Search Results

Search found 20799 results on 832 pages for 'long integer'.

Page 778/832 | < Previous Page | 774 775 776 777 778 779 780 781 782 783 784 785  | Next Page >

• Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

  - by Doug Chamberlain

  Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

  Read the article

• Need help simplifying my php table

  - by user342391

  I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

  Read the article

• Google Maps API 3 How to call initialize without putting it in Body onload

  - by Bex

  Hi I am using the google maps API and have copied the examples and have ended up with a function called "initialize" that is called from the body onload. I am using the maps in a few different user controls, which are placed within content place holders, so the body tag is in the master page. Is there a way of calling initialize directly in the usercontrol rather than having to place an onload on the masterpage? Ideally I want my user control to be a stand alone control that I can just slot into pages without trying to access the master page body onload. I have tried calling the Initialize function from my page load of the user control (by adding a start up script), but the map doesn't appear. Any suggestions? My code: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false">/script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> var map; var geocoder; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(51.8052184317649, -4.965819906250006); var myOptions = { zoom: 8, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); $.ajax({ type: "POST", url: "/GoogleMapsService.asmx/GetPointers", contentType: "application/json; charset=utf-8", dataType: "json", beforeSend: function () { $(".loadingData").html("<p>Loading data..</p>"); }, complete: function () { $(".loadingData").html(""); }, cache: true, success: mapPoints, error: onError }); } function onError(xhr, ajaxOptions, thrownError) { alert(xhr.status); alert(xhr.responseText); } function mapPoints(response) { if (response.d != null) { if (response.d.length > 0) { for (var i = 0; i < response.d.length; i++) { plotOnMap(response.d[i].Id, response.d[i].Name, response.d[i].Lat, response.d[i].Long, response.d[i].ShortDesc) } } } } and on my test master page: <body onload="initialize()"> <form runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePageMethods="true"></asp:ScriptManager> <asp:ContentPlaceHolder ID="MainContent" runat="server"> </asp:ContentPlaceHolder> </form> </body>

  Read the article

• What is GC holes?

  - by tianyi

  I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

  Read the article

• problem to create session of facebook

  - by khoyendra

  try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

  Read the article

• HTML table ignoring element-style width

  - by sangil

  HTML table ignoring element-style width I have an HTML table where certain cells have very long text contents. I want to specify a width (in pixels) for these cells using jQuery, but the rendered table just ignores the given width. Is there any way to force the table to respect this width? Thanks! JSFiddle: http://jsfiddle.net/sangil/6hejy/35/ (If you inspect the cell you can see the the computed width is different than the element-style width) HTML: <div id="tblcont" class="tblcont"> <table id="pivot_table"> <tbody> <tr> <th id="h0" >product</th> <th id="h1" >price</th> <th id="h2" >change</th> </tr> <tr> <!-- this is the cell causing trouble --> <td id="c00" >Acer 2400 aaaaaaaaaaaaaaaaaaaaaaaaaa</td> <td id="c01" >3212</td> <td id="c02" >219</td> </tr> <tr> <td id="c10" >Acer</td> <td id="c11" >3821</td> <td id="c12" >206</td> </tr> </tbody> </table> </div> CSS: .tblcont { overflow: hidden; width: 500px; } table { table-layout: fixed; border-collapse: collapse; overflow-x: scroll; border-spacing:0; width: 100%; } th, td { overflow: hidden; text-overflow: ellipsis; word-wrap: break-word; } th { height: 50px; } ?Javascript: $(document).ready(function() { // THIS LINE HAS NO EFFECT! $('#c00').width(30); });

  Read the article

• how do i know how many clients are calling my WCF service function

  - by ZhengZhiren

  i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

  - by domsom

  I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

  Read the article

• How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

  - by dommer

  I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

  Read the article

• Error with connection in my database servlet

  - by Zerobu

  Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

  Read the article

• C strange array behaviour

  - by LukeN

  After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

  Read the article

• Generic Type constraint in .net

  - by Jose

  Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

  Read the article

• Will this ever result in a stack overflow error?

  - by David

  Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

  Read the article

• Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

  - by jboyd

  Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

  Read the article

• basic operations for modifying a source document with XSLT

  - by SpliFF

  All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

  Read the article

• How to tag photos in facebook-api?

  - by Camillo

  Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

  Read the article

• C++ using cdb_read returns extra characters on some reads

  - by Moe Be

  Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

  Read the article

• php connecting to mysql server(localhost) very slow

  - by Ahmad

  actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

  Read the article

• Calculate minimum moves to solve a puzzle

  - by Luke

  I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

  Read the article

• div popup inside td

  - by sims

  I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

  Read the article

• Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

  - by Pickels

  Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

  Read the article

• Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

  - by Nailuj

  I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

  Read the article

• SQL Server architecture guidance

  - by Liam

  Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

  Read the article

• ASP.Net MVC Ajax form with jQuery validation

  - by Tomas Lycken

  I have an MVC view with a form built with the Ajax.BeginForm() helper method, and I'm trying to validate user input with the jQuery Validation plugin. I get the plugin to highlight the inputs with invalid input data, but despite the invalid input the form is posted to the server. How do I stop this, and make sure that the data is only posted when the form validates? My code The form: <fieldset> <legend>leave a message</legend> <% using (Ajax.BeginForm("Post", new AjaxOptions { UpdateTargetId = "GBPostList", InsertionMode = InsertionMode.InsertBefore, OnSuccess = "getGbPostSuccess", OnFailure = "showFaliure" })) { %> <div class="column" style="width: 230px;"> <p> <label for="Post.Header"> Rubrik</label> <%= Html.TextBox("Post.Header", null, new { @style = "width: 200px;", @class="text required" }) %></p> <p> <label for="Post.Post"> Meddelande</label> <%= Html.TextArea("Post.Post", new { @style = "width: 230px; height: 120px;" }) %></p> </div> <p> <input type="submit" value="OK!" /></p> </fieldset> The JavaScript validation: $(document).ready(function() { // for highlight var elements = $("input[type!='submit'], textarea, select"); elements.focus(function() { $(this).parents('p').addClass('highlight'); }); elements.blur(function() { $(this).parents('p').removeClass('highlight'); }); // for validation $("form").validate(); }); EDIT: As I was getting downvotes for publishing follow-up problems and their solutions in answers, here is also the working validate method... function ajaxValidate() { return $('form').validate({ rules: { "Post.Header": { required: true }, "Post.Post": { required: true, minlength: 3 } }, messages: { "Post.Header": "Please enter a header", "Post.Post": { required: "Please enter a message", minlength: "Your message must be 3 characters long" } } }).form(); }

  Read the article

< Previous Page | 774 775 776 777 778 779 780 781 782 783 784 785  | Next Page >