Search Results

Search found 20799 results on 832 pages for 'long integer'.

Page 778/832 | < Previous Page | 774 775 776 777 778 779 780 781 782 783 784 785  | Next Page >

  • Will this ever result in a stack overflow error?

    - by David
    Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

    Read the article

  • How to tag photos in facebook-api?

    - by Camillo
    Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • problem to create session of facebook

    - by khoyendra
    try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

    Read the article

  • SQL Server 2008: If Multiple Values Set In Other Mutliple Values Set

    - by AJH
    In SQL, is there anyway to accomplish something like this? This is based off a report built in SQL Server Report Builder, where the user can specify multiple text values as a single report parameter. The query for the report grabs all of the values the user selected and stores them in a single variable. I need a way for the query to return only records that have associations to EVERY value the user specified. -- Assume there's a table of Elements with thousands of entries. -- Now we declare a list of properties for those Elements to be associated with. create table #masterTable ( ElementId int, Text varchar(10) ) insert into #masterTable (ElementId, Text) values (1, 'Red'); insert into #masterTable (ElementId, Text) values (1, 'Coarse'); insert into #masterTable (ElementId, Text) values (1, 'Dense'); insert into #masterTable (ElementId, Text) values (2, 'Red'); insert into #masterTable (ElementId, Text) values (2, 'Smooth'); insert into #masterTable (ElementId, Text) values (2, 'Hollow'); -- Element 1 is Red, Coarse, and Dense. Element 2 is Red, Smooth, and Hollow. -- The real table is actually much much larger than this; this is just an example. -- This is me trying to replicate how SQL Server Report Builder treats -- report parameters in its queries. The user selects one, some, all, -- or no properties from a list. The written query treats the user's -- selections as a single variable called @Properties. -- Example scenario 1: User only wants to see Elements that are BOTH Red and Dense. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Dense in (select Text from #masterTable where ElementId = e.Id) --ideally a set containing only Red, Coarse, and Dense --Both Red and Dense are within Element 1's properties (Red, Coarse, Dense), so Element 1 gets returned, but not Element 2. -- Example scenario 2: User only wants to see Elements that are BOTH Red and Hollow. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Hollow in (select Text from #masterTable where ElementId = e.Id) --Both Red and Hollow are within Element 2's properties (Red, Smooth, Hollow), so Element 2 gets returned, but not Element 1. --Example Scenario 3: User only picked the Red option. select e.* from Elements e where (@Properties) --ideally a set containing only Red in (select Text from #masterTable where ElementId = e.Id) --Red is within both Element 1 and Element 2's properties, so both Element 1 and Element 2 get returned. The above syntax doesn't actually work because SQL doesn't seem to allow multiple values on the left side of the "in" comparison. Error that returns: Subquery returned more than 1 value. This is not permitted when the subquery follows =, !=, <, <= , >, >= or when the subquery is used as an expression. Am I even on the right track here? Sorry if the example looks long-winded or confusing.

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • C strange array behaviour

    - by LukeN
    After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

    Read the article

  • One intent is working, second is giving me a crash

    - by user1480742
    ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • Android: onListItemClick not getting called in ListActivity

    - by user521469
    I'm having problems with my first Android app. I have subclassed ListActivity, and I'm having no luck getting the overridden onListItemClick() to respond to click events. I've read focus can be a problem, but changing focus in the XML files does not seem to work. Here's the relevant bits of code. Anyone see what's I've buggered up? public class Notepadv1 extends ListActivity { private int mNoteNumber = 1; private NotesDbAdapter mDbHelper; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.notepad_list); mDbHelper = new NotesDbAdapter(this); mDbHelper.open(); fillData(); } private void fillData() { // Get all of the notes from the database and create the item list Cursor c = mDbHelper.fetchAllNotes(); startManagingCursor(c); String[] from = new String[] { NotesDbAdapter.KEY_TITLE }; int[] to = new int[] { R.id.text1 }; SimpleCursorAdapter notes = new SimpleCursorAdapter(this, R.layout.notes_row, c, from, to); setListAdapter(notes); } @Override public void onListItemClick (ListView l, View v, int position, long id){ super.onListItemClick(l, v, position, id); AlertDialog alert = new AlertDialog.Builder(this).create(); String message = "row clicked!"; alert.setMessage(message); alert.show(); } notepad_list.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@android:id/list" android:layout_width="wrap_content" android:layout_height="wrap_content" android:dividerHeight="6dp"/> <TextView android:id="@android:id/empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/no_notes" /> </LinearLayout> And notes_row.xml <?xml version="1.0" encoding="utf-8"?> <TextView android:id="@+id/text1" xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="60dp" android:focusable="false"/>

    Read the article

  • Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

    - by Pickels
    Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • Across process marhalling problem with an array of points

    - by ElMagn
    Hi All, We have what we think is a marshalling problem with a renderer object when called across process boundaries. The renderer is an ATL COM server with a COM object that implements the IPoints interface defined below: typedef [uuid(B0E01719-005A-427c-B9DD-B42A18E969AE)] struct Point { double X; double Y; } Point; [ object, uuid(3BFECFE3-B4FB-4f14-8257-6E065D02E3B3), helpstring("IPoints Interface"), dual, ] interface IPoints : IDispatch { HRESULT DrawPolyLine([in] long hDC, [in] short count, [in, size_is(count)] Point * points ); // many more like DrawLine } The count parameter represents the number of points and the points parameter represents an array of the actual points. We have two process running, a graphical display process (GDP) and a tabular (grid) display process (TDP). A factory in the GDP, written in C#, creates the renderer and the clients of the renderer in the GDP. When the clients call into the renderer, everything displays correctly. The renderer is created at start up BTW. There is another factory in the TDP, written in VB6, that calls into the factory in the GDP to create the clients. When the clients call into the renderer, only the first point in the array is marshaled correctly, all the other points are garbage. Seems that the rendering works only when the client creation is started from the same process as the renderer. Now, i am not sure what the solution to this problem is. It seems that if we can guarantee that the clients are always created from a thread in the same GDP process as the renderer then the points are marshaled correctly. We tried using a background thread from the Thread Pool in C# and it indeed worked. The problem is that Windows Forms created from the clients stopped working because accessing the form's controls from a thread other than the thread that created the control is not allowed. We might change the calls to access the forms but we have quite a few of them and are trying to look into a different solution that might involve making changes to the renderer. The other problem is that the renderer is legacy code and we can't just change the interface. I am wondering what can we do to the renderer's interface that would help with marshalling from across process calls. Any ideas would be greatly appreciated. Regards, ElMagn

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • remove data layer and put into it's own domain

    - by user334768
    I have a SL4 application that uses EF4 & RIA Services. DB is SQL 2008. All is working well. Now I want to put the Database and web services on one domain (A.com) with the web service exposing the same methods available in my working project. (one listed at top of message) Then put a Silverlight application (same one as above) on domain(B.com) and call the web services on A.com. I thought I had a fair understanding of RIA Services. Enough to get the above application working. Now when I say "working" I do mean on my local dev machine. I have yet to deployed as SL4 & .NET 4 application to my hosting site. But I don't think I understand it well enough. I normally create a new business app, add EF then create the RIA DomainService. Add any [Includes] I need, modify my linq queries and run application. And it works. Now I need to break off my data layer and put it on another hosting site (A.com) And put my UI and business logic on another hosting site (B.com) I think I need to do the following : On the Database & web service site: domain(A.com) create application, create EF4, create RIA Services and deploy. At this time, are the methods exposed available as a "WEB SERVICE" to other applications calling by http:// a.com/serviceName.svc address? I think I need to do the following : On the application site : domain(B.com) create a business application (later will need authentication and navigation). How can I create an EF when I don't have access to the database? (I know I do have access but I want know what happens here when I do not have access to the database, but only data provided by a web service) If I can not create an EF how do I create my RIA Service? I hope any one who takes time to help me understands what I'm asking. Sorry so long.

    Read the article

< Previous Page | 774 775 776 777 778 779 780 781 782 783 784 785  | Next Page >