Search Results

Search found 5279 results on 212 pages for 'optional arguments'.

Page 85/212 | < Previous Page | 81 82 83 84 85 86 87 88 89 90 91 92  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • drupal editing user information after registration

    - by Arun
    how to allow user to edit their information after registration. And moreover how add new fields during editing information. for ex: my primary registration holds name,email,picture(optional). I want to get additional information like state,city,... when they wants some customized service. May any one suggest me a solution .

    Read the article

  • jquery dialog form with dynamic variables

    - by Patrick
    Hello, Currently I have an html form - which I call with jquery dialog - to insert new records into a table. But I also would like to update existing records with the same form - using jquery dialog. I'm not sure within the dialog how I access these data values - or pass them in as arguments - and hook them up with the form elements...? Anyone has done this before and knows an agile technique to do this? kind regards, Patrick

    Read the article

  • How does Eclipse/IDEA/etc. debugger obtain the information about local variable values and watch exp

    - by Bubba88
    I always thought that varibales are mapped to stack locations once your Java source is compiled; additionally, they may include the info about the variable names and their scope in classfiles, but that's optional AFAIK. The question is - how do my Eclipse/IDEA IDEs allow me to set a watch expression containing the local variable name? To me, it's hard to understand :)

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • Execute a Application On The Server Using VBScript

    - by Nathan Campos
    I have an application on my server that is called leaf.exe, that haves two arguments needed to run, they are: inputfile and outputfile, that will be like this example: leaf.exe input.jpg output.leaf They are all on the same directory as my home page file(the executable and the input file). But I need that a VBScript could run the application like that, then I want to know how could I do this.

    Read the article

  • Changing forecolor according to backcolor

    - by strakastroukas
    Dear SO family, I have created an iframe which contains the label, "powered by MyWebsite.site" The "iframe itself" accepts arguments, so other webmasters may customize the appearance of it. The problem is that since the background of the iframe could be customized, anyone can "vanish" the "powered by MyWebsite.site". So what option do i have? How should i dynamically change the label color depending on any background?

    Read the article

  • how to get $form_state outside of FAPI's functions?

    - by logii
    I'm writing a custom module and I'd like to use $form_state of the current form in another non-form api function - custom_facet_view_build(). any help is appreciated :) <?php /** * Implementation of hook_perm(). */ function custom_facet_perm() { return array( 'access foo content', 'access baz content', ); } /** * Implementation of hook_menu(). */ function custom_facet_menu() { $items['faceted-search'] = array( 'title' => 'Faceted Search', 'page callback' => 'drupal_get_form', 'access arguments' => array(), ); $items['facet-search-test'] = array( 'page callback' => 'drupal_get_form', 'page arguments' => array('custom_facet_form'), 'access callback' => TRUE, 'type' => MENU_CALLBACK, ); return $items; } /** * Form definition; ahah_helper_demo form. */ function custom_facet_form($form_state) { $form = array(); ahah_helper_register($form, $form_state); if (isset($form_state['storage']['categories'])) { $categories_default_value = $form_state['storage']['categories']["#value"]; } $form['facet_search_form'] = array( '#type' => 'fieldset', '#title' => t('Faceted Search'), '#prefix' => '<div id="billing-info-wrapper">', // This is our wrapper div. '#suffix' => '</div>', '#tree' => TRUE, // Don't forget to set #tree! ); $form['facet_search_form']['categories'] = array( '#type' => 'select', '#title' => t('Category'), '#options' => _custom_facet_taxonomy_query(1), '#multiple' => TRUE, '#default_value' => $categories_default_value, ); $form['save'] = array( '#type' => 'submit', '#value' => t('Save'), ); return $form; } /** * Validate callback for the form. */ function custom_facet_form_validate($form, &$form_state) { } /** * Submit callback for the form. */ function custom_facet_form_submit($form, &$form_state) { drupal_set_message('nothing done'); $form_state['storage']['categories'] = $form['facet_search_form']['categories']; // dpm($form_state); // There's a value returned in form_state['storage] within this function } /** * Implementation of hook_views_api(). */ function custom_facet_views_api() { return array( 'api' => 2, ); } function custom_facet_view_build(&$view) { dpm($form_state); // form_state['storage] remains NULL even though there's a value on previous submission }

    Read the article

  • What would be a correct implemantation of JSF Converter if I need to get an Integer to run a query?

    - by Ignacio
    HI here's my code: List.xhmtl <h:selectOneMenu value="#{produtosController.items}"> <f:selectItems value="#{produtosController.itemsAvailableSelectOne}"/> </h:selectOneMenu> <h:commandButton action="#{produtosController.createByCodigos}" value="Buscar" /> My Controller Class with innner Converter implemantation @ManagedBean (name="produtosController") @SessionScoped public class ProdutosController { private Produtos current; private DataModel items = null; @EJB private controladores.ProdutosFacade ejbFacade; private PaginationHelper pagination; private int selectedItemIndex; public ProdutosController() { } public Produtos getSelected() { if (current == null) { current = new Produtos(); selectedItemIndex = -1; } return current; } private ProdutosFacade getFacade() { return ejbFacade; } public PaginationHelper getPagination() { if (pagination == null) { pagination = new PaginationHelper(10) { @Override public int getItemsCount() { return getFacade().count(); } @Override public DataModel createPageDataModel() { return new ListDataModel(getFacade().findRange(new int[]{getPageFirstItem(), getPageFirstItem()+getPageSize()})); } }; } return pagination; } public String prepareList() { recreateModel(); return "List"; } public String prepareView() { current = (Produtos)getItems().getRowData(); selectedItemIndex = pagination.getPageFirstItem() + getItems().getRowIndex(); return "View"; } public String prepareCreate() { current = new Produtos(); selectedItemIndex = -1; return "Create"; } public String create() { try { getFacade().create(current); JsfUtil.addSuccessMessage(ResourceBundle.getBundle("/Bundle").getString("ProdutosCreated")); return prepareCreate(); } catch (Exception e) { JsfUtil.addErrorMessage(e, ResourceBundle.getBundle("/Bundle").getString("PersistenceErrorOccured")); return null; } } public String createByMarcas() { items = new ListDataModel(ejbFacade.findByMarcas(current.getIdMarca())); updateCurrentItem(); return "List"; } public String createByModelos() { items = new ListDataModel(ejbFacade.findByModelos(current.getIdModelo())); updateCurrentItem(); return "List"; } public String createByCodigos(){ items = new ListDataModel(ejbFacade.findByCodigo(current.getCodigo())); updateCurrentItem(); return "List"; } public String prepareEdit() { current = (Produtos)getItems().getRowData(); selectedItemIndex = pagination.getPageFirstItem() + getItems().getRowIndex(); return "Edit"; } public String update() { try { getFacade().edit(current); JsfUtil.addSuccessMessage(ResourceBundle.getBundle("/Bundle").getString("ProdutosUpdated")); return "View"; } catch (Exception e) { JsfUtil.addErrorMessage(e, ResourceBundle.getBundle("/Bundle").getString("PersistenceErrorOccured")); return null; } } public String destroy() { current = (Produtos)getItems().getRowData(); selectedItemIndex = pagination.getPageFirstItem() + getItems().getRowIndex(); performDestroy(); recreateModel(); return "List"; } public String destroyAndView() { performDestroy(); recreateModel(); updateCurrentItem(); if (selectedItemIndex >= 0) { return "View"; } else { // all items were removed - go back to list recreateModel(); return "List"; } } private void performDestroy() { try { getFacade().remove(current); JsfUtil.addSuccessMessage(ResourceBundle.getBundle("/Bundle").getString("ProdutosDeleted")); } catch (Exception e) { JsfUtil.addErrorMessage(e, ResourceBundle.getBundle("/Bundle").getString("PersistenceErrorOccured")); } } private void updateCurrentItem() { int count = getFacade().count(); if (selectedItemIndex >= count) { // selected index cannot be bigger than number of items: selectedItemIndex = count-1; // go to previous page if last page disappeared: if (pagination.getPageFirstItem() >= count) { pagination.previousPage(); } } if (selectedItemIndex >= 0) { current = getFacade().findRange(new int[]{selectedItemIndex, selectedItemIndex+1}).get(0); } } public DataModel getItems() { if (items == null) { items = getPagination().createPageDataModel(); } return items; } private void recreateModel() { items = null; } public String next() { getPagination().nextPage(); recreateModel(); return "List"; } public String previous() { getPagination().previousPage(); recreateModel(); return "List"; } public SelectItem[] getItemsAvailableSelectMany() { return JsfUtil.getSelectItems(ejbFacade.findAll(), false); } public SelectItem[] getItemsAvailableSelectOne() { return JsfUtil.getSelectItems(ejbFacade.findAll(), true); } @FacesConverter(forClass=Produtos.class) public static class ProdutosControllerConverter implements Converter{ public Object getAsObject(FacesContext facesContext, UIComponent component, String value) { if (value == null || value.length() == 0) { return null; } ProdutosController controller = (ProdutosController)facesContext.getApplication().getELResolver(). getValue(facesContext.getELContext(), null, "produtosController"); return controller.ejbFacade.find(getKey(value)); } java.lang.Integer getKey(String value) { java.lang.Integer key; key = Integer.decode(value); return key; } String getStringKey(java.lang.Integer value) { StringBuffer sb = new StringBuffer(); sb.append(value); return sb.toString(); } public String getAsString(FacesContext facesContext, UIComponent component, Object object) { if (object == null) { return null; } if (object instanceof Produtos) { Produtos o = (Produtos) object; return getStringKey(o.getCodigo()); } else { throw new IllegalArgumentException("object " + object + " is of type " + object.getClass().getName() + "; expected type: "+ProdutosController.class.getName()); } } } } and my EJB @Entity @ViewScoped @Table(name = "produtos") @NamedQueries({ @NamedQuery(name = "Produtos.findAll", query = "SELECT p FROM Produtos p"), @NamedQuery(name = "Produtos.findById", query = "SELECT p FROM Produtos p WHERE p.id = :id"), @NamedQuery(name = "Produtos.findByCodigo", query = "SELECT p FROM Produtos p WHERE p.codigo = :codigo"), @NamedQuery(name = "Produtos.findByDescripcion", query = "SELECT p FROM Produtos p WHERE p.descripcion = :descripcion"), @NamedQuery(name = "Produtos.findByImagen", query = "SELECT p FROM Produtos p WHERE p.imagen = :imagen"), @NamedQuery(name = "Produtos.findByMarcas", query="SELECT m FROM Produtos m WHERE m.idMarca.id = :idMarca"), @NamedQuery(name = "Produtos.findByModelos", query="SELECT m FROM Produtos m WHERE m.idModelo.id = :idModelo")}) public class Produtos implements Serializable { private static final long serialVersionUID = 1L; @Id @GeneratedValue(strategy = GenerationType.IDENTITY) @Basic(optional = false) @Column(name = "id") private Integer id; @Column(name = "codigo") private Integer codigo; @Column(name = "descripcion") private String descripcion; @Column(name = "imagen") private String imagen; @JoinColumn(name = "id_modelo", referencedColumnName = "id") @ManyToOne(optional = false) private Modelos idModelo; @JoinColumn(name = "id_marca", referencedColumnName = "id") @ManyToOne(optional = false) private Marcas idMarca; public Produtos() { } public Produtos(Integer id) { this.id = id; } public Integer getId() { return id; } public void setId(Integer id) { this.id = id; } public Integer getCodigo() { return codigo; } public void setCodigo(Integer codigo) { this.codigo = codigo; } public String getDescripcion() { return descripcion; } public void setDescripcion(String descripcion) { this.descripcion = descripcion; } public String getImagen() { return imagen; } public void setImagen(String imagen) { this.imagen = imagen; } public Modelos getIdModelo() { return idModelo; } public void setIdModelo(Modelos idModelo) { this.idModelo = idModelo; } public Marcas getIdMarca() { return idMarca; } public void setIdMarca(Marcas idMarca) { this.idMarca = idMarca; } @Override public int hashCode() { int hash = 0; hash += (id != null ? id.hashCode() : 0); return hash; } @Override public boolean equals(Object object) { // TODO: Warning - this method won't work in the case the id fields are not set if (!(object instanceof Produtos)) { return false; } Produtos other = (Produtos) object; if ((this.id == null && other.id != null) || (this.id != null && !this.id.equals(other.id))) { return false; } return true; } @Override public String toString() { return "" + codigo + ""; } }

    Read the article

  • error in creating my own Robot class in android..

    - by manju
    Hi All, I have decided to create my own Java's Robot class in android to take screen capture..i have written the source code of the robot class by my own but the problem is here, the following line in the code is throwing compilation error..saying "The method createRobot(Robot, GraphicsDevice) in the type ComponentFactory is not applicable for the arguments (Robot, GraphicsDevice)" peer = ((ComponentFactory)toolkit).createRobot(this, screen); Can anyone suggest me what would be the solution.... thanks..

    Read the article

  • Patterns for wrapping a command line tool in another language

    - by Tom Duckering
    I'm currently writing some Java to wrap around an extensive command line tool. It feels like I'm writing a lot of similar code. I'm wondering if there are any established patterns for wrapping command line tools - passing arguments and handling output and so on. Specific examples in Java would obviously be great, but any general suggestions or pointers are welcome too.

    Read the article

  • Python tkInter text entry validation

    - by meade
    I'm trying to validate the entry of text using Python/tkInter def validate_text(): return False text = Entry(textframe, validate="focusout", validatecommand=validate_text) where validate_text is the function - I've tried always returning False and always returning True and there's no difference in the outcome..? Is there a set of arguments in the function that I need to include? Edit - changed from NONE to focusout...still not working

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

  • Deploy .net MVC 2 appication on IIS6

    - by munish
    I want to deploy my .net MVC 2 appication on IIS6.0. Will it require to change route path in global.asax file. In my application i have used html link, ajax request and Html.ActionLink. The code lines in the Global.asax file are: routes.MapRoute( "LogOn", "{controller}/{action}/{id}", new { controller = "Account", action = "Index", id = UrlParameter.Optional } ); Please suggest me. Thanks and Regards Munish

    Read the article

  • What are some reasons that application:didFinishLaunchingWithOptions method could get skipped?

    - by BeachRunnerJoe
    My iPad app was working fine until I opened up IB and started editing the interface. Now, my application:didFinishLaunchingWithOptions isn't getting called. I understand it's an optional function and it gets skipped if it doesn't exist, but in my case it does. What are some reasons that application:didFinishLaunchingWithOptions method could get skipped? Thanks in advance for your help!

    Read the article

  • Search for -1 in Solr

    - by Znarkus
    Hi! I have an optional property of type pfloat, that can either be an encoded numeric value, or -1 if the property is not set. Numerics are encoded to be range searchable (1 is encoded to something like 10000000001), but -1 will always be -1. How can I search a field for -1? property:-1 throws parse error and property:'-1' doesn't return anything. Thanks for help!

    Read the article

  • Call trace in Android

    - by DenMark
    I want to know how to do method tracing for Android applications. I mean, a sequence of calls on each object, not a stack trace. It's very similar to this question (Call trace in java), but on different platforms (jvm-PC vs dvm-Android). I have no control over the start arguments of dalvik, thus I cannot specify a java agent (or am I wrong here?). Is there another way to do method tracing? Thanks!

    Read the article

  • Variable popen calls in C

    - by Bushman
    I'm trying to execute MS-DOS DEL commands inside a Win32 C program, and I already know that system and popen can be used for this. However, the problem is that both require string literals (type const char) for the commands, and I need something like the DOS equivalent of dir ~ | grep -P '/\d{7,8}\.exe$/' | rm, which obviously can't use string literals. Is there some other subprocess function in C that allows for char arrays as arguments for process names?

    Read the article

  • splat operator in groovy?

    - by IttayD
    def foo(map, name) { println(map) } foo("bar", hi: "bye") will print [hi:bye] Now I have a previous map that I wish to pass along to foo. In pseudo code, something like: def otherMap = [hi: "world"] foo("bar", hi: "bye", otherMap*) So that it prints [hi:world] This doesn't work of course. Also, trying to pass just the map mixes the order of arguments: def otherMap = [hi: "world"] foo("bar", otherMap) will print bar How can I fix this?

    Read the article

  • Doing things with objects as if they were parents

    - by General Ackbar
    Sorry that this is probably a super noob question. But the following code give me an error saying that there are invalid arguments in my call of doStuffToLines(segments) shouldnt I be able to do this since I have my DimensionLineSegment inherits from Lines? private void doStuff() { List<DimensionLineSegment> segments = new List<DimensionLineSegment>(); doStuffToLines(segments); } private void doStuffToLines(List<Line> lines) { }

    Read the article

< Previous Page | 81 82 83 84 85 86 87 88 89 90 91 92  | Next Page >