Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 83/212 | < Previous Page | 79 80 81 82 83 84 85 86 87 88 89 90  | Next Page >

  • Keyboard input with timeout in Python

    - by J. Pablo Fernández
    How would you prompt the user for some input but timing out after N seconds? Google is pointing to a mail thread about it at http://mail.python.org/pipermail/python-list/2006-January/533215.html but it seems not to work. The statement in which the timeout happens, no matter whether it is a sys.input.readline or timer.sleep(), I always get: <type 'exceptions.TypeError'>: [raw_]input expected at most 1 arguments, got 2 which somehow the except fails to catch.

    Read the article

  • Scala: is it possible to override default case class constructor?

    - by adam77
    Just wondering if this is possible. What I would actually like to do is check and possibly modify one of the arguments before it is stored as a val. Alternatively, I could use an overload and make the default constructor private. In which case I would also like to make private the default factory constructor in the companion object, how would I do that? Many thanks. Adam

    Read the article

  • How to modify my Response.Document XSD for getting author name form Sharepoint

    - by Rohan Patil
    Hi, This is my XSD currently <?xml version="1.0" encoding="Windows-1252"?> <xsd:schema xmlns:tns="urn:Microsoft.Search.Response.Document" attributeFormDefault="unqualified" elementFormDefault="qualified" targetNamespace="urn:Microsoft.Search.Response.Document" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <xsd:import namespace="urn:Microsoft.Search.Response.Document.Document" schemaLocation="Microsoft.Search.Response.Document.Document.xsd" /> <xsd:annotation> <xsd:documentation> </xsd:documentation> <xsd:documentation> Defines a Query Respnose from a Windows SharePoint Services 3.0 Query Service. </xsd:documentation> </xsd:annotation> <!-- - - - - - - - - - - - - - - - - - - - - - - - - - --> <!-- Root Element: Document --> <!-- - - - - - - - - - - - - - - - - - - - - - - - - - --> <xsd:element name="Document"> <xsd:complexType> <xsd:sequence> <xsd:element name="Title" type="xsd:string" minOccurs="0" /> <xsd:element name="Action"> <xsd:complexType> <xsd:sequence> <xsd:element name="LinkUrl"> <xsd:complexType> <xsd:simpleContent> <xsd:extension base="xsd:string"> <xsd:attribute name="size" type="xsd:unsignedByte" use="optional" /> <xsd:attribute name="fileExt" type="xsd:string" use="required" /> </xsd:extension> </xsd:simpleContent> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> <xsd:element name="Description" type="xsd:string" minOccurs="0" /> <xsd:element name="Date" type="xsd:dateTime" minOccurs="0" /> <xsd:element xmlns:q1="urn:Microsoft.Search.Response.Document.Document" ref="q1:Properties" minOccurs="0" /> </xsd:sequence> <xsd:attribute name="relevance" type="xsd:unsignedByte" use="optional" /> </xsd:complexType> </xsd:element> </xsd:schema> I want to able to get the author name.. Please help..

    Read the article

  • Running shell scripts with sudo through my web app

    - by nfm
    I have some functionality that interfaces with the server's OS in my web application. I've written a bash script and am able to run it from within my app. However, some functionality of the script requires superuser privileges. What is the most sane way to run this script securely? It is being passed arguments from a web form, but should only be able to be called by authenticated users that I trust not to haxxor it.

    Read the article

  • haskell recursive function

    - by snorlaks
    Hello, Please help me with writing function which takes two arguments : list of ints and index (int) and returns list of integers with negative of value on specified index position in the table MyReverse :: [Int]-Int-[Int] for example myReverse [1,2,3,4,5] 3 = [1,2,-3,4,5] if index is bigger then length of the list or smaller then 0 return the same list. Thanks for help

    Read the article

  • Build error while compiling Android source (JNI)

    - by arTsmarT
    I added some new functionality in C and when I try to build it, it gives me the following error: libnativehelper/include/nativehelper/JNIHelp.h:116: error: undefined reference to 'jniRegisterNativeMethods' error. I have included jnihelp.h in my C files. Is this a makefile related issue or am I missing something? LOCAL_PATH := $(call my-dir) include $(CLEAR_VARS) LOCAL_MODULE_TAGS := optional LOCAL_MODULE := newfile LOCAL_SRC_FILES := newfile.cpp include $(BUILD_SHARED_LIBRARY)

    Read the article

  • string directly before with regular expressions?

    - by acidzombie24
    I have been given a file that has its string like this blah blah DUMMY blah blah DUMMY blah blah VALUE blahX blahY KEY Some values/keys are optional, i cannot depend on order. With regular expressions using C# how do i write an regex that takes the value directly behind the key? I know i could write it in such a way it will match the first DUMMY but i cant think of how to make the VALUE instead.

    Read the article

  • Can a single argument constructor with a default value be subject to implicit type conversion

    - by Richard
    I understand the use of the explicit keyword to avoid the implicit type conversions that can occur with a single argument constructor, or with a constructor that has multiple arguments of which only the first does not have a default value. However, I was wondering, does a single argument constructor with a default value behave the same as one without a default value when it comes to implicit conversions?

    Read the article

  • JQuery UI popup elements not positioning correctly

    - by Okku
    I am using both JQuery UI Dialog and JQuery UI autocomplete both have the same erroneous behavior when they popup, the position is always 0,0! I have tried some different position arguments when popping up the dialog but non seems to help. Any clues? Is this a bug in the position calculation in JQuery? Or is this some css bug? Versions are 1.4.2 and 1.8.0

    Read the article

  • Image editor component in Flex / JavaScript

    - by nobby
    Hi everyone, I'm looking for a simple Flex or JavaScript based image editing component which can be embedded in a web application. It shouldn't be a web service but rather a component that I can download and customize (i18n etc.). I only need some basic features: most important is cropping, optional features would be rotating and adjusting brightness/contrast. Basically something like splashup.com, but as an open source application rather than a web-service. Thanks a lot in advance for any hints! -- Andreas

    Read the article

  • Why we need to read() before write() in TCP server program?

    - by Naga
    Hi, As per my understanding a simple TCP server will be coded as follows. socket() - bind() - listen() - accept() - read() - write() The clients will be written as follows. socket() - bind()(Optional) - connect() - write() - read() Please note the order difference in read() and write() calls between client and server program. Is it a requirement to always read() before write() in a server program and if, then why? Thanks, Naga

    Read the article

  • use viewengine only within certain area

    - by Daniel Powell
    Is it possible to use a custom view engine for a specific area only? I have tried public override void RegisterArea(AreaRegistrationContext context) { context.MapRoute( "Forms_default", "Forms/{client}/{controller}/{action}/{id}", new { client="Generic",action = "Index", id = UrlParameter.Optional } ); ViewEngines.Engines.Clear(); ViewEngines.Engines.Add(new ClientSpecificViewEngine()); } Within my area but this seems to be a site wide affect as I'm getting errors specific to the custom view engine when visiting pages outside the area.

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • LINQ Query returns nothing.

    - by gtas
    Why is this query returns 0 lines? There is a record matching the arguments. Deafkaw.Where(p => (p.ImerominiaKataxorisis >= aDate && p.ImerominiaKataxorisis <= DateTime.Now) && (p.Year == etos && p.IsYpodeigma == false) ).ToList(); Am i missing something?

    Read the article

  • Javascript: Inline function vs predefined functions

    - by glaz666
    Can any body throw me some arguments for using inline functions against passing predefined function name to some handler. I.e. which is better: (function(){ setTimeout(function(){ /*some code here*/ }, 5); })(); versus (function(){ function invokeMe() { /*code*/ } setTimeout(invokeMe, 5); })(); Strange question, but we are almost fighting in the team about this

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

< Previous Page | 79 80 81 82 83 84 85 86 87 88 89 90  | Next Page >