Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 84/212 | < Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >

  • jQuery plugin for formatting inputs

    - by antony.trupe
    I want to accept values in any of the following format: -$5 -$5.00 $5 $5.00 Is it possible to do that using Masked Input Plugin? If not, what plug-in am I looking for? How do I indicate a character is optional? The code I've got so far $.mask.definitions['~']='[ +-]'; $(".currency").mask("~$9");

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Why does Scala apply thunks automatically, sometimes?

    - by Anonymouse
    At just after 2:40 in ShadowofCatron's Scala Tutorial 3 video, it's pointed out that the parentheses following the name of a thunk are optional. "Buh?" said my functional programming brain, since the value of a function and the value it evaluates to when applied are completely different things. So I wrote the following to try this out. My thought process is described in the comments. object Main { var counter: Int = 10 def f(): Int = { counter = counter + 1; counter } def runThunk(t: () => Int): Int = { t() } def main(args: Array[String]): Unit = { val a = f() // I expect this to mean "apply f to no args" println(a) // and apparently it does val b = f // I expect this to mean "the value f", a function value println(b) // but it's the value it evaluates to when applied to no args println(b) // and the evaluation happens immediately, not in the call runThunk(b) // This is an error: it's not println doing something funny runThunk(f) // Not an error: seems to be val doing something funny } }   To be clear about the problem, this Scheme program (and the console dump which follows) shows what I expected the Scala program to do. (define counter (list 10)) (define f (lambda () (set-car! counter (+ (car counter) 1)) (car counter))) (define runThunk (lambda (t) (t))) (define main (lambda args (let ((a (f)) (b f)) (display a) (newline) (display b) (newline) (display b) (newline) (runThunk b) (runThunk f)))) > (main) 11 #<procedure:f> #<procedure:f> 13   After coming to this site to ask about this, I came across this answer which told me how to fix the above Scala program: val b = f _ // Hey Scala, I mean f, not f() But the underscore 'hint' is only needed sometimes. When I call runThunk(f), no hint is required. But when I 'alias' f to b with a val then apply it, it doesn't work: the evaluation happens in the val; and even lazy val works this way, so it's not the point of evaluation causing this behaviour.   That all leaves me with the question: Why does Scala sometimes automatically apply thunks when evaluating them? Is it, as I suspect, type inference? And if so, shouldn't a type system stay out of the language's semantics? Is this a good idea? Do Scala programmers apply thunks rather than refer to their values so much more often that making the parens optional is better overall? Examples written using Scala 2.8.0RC3, DrScheme 4.0.1 in R5RS.

    Read the article

  • Why we need to read() before write() in TCP server program?

    - by Naga
    Hi, As per my understanding a simple TCP server will be coded as follows. socket() - bind() - listen() - accept() - read() - write() The clients will be written as follows. socket() - bind()(Optional) - connect() - write() - read() Please note the order difference in read() and write() calls between client and server program. Is it a requirement to always read() before write() in a server program and if, then why? Thanks, Naga

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Memory Allocation Error in MySQL

    - by Chinjoo
    I am using MySql ODBC driver with .Net 3.5. I have created a stored procedure in MySQl which accepts around 15 parameters with types like datetime, varchar, Int32, Int64 etc.. When I run the SP from the query window with the arguments provided, it runs fine. But whwn I test using the .Net application, it gives exception with "Memory allocation error", MySQL native error code is 4001. Any help will be much appreciated.

    Read the article

  • Help with C# program design implementation: multiple array of lists or a better way?

    - by Bob
    I'm creating a 2D tile-based RPG in XNA and am in the initial design phase. I was thinking of how I want my tile engine to work and came up with a rough sketch. Basically I want a grid of tiles, but at each tile location I want to be able to add more than one tile and have an offset. I'd like this so that I could do something like add individual trees on the world map to give more flair. Or set bottles on a bar in some town without having to draw a bunch of different bar tiles with varying bottles. But maybe my reach is greater than my grasp. I went to implement the idea and had something like this in my Map object: List<Tile>[,] Grid; But then I thought about it. Let's say I had a world map of 200x200, which would actually be pretty small as far as RPGs go. That would amount to 40,000 Lists. To my mind I think there has to be a better way. Now this IS pre-mature optimization. I don't know if the way I happen to design my maps and game will be able to handle this, but it seems needlessly inefficient and something that could creep up if my game gets more complex. One idea I have is to make the offset and the multiple tiles optional so that I'm only paying for them when needed. But I'm not sure how I'd do this. A multiple array of objects? object[,] Grid; So here's my criteria: A 2D grid of tile locations Each tile location has a minimum of 1 tile, but can optionally have more Each extra tile can optionally have an x and y offset for pinpoint placement Can anyone help with some ideas for implementing such a design (don't need it done for me, just ideas) while keeping memory usage to a minimum? If you need more background here's roughly what my Map and Tile objects amount to: public struct Map { public Texture2D Texture; public List<Rectangle> Sources; //Source Rectangles for where in Texture to get the sprite public List<Tile>[,] Grid; } public struct Tile { public int Index; //Where in Sources to find the source Rectangle public int X, Y; //Optional offsets }

    Read the article

  • XSD and plain text

    - by Paul Knopf
    I have a rest/xml service that gives me the following... <verse-unit unit-id="38009001"> <marker class="begin-verse" mid="v38009001"/> <begin-chapter num="9"/><heading>Judgment on Israel&apos;s Enemies</heading> <begin-block-indent/> <begin-paragraph class="line-group"/> <begin-line/><verse-num begin-chapter="9">1</verse-num>The burden of the word of the <span class="divine-name">Lord</span> is against the land of Hadrach<end-line class="br"/> <begin-line class="indent"/>and Damascus is its resting place.<end-line class="br"/> <begin-line/>For the <span class="divine-name">Lord</span> has an eye on mankind<end-line class="br"/> <begin-line class="indent"/>and on all the tribes of Israel,<footnote id="f1"> A slight emendation yields <i> For to the <span class="divine-name">Lord</span> belongs the capital of Syria and all the tribes of Israel </i> </footnote><end-line class="br"/> </verse-unit> I used visual studio to generate a schema from this and used XSD.EXE to generate classes that I can use to deserialize this mess into programmable stuff. I got everything to work and it is deserialized perfectly (almost). The problem I have is with the random text mixed throughout the child nodes. The generated verse-unit objects gives me a list of objects (begin-line, begin-block-indent, etc), and also another list of string objects that represent the bits of string throughout the xml. Here is my schema <xs:element maxOccurs="unbounded" name="verse-unit"> <xs:complexType mixed="true"> <xs:sequence> <xs:choice maxOccurs="unbounded"> <xs:element name="marker"> <xs:complexType> <xs:attribute name="class" type="xs:string" use="required" /> <xs:attribute name="mid" type="xs:string" use="required" /> </xs:complexType> </xs:element> <xs:element name="begin-chapter"> <xs:complexType> <xs:attribute name="num" type="xs:unsignedByte" use="required" /> </xs:complexType> </xs:element> <xs:element name="heading"> <xs:complexType mixed="true"> <xs:sequence minOccurs="0"> <xs:element name="span"> <xs:complexType> <xs:simpleContent> <xs:extension base="xs:string"> <xs:attribute name="class" type="xs:string" use="required" /> </xs:extension> </xs:simpleContent> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="begin-block-indent" /> <xs:element name="begin-paragraph"> <xs:complexType> <xs:attribute name="class" type="xs:string" use="required" /> </xs:complexType> </xs:element> <xs:element name="begin-line"> <xs:complexType> <xs:attribute name="class" type="xs:string" use="optional" /> </xs:complexType> </xs:element> <xs:element name="verse-num"> <xs:complexType> <xs:simpleContent> <xs:extension base="xs:unsignedByte"> <xs:attribute name="begin-chapter" type="xs:unsignedByte" use="optional" /> </xs:extension> </xs:simpleContent> </xs:complexType> </xs:element> <xs:element name="end-line"> <xs:complexType> <xs:attribute name="class" type="xs:string" use="optional" /> </xs:complexType> </xs:element> <xs:element name="end-paragraph" /> <xs:element name="end-block-indent" /> <xs:element name="end-chapter" /> </xs:choice> </xs:sequence> <xs:attribute name="unit-id" type="xs:unsignedInt" use="required" /> </xs:complexType> </xs:element> WHAT I NEED IS THIS. I need the random text that is NOT surrounded by an xml node to be represented by an object so I know the order that everything is in. I know this is complicated, so let me try to simplify it. <field name="test_field_0"> Some text I'm sure you don't want. <subfield>Some text.</subfield> More text you don't want. </field> I need the xsd to generate a field object with items that can have either a text object, or a subfield object. I need to no where the random text is within the child nodes.

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

< Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >