</value> <value>$100,000,000</value> <value>$100,000,000+</value> </values> And my function looks like this Public Class LoadValues Private Shared SearchValuesInstance As List(Of SearchValues) = Nothing Public Shared ReadOnly Property LoadSearchValues As List(Of SearchValues) Get Dim sv As New List(Of SearchValues) If SearchValuesInstance Is Nothing Then Dim objDoc As XmlDocument = New XmlDataDocument Dim objRdr As XmlTextReader = New XmlTextReader(HttpContext.Current.Server.MapPath("~/App_Data/Search-Values.xml")) objRdr.Read() objDoc.Load(objRdr) Dim root As XmlElement = objDoc.DocumentElement Dim itemNodes As XmlNodeList = root.SelectNodes("/values") For Each n As XmlNode In itemNodes sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) Next SearchValuesInstance = sv Else : sv = SearchValuesInstance End If Return sv End Get End Property End Class My problem is that I'm getting an object not set to an instance of an object on the sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) line.

    Read the article

  • Android Camera takePicture function does not call Callback function

    - by Tomáš 'Guns Blazing' Frcek
    I am working on a custom Camera activity for my application. I was following the instruction from the Android Developers site here: http://developer.android.com/guide/topics/media/camera.html Everything seems to works fine, except the Callback function is not called and the picture is not saved. Here is my code: public class CameraActivity extends Activity { private Camera mCamera; private CameraPreview mPreview; private static final String TAG = "CameraActivity"; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.camera); // Create an instance of Camera mCamera = getCameraInstance(); // Create our Preview view and set it as the content of our activity. mPreview = new CameraPreview(this, mCamera); FrameLayout preview = (FrameLayout) findViewById(R.id.camera_preview); preview.addView(mPreview); Button captureButton = (Button) findViewById(R.id.button_capture); captureButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { Log.v(TAG, "will now take picture"); mCamera.takePicture(null, null, mPicture); Log.v(TAG, "will now release camera"); mCamera.release(); Log.v(TAG, "will now call finish()"); finish(); } }); } private PictureCallback mPicture = new PictureCallback() { @Override public void onPictureTaken(byte[] data, Camera camera) { Log.v(TAG, "Getting output media file"); File pictureFile = getOutputMediaFile(); if (pictureFile == null) { Log.v(TAG, "Error creating output file"); return; } try { FileOutputStream fos = new FileOutputStream(pictureFile); fos.write(data); fos.close(); } catch (FileNotFoundException e) { Log.v(TAG, e.getMessage()); } catch (IOException e) { Log.v(TAG, e.getMessage()); } } }; private static File getOutputMediaFile() { String state = Environment.getExternalStorageState(); if (!state.equals(Environment.MEDIA_MOUNTED)) { return null; } else { File folder_gui = new File(Environment.getExternalStorageDirectory() + File.separator + "GUI"); if (!folder_gui.exists()) { Log.v(TAG, "Creating folder: " + folder_gui.getAbsolutePath()); folder_gui.mkdirs(); } File outFile = new File(folder_gui, "temp.jpg"); Log.v(TAG, "Returnng file: " + outFile.getAbsolutePath()); return outFile; } } After clicking the Button, I get logs: "will now take picture", "will now release camera" and "will now call finish". The activity finishes succesfully, but the Callback function was not called during the mCamera.takePicture(null, null, mPicture); function (There were no logs from the mPicture callback or getMediaOutputFile functions) and there is no file in the location that was specified. Any ideas? :) Much thanks!

    Read the article

  • How do I make my custom Swing component visible?

    - by Alex
    I have no idea why it won't show. First I create an instance of the component and then add it to a certain element in a two-dimensional JPanel array. Then I loop through that array and add each JPanel to another JPanel container which is to hold all the JPanels. I then add that final container to my JFrame window and set visibility to true, it should be visible? public class View extends JFrame { Board gameBoard; JFrame gameWindow = new JFrame("Chess"); JPanel gamePanel = new JPanel(); JPanel[][] squarePanel = new JPanel[8][8]; JMenuBar gameMenu = new JMenuBar(); JButton restartGame = new JButton("Restart"); JButton pauseGame = new JButton("Pause"); JButton log = new JButton("Log"); View(Board board){ gameWindow.setDefaultCloseOperation(EXIT_ON_CLOSE); gameWindow.setSize(400, 420); gameWindow.getContentPane().add(gamePanel, BorderLayout.CENTER); gameWindow.getContentPane().add(gameMenu, BorderLayout.NORTH); gameMenu.add(restartGame); gameMenu.add(pauseGame); gameMenu.add(log); gameBoard = board; drawBoard(gameBoard); gameWindow.setResizable(false); gameWindow.setVisible(true); } public void drawBoard(Board board){ for(int row = 0; row < 8; row++){ for(int col = 0; col < 8; col++){ Box box = new Box(board.getSquare(col, row).getColour(), col, row); squarePanel[col][row] = new JPanel(); squarePanel[col][row].add(box); } } for(JPanel[] col : squarePanel){ for(JPanel square : col){ gamePanel.add(square); } } } } @SuppressWarnings("serial") class Box extends JComponent{ Color boxColour; int col, row; public Box(Color boxColour, int col, int row){ this.boxColour = boxColour; this.col = col; this.row = row; repaint(); } protected void paintComponent(Graphics drawBox){ drawBox.setColor(boxColour); drawBox.drawRect(50*col, 50*row, 50, 50); drawBox.fillRect(50*col, 50*row, 50, 50); } } A final question as well. Notice how each Box component has a position, what happens to the position when I add the component to a JPanel and add the JPanel to my JFrame? Does it still have the same position in relation to the other Box components?

    Read the article

  • IOC/Autofac problem

    - by Krazzy
    I am currently using Autofac, but am open to commentary regarding other IOC containers as well. I would prefer a solution using Autofac if possible. I am also somewhat new to IOC so I may be grossly misunderstanding what I should be using an IOC container for. Basically, the situation is as follows: I have a topmost IOC container for my app. I have a tree of child containers/scopes where I would like the same "service" (IWhatever) to resolve differently depending on which level in the tree it is resolved. Furthermore if a service is not registered at some level in the tree I would like the tree to be transversed upward until a suitable implementation is found. Furthermore, when constructing a given component, it is quite possible that I will need access to the parent container/scope. In many cases the component that I'm registering will have a dependency on the same or a different service in a parent scope. Is there any way to express this dependency with Autofac? Something like: builder.Register(c=> { var parentComponent = ?.Resolve<ISomeService>(); var childComponent = new ConcreteService(parentComponent, args...); return childComponent; }).As<ISomeService>(); I can't get anything similar to the above pseudocode to work for serveral reasons: A) It seems that all levels in the scope tree share a common set of registrations. I can't seem to find a way to make a given registration confined a certain "scope". B) I can't seem to find a way to get a hold of the parent scope of a given scope. I CAN resolve ILifetimeScope in the container and then case it to a concrete LifetimeScope instance which provides its parent scope, but I'm guessing it is probably note meant to be used this way. Is this safe? C) I'm not sure how to tell Autofac which container owns the resolved object. For many components I would like component to be "owned" by the scope in which it is constructed. Could tagged contexts help me here? Would I have to tag every level of the tree with a unique tag? This would be difficult because the tree depth is determined at runtime. Sorry for the extremely lengthy question. In summary: 1) Is there any way to do what I want to do using Autofac? 2) Is there another container more suited to this kind of dependency structure? 3) Is IOC the wrong tool for this altogether?

    Read the article

  • Absolute Xpath to get list of childnodes?

    - by Googler
    Hi this my xml file, <?xml version="1.0"?> <worldpatentdata xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <meta name="elapsed-time" value="329" xmlns="http://ops.epo.org"/> <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> </exchange-documents> </worldpatentdata> For the above xml file, i need the xpath to receive the childnodes below it: Output i need is : <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> I using Linq-Xml to get the following data: This is my Xpath and code: var list = doc1.XPathSelectElement("exchange-document"); I couldnt retreive the needed output.It returns null for the above code. Can anyone pls help on this by providing the correct xpath to retieve the child nodes. Else is there any other way to retrieve it.

    Read the article

  • Help with listView in Android

    - by jul
    Hi, I'm just starting with Android and can't find how to display a list in my activity. I get some restaurant data from a web service and I'd like to show the results in a list. The activity, the restaurant class and the layout main.xml are shown below. How can I display, for instance, the list of the restaurant names in the ListView 'list' of my layout? thank you Jul public class Atable extends ListActivity { RestaurantList restaurantList; public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); //Here I set restaurantList //Now how can I display, for example, the list of the names of the restaurants } main.xml <LinearLayout android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="wrap_content"> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/search" /> <EditText android:id="@+id/search" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_weight="1"/> </LinearLayout> <LinearLayout android:orientation="vertical" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@+id/android:list" android:layout_width="wrap_content" android:layout_height="wrap_content"/> <TextView android:id="@+id/android:empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/noresults"/> </LinearLayout> </LinearLayout> Restaurant list class package org.digitalfarm.atable; import java.util.List; public class RestaurantList { private List<Restaurant> restaurants; public List<Restaurant> getRestaurants() { return restaurants; } public void setRestaurants(List<Restaurant> restaurants) { this.restaurants = restaurants; } } Restaurant class package org.digitalfarm.atable; public class Restaurant { private String name; private float latitude; private float longitude; public String getName() { return name; } public void setName(String name) { this.name = name; } public float getLatitude() { return latitude; } public void setLatitude(float latitude) { this.latitude = latitude; } public float getLongitude() { return longitude; } public void setLongitude(float longitude) { this.longitude = longitude; } }

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • Hidden divs for "lazy javascript" loading? Possible security/other issues?

    - by xyld
    I'm curious about people's opinion's and thoughts about this situation. The reason I'd like to lazy load javascript is because of performance. Loading javascript at the end of the body reduces the browser blocking and ends up with much faster page loads. But there is some automation I'm using to generate the html (django specifically). This automation has the convenience of allowing forms to be built with "Widgets" that output content it needs to render the entire widget (extra javascript, css, ...). The problem is that the widget wants to output javascript immediately into the middle of the document, but I want to ensure all javascript loads at the end of the body. When the following widget is added to a form, you can see it renders some <script>...</script> tags: class AutoCompleteTagInput(forms.TextInput): class Media: css = { 'all': ('css/jquery.autocomplete.css', ) } js = ( 'js/jquery.bgiframe.js', 'js/jquery.ajaxQueue.js', 'js/jquery.autocomplete.js', ) def render(self, name, value, attrs=None): output = super(AutoCompleteTagInput, self).render(name, value, attrs) page_tags = Tag.objects.usage_for_model(DataSet) tag_list = simplejson.dumps([tag.name for tag in page_tags], ensure_ascii=False) return mark_safe(u'''<script type="text/javascript"> jQuery("#id_%s").autocomplete(%s, { width: 150, max: 10, highlight: false, scroll: true, scrollHeight: 100, matchContains: true, autoFill: true }); </script>''' % (name, tag_list,)) + output What I'm proposing is that if someone uses a <div class=".lazy-js">...</div> with some css (.lazy-js { display: none; }) and some javascript (jQuery('.lazy-js').each(function(index) { eval(jQuery(this).text()); }), you can effectively force all javascript to load at the end of page load: class AutoCompleteTagInput(forms.TextInput): class Media: css = { 'all': ('css/jquery.autocomplete.css', ) } js = ( 'js/jquery.bgiframe.js', 'js/jquery.ajaxQueue.js', 'js/jquery.autocomplete.js', ) def render(self, name, value, attrs=None): output = super(AutoCompleteTagInput, self).render(name, value, attrs) page_tags = Tag.objects.usage_for_model(DataSet) tag_list = simplejson.dumps([tag.name for tag in page_tags], ensure_ascii=False) return mark_safe(u'''<div class="lazy-js"> jQuery("#id_%s").autocomplete(%s, { width: 150, max: 10, highlight: false, scroll: true, scrollHeight: 100, matchContains: true, autoFill: true }); </div>''' % (name, tag_list,)) + output Nevermind all the details of my specific implementation (the specific media involved), I'm looking for a consensus on whether the method of using lazy-loaded javascript through hidden a hidden tags can pose issues whether security or other related? One of the most convenient parts about this is that it follows the DRY principle rather well IMO because you don't need to hack up a specific lazy-load for each instance in the page. It just "works". UPDATE: I'm not sure if django has the ability to queue things (via fancy template inheritance or something?) to be output just before the end of the </body>?

    Read the article

  • Dynamically find other hosts in a LAN in Java

    - by Federico Cristina
    A while ago I developed a little LAN chat app. in Java which allows chatting with other hosts, send images, etc. Although it was created just for fun, now it's being used where I work. Currently, there is no "chat server" on the app. where each client registers, updates it's status, etc. (I liked the idea of symmetric design and not depending on a server running on some other machine). Instead, each host is a client/server which has a hosts.properties file with the hostname of the other hosts, and - for instance - broadcasts to each one of them when sending a massive message/image/whatever. In the beginning there were just a couple of hosts, so this hosts.properties file wasn't an issue. But as the amount of users increased, the need of updating that file was a bit daunting. So now I've decided to get rid of it, and each time the app. starts, dynammically find the other active hosts. However, I cannot find the correct way of implement this. I've tried starting different threads, each one of them searching for other hosts in a known range of IP addresses. Something like this (simplified for the sake of readability): /** HostsLocator */ public static void searchForHosts(boolean waitToEnd) { for (int i=0; i < MAX_IP; i+= MAX_IP / threads) { HostsLocator detector = new HostsLocator(i, i+(MAX_IP / threads - 1)); // range: from - to new Thread(detector).start(); } } public void run() { for (int i=from; i<=to; i++) findHosts( maskAddress + Integer.toString(i) ); } public static boolean findHosts(String IP) { InetAddress address = InetAddress.getByName(IP); if ( address.isReachable(CONNECTION_TIME_OUT) ) // host found! } However: With a single thread and a low value in CONNECTION_TIME_OUT (500ms) I get wrong Host Not Found status for for hosts actually active. With a high value in CONNECTION_TIME_OUT (5000ms) and only one single thread takes forever to end With several threads I've also found problems similar like the first one, due to collisions. So... I guess there's a better way of solving this problem but I couldn't find it. Any advice? Thanks!

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

< Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >