Search Results

Search found 21960 results on 879 pages for 'program termination'.

Page 831/879 | < Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • OpenGL Coordinate system confusion

    - by user146780
    Maybe I set up GLUT wrong. Basically I want verticies to be reletive to their size in pixels. Ex:right now if I create a hexagon, it hakes up the whole screen even though the units are 6. #include <iostream> #include <stdlib.h> //Needed for "exit" function #include <cmath> //Include OpenGL header files, so that we can use OpenGL #ifdef __APPLE__ #include <OpenGL/OpenGL.h> #include <GLUT/glut.h> #else #include <GL/glut.h> #endif using namespace std; //Called when a key is pressed void handleKeypress(unsigned char key, //The key that was pressed int x, int y) { //The current mouse coordinates switch (key) { case 27: //Escape key exit(0); //Exit the program } } //Initializes 3D rendering void initRendering() { //Makes 3D drawing work when something is in front of something else glEnable(GL_DEPTH_TEST); } //Called when the window is resized void handleResize(int w, int h) { //Tell OpenGL how to convert from coordinates to pixel values glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); //Switch to setting the camera perspective //Set the camera perspective glLoadIdentity(); //Reset the camera gluPerspective(45.0, //The camera angle (double)w / (double)h, //The width-to-height ratio 1.0, //The near z clipping coordinate 200.0); //The far z clipping coordinate } //Draws the 3D scene void drawScene() { //Clear information from last draw glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glLoadIdentity(); //Reset the drawing perspective glPolygonMode(GL_FRONT_AND_BACK, GL_FILL); glBegin(GL_POLYGON); //Begin quadrilateral coordinates //Trapezoid glColor3f(255,0,0); for(int i = 0; i < 6; ++i) { glVertex2d(sin(i/6.0*2* 3.1415), cos(i/6.0*2* 3.1415)); } glEnd(); //End quadrilateral coordinates glutSwapBuffers(); //Send the 3D scene to the screen } int main(int argc, char** argv) { //Initialize GLUT glutInit(&argc, argv); glutInitDisplayMode(GLUT_DOUBLE | GLUT_RGBA | GLUT_DEPTH); glutInitWindowSize(400, 400); //Set the window size //Create the window glutCreateWindow("Basic Shapes - videotutorialsrock.com"); initRendering(); //Initialize rendering //Set handler functions for drawing, keypresses, and window resizes glutDisplayFunc(drawScene); glutKeyboardFunc(handleKeypress); glutReshapeFunc(handleResize); glutMainLoop(); //Start the main loop. glutMainLoop doesn't return. return 0; //This line is never reached } How can I make it so that a polygon of 0,0 10,0 10,10 0,10 defines a polygon starting at the top left of the screen and is a width and height of 10 pixels? Thanks

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • StringBuffer wont read whole stream into a string (JAVA/Android)

    - by Levara
    Hi all! I'm making an android program that retrieves content of a webpage using HttpURLConnection. I'm new to both Java and Android. Problem is: Reader reads whole page source, but in the last while iteration it doesn't append to stringBuffer that last part. Using debbuger I have determined that, in the last loop iteration, string buff is created, but stringBuffer just doesnt append it. I need to parse retrieved content. Is there any better way to handle the content for parsing than using strings. I've read on numerous other sites that string size in Java is limited only by available heap size. I've tried with StringBuilder too. Anyone know what could be the problem. Btw feel free to suggest any improvements to the code. Thanks! URL u; try { u = new URL("http://feeds.timesonline.co.uk/c/32313/f/440134/index.rss"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestProperty("User-agent","Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.1; SV1; .NET CLR 1.1.4322; InfoPath.1; .NET CLR 2.0.50727)"); c.setRequestMethod("GET"); c.setDoOutput(true); c.setReadTimeout(3000); c.connect(); StringBuffer stringBuffer = new StringBuffer(""); InputStream in = c.getInputStream(); InputStreamReader inp = new InputStreamReader(in); BufferedReader reader = new BufferedReader(inp); char[] buffer = new char[3072]; int len1 = 0; while ( (len1 = reader.read(buffer)) != -1 ) { String buff = new String(buffer,0,len1); stringBuffer.append(buff); } String stranica = new String(stringBuffer); c.disconnect(); reader.close(); inp.close(); in.close();

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • Two loops speeds drawing in a Jframe

    - by noahn567
    I have a program that requires two classes. The player-Names class, and the Player-Model class. I want the player-Names class to repaint every half second, and the Player-Model class to repaint 60 times per second because i want the movement to be smooth. The problem that i am having is that i want all of this to be done on one J-frame. How would i go about doing this? If you could lead me in the right direction or give me a little example that would be great! Thank you :). for some reason it wont let me post so i'm going to put in some random code import java.awt.Color; import java.awt.Font; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.RenderingHints; import javax.swing.JComponent; import javax.swing.JFrame; public class PlayerNames extends JFrame { static int connectionTimer = 0; static int connectionTimer2 = 0; static int reconnect = 0; static int reconnectValue = 1; static int x = 0; static int reconnectWait = connectionTimer + reconnectValue; private static final long serialVersionUID = 1L; public graph gg = new graph(); public graph g = new graph(); private static GameClient socketClient; private GameServer socketServer; public static void main(int width, int height) { PlayerNames tt = new PlayerNames(); // PlayerGraphics t = new PlayerGraphics(); tt.setSize(width, height); if (Game.ServerOwner == 1) { tt.setTitle("Server: " + Game.username); } else { tt.setTitle("Username: " + Game.username); } tt.setVisible(true); tt.getContentPane().add(tt.gg); tt.getContentPane().add(tt.g); tt.setDefaultCloseOperation(EXIT_ON_CLOSE); tt.setResizable(false); }

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • Random generates same number in java

    - by user1613360
    This is my java code. import java.io.*; import java.util.*; import java.util.concurrent.TimeUnit; class search { private int numelem; private int[] input=new int[100]; public void setNumofelem() { System.out.println("Enter the total numebr of elements"); Scanner yz=new Scanner(System.in); numelem=yz.nextInt(); } public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { input[j]=rand.nextInt(max)+1; } } public void printinput() { int b=numelem,t=0; while(true) if(b!=0) { System.out.print(" "+input[t]); b--; t++; } else break; } } public class mycode { public static void main(String args[]) throws Exception { search a=new search(); a.setNumofelem(); a.randomnumber(); a.printinput(); } } Now the function randomnumber() just returns the same number.The function executes perfectly if I execute it as a separate java program but fails miserably if I call it using an object.I have also tried the following variations but nothing works everything return the same number. Variation 1: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { TimeUnit.SECONDS.sleep(1); input[j]=rand.nextInt(max)+1; } } Variation 2: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { rand.setSeed(System.nanoTime()); input[j]=rand.nextInt(max)+1; } } Variation 3: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { TimeUnit.SECONDS.sleep(1); rand.setSeed(System.nanoTime()); input[j]=rand.nextInt(max)+1; } } Sample input/Output: Enter the number of elements: 5 23 23 23 23 23 23

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Pointers to class fields

    - by newbie_cpp
    My task is as follows : Using pointers to class fields, create menu allowing selection of ice, that Person can buy in Ice shop. Buyer will be charged with waffel and ice costs. Selection of ice and charging buyers account must be shown in program. Here's my Person class : #include <iostream> using namespace std; class Iceshop { const double waffel_price = 1; public: } class Person { static int NUMBER; char* name; int age; const int number; double plus, minus; public: class Account { int number; double resources; public: Account(int number, double resources) : number(number), resources(resources) {} } Person(const char* n, int age) : name(strcpy(new char[strlen(n)+1],n)), number(++NUMBER), plus(0), minus(0), age(age) {} Person::~Person(){ cout << "Destroying resources" << endl; delete [] name; } friend void show(Person &p); int* take_age(){ return &age; } char* take_name(){ return name; } void init(char* n, int a) { name = n; age = a; } Person& remittance(double d) { plus += d; return *this; } Person& paycheck(double d) { minus += d; return *this; } Account* getAccount(); }; int Person:: Person::Account* Person::getAccount() { return new Account(number, plus - minus); } void Person::Account::remittance(double d){ resources = resources + d; } void Person::Account::paycheck(double d){ resources = resources - d; } void show(Person *p){ cout << "Name: " << p->take_name() << "," << "age: " << p->take_age() << endl; } int main(void) { Person *p = new Person; p->init("Mary", 25); show(p); p->remittance(100); system("PAUSE"); return 0; } How to start this task ? Where and in what form should I store menu options ?

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • C++ segmentation error when first parameter is null in comparison operator overload

    - by user1774515
    I am writing a class called Word, that handles a c string and overloads the <, , <=, = operators. word.h: friend bool operator<(const Word &a, const Word &b); word.cc: bool operator<(const Word &a, const Word &b) { if(a == NULL && b == NULL) return false; if(a == NULL) return true; if(b == NULL) return false; return a.wd < b.wd; //wd is a valid c string } main: char* temp = NULL; //EDIT: i was mistaken, temp is a char pointer Word a("blah"); //a.wd = [b,l,a,h] cout << (temp<a); i get a segmentation error before the first line of the operator< method after the last line in the main. I can correct the problem by writing cout << (a>temp); where the operator> is similarly defined and i get no errors. but my assignment requires (temp < a) to work so this is where i ask for help. EDIT: i made a mistake the first time and i said temp was of type Word, but it is actually of type char*. so i assume that the compiler converts temp to a Word using one of my constructors. i dont know which one it would use and why this would work since the first parameter is not Word. here is the constructor i think is being used to make the Word using temp: Word::Word(char* c, char* delimeters=NULL) { char *temporary = "\0"; if(c == NULL) c = temporary; check(stoppers!=NULL, "(Word(char*,char*))NULL pointer"); //exits the program if the expression is false if(strlen(c) == 0) size = DEFAULT_SIZE; //10 else size = strlen(c) + 1 + DEFAULT_SIZE; wd = new char[size]; check(wd!=NULL, "Word(char*,char*))heap overflow"); delimiters = new char[strlen(stoppers) + 1]; //EDIT: changed to [] check(delimiters!=NULL,"Word(char*,char*))heap overflow"); strcpy(wd,c); strcpy(delimiters,stoppers); count = strlen(wd); } wd is of type char* thanks for looking at this big question and trying to help. let me know if you need more code to look at

    Read the article

  • Calculating the Angle Between Two vectors Using Dot Product

    - by P. Avery
    I'm trying to calculate the angle between two vectors so that I can rotate a character in the direction of an object in 3D space. I have two vectors( character & object), loc_look, and modelPos respectively. For simplicity's sake I am only trying to rotate along the up axis...yaw. loc_look = D3DXVECTOR3 (0, 0, 1), modelPos = D3DXVECTOR3 (0, 0, 15); I have written this code which seems to be the correct calculations. My problem arises, seemingly, because the rotation I apply to the character's look vector(loc_look) exceeds the value of the object's position (modelPos). Here is my code: BOOL CEntity::TARGET() { if(graphics.m_model->m_enemy) { D3DXVECTOR3 modelPos = graphics.m_model->position; D3DXVec3Normalize(&modelPos, &modelPos); //D3DXVec3Normalize(&loc_look, &loc_look); float dot = D3DXVec3Dot(&loc_look, &modelPos); float yaw = acos(dot); BOOL neg = (loc_look.x > modelPos.x) ? true : false; switch ( neg ) { case false: Yaw(yaw); return true; case true: Yaw(-yaw); return true; } } else return false; } I rotate the character's orientation matrix with the following code: void CEntity::CalculateOrientationMatrix(D3DXMATRIX *orientationMatrix) { D3DXMatrixRotationAxis(&rotY, &loc_up, loc_yaw); D3DXVec3TransformCoord(&loc_look, &loc_look, &rotY); D3DXVec3TransformCoord(&loc_right, &loc_right, &rotY); D3DXMatrixRotationAxis(&rotX, &loc_right, loc_pitch); D3DXVec3TransformCoord(&loc_look, &loc_look, &rotX); D3DXVec3TransformCoord(&loc_up, &loc_up, &rotX); D3DXMatrixRotationAxis(&rotZ, &loc_look, loc_roll); D3DXVec3TransformCoord(&loc_up, &loc_up, &rotZ); D3DXVec3TransformCoord(&loc_right, &loc_right, &rotZ); *orientationMatrix *= rotX * rotY * rotZ; orientationMatrix->_41 = loc_position.x; orientationMatrix->_42 = loc_position.y; orientationMatrix->_43 = loc_position.z; //D3DXVec3Normalize(&loc_look, &loc_look); SetYawPitchRoll(0,0,0); // Reset Yaw, Pitch, & Roll Amounts } Also to note, the modelPos.x increases by 0.1 each iteration so the character will face the object as it moves along the x-axis... Now, when I run program, in the first iteration everything is fine(I haven't rotated the character yet). On the second iteration, the loc_look.x value is greater than the modelPos.x value(I rotated the character too much using the angle specified with the dot product calculations in the TARGET function). Therefore on the second iteration my code will rotate the character left to adjust for the difference in the vectors' x values... How can I tighten up the measurements so that I do not rotate my character's look vector by too great a value?

    Read the article

  • Web SITE publishing, dynamic compilation, smoke & mirrors

    - by tbehunin
    When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

    Read the article

  • Nested WHILE loops not acting as expected - Javascript / Google Apps Script

    - by dthor
    I've got a function that isn't acting as intended. Before I continue, I'd like preface this with the fact that I normally program in Mathematica and have been tasked with porting over a Mathematica function (that I wrote) to JavaScript so that it can be used in a Google Docs spreadsheet. I have about 3 hours of JavaScript experience... The entire (small) project is calculating the Gross Die per Wafer, given a wafer and die size (among other inputs). The part that isn't working is where I check to see if any corner of the die is outside of the effective radius, Reff. The function takes a list of X and Y coordinates which, when combined, create the individual XY coord of the center of the die. That is then put into a separate function "maxDistance" that calculates the distance of each of the 4 corners and returns the max. This max value is checked against Reff. If the max is inside the radius, 1 is added to the die count. // Take a list of X and Y values and calculate the Gross Die per Wafer function CoordsToGDW(Reff,xSize,ySize,xCoords,yCoords) { // Initialize Variables var count = 0; // Nested loops create all the x,y coords of the die centers for (var i = 0; i < xCoords.length; i++) { for (var j = 0; j < yCoords.length, j++) { // Add 1 to the die count if the distance is within the effective radius if (maxDistance(xCoords[i],yCoords[j],xSize,ySize) <= Reff) {count = count + 1} } } return count; } Here are some examples of what I'm getting: xArray={-52.25, -42.75, -33.25, -23.75, -14.25, -4.75, 4.75, 14.25, 23.75, 33.25, 42.75, 52.25, 61.75} yArray={-52.5, -45.5, -38.5, -31.5, -24.5, -17.5, -10.5, -3.5, 3.5, 10.5, 17.5, 24.5, 31.5, 38.5, 45.5, 52.5, 59.5} CoordsToGDW(45,9.5,7.0,xArray,yArray) returns: 49 (should be 72) xArray={-36, -28, -20, -12, -4, 4, 12, 20, 28, 36, 44} yArray={-39, -33, -27, -21, -15, -9, -3, 3, 9, 15, 21, 27, 33, 39, 45} CoordsToGDW(32.5,8,6,xArray,yArray) returns: 39 (should be 48) I know that maxDistance() is returning the correct values. So, where's my simple mistake? Also, please forgive me writing some things in Mathematica notation... Edit #1: A little bit of formatting. Edit #2: Per showi, I've changed WHILE loops to FOR loops and replaced <= with <. Still not the right answer. It did clean things up a bit though... Edit #3: What I'm essentially trying to do is take [a,b] and [a,b,c] and return [[a,a],[a,b],[a,c],[b,a],[b,b],[b,c]]

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • Displaying xaml resources dynamically?

    - by Robert
    I used Mike Swanson's illustrator to xaml converter to convert some of my images to xaml. The convert creates a viewbox that contains the image. These viewboxes I made resource files in my program. The code below shows what I'm trying to do: I have a viewmodel that has an enum variable called PrimaryWinding of type Windings. The values PrimD and PrimY of the enum select the respective PrimD and PrimY xaml files in the resources. <UserControl.Resources> <DataTemplate x:Key="PrimTrafo" DataType="{x:Type l:Windings}"> <Frame Source="{Binding}" x:Name="PART_Image" NavigationUIVisibility="Hidden"> <Frame.LayoutTransform> <ScaleTransform ScaleX="0.5" ScaleY="0.5"/> </Frame.LayoutTransform> </Frame> <DataTemplate.Triggers> <DataTrigger Binding="{Binding}" Value="PrimD"> <Setter TargetName="PART_Image" Property="Source" Value="Resources\PrimD.xaml" /> </DataTrigger> <DataTrigger Binding="{Binding}" Value="PrimY"> <Setter TargetName="PART_Image" Property="Source" Value="Resources\PrimY.xaml" /> </DataTrigger> </DataTemplate.Triggers> </DataTemplate> </UserControl.Resources> <!--The contentcontrol that holds the datatemplate defined above--> <Grid > <Grid.ColumnDefinitions> <ColumnDefinition Width="2*"></ColumnDefinition> <ColumnDefinition Width="2*"></ColumnDefinition> <ColumnDefinition Width="1*"></ColumnDefinition> </Grid.ColumnDefinitions> <ContentControl Grid.Column="0" Content="{Binding PrimaryWinding}" ContentTemplate="{StaticResource PrimTrafo}"/> </Grid> This code works. Only I can't resize the drawings to the size of the grid cell. I added the ScaleTransform class to resize the image. Is a Frame the wrong class to hold the drawings? Should I use the ScaleTransform class to resize the drawing to the size of the cell? And how can I do that dynamically?

    Read the article

  • Weird Datagrid / paint behaviour

    - by Shane.C
    The scenario: A method sends out a broadcast packet, and returned packets that are validated are deemed okay to be added as a row in my datagrid (The returned packets are from devices i want to add into my program). So for each packet returned, containing information about a device, i create a new row. This is done by first sending packets out, creating rows and adding them to a list of rows that are to be added, and then after 5 seconds (In which case all packets would have returned by then) i add the rows. Here's a few snippets of code. Here for each returned packet, i create a row and add it to a list; DataRow row = DGSource.NewRow(); row["Name"] = deviceName; row["Model"] = deviceModel; row["Location"] = deviceLocation; row["IP"] = finishedIP; row["MAC"] = finishedMac; row["Subnet"] = finishedSubnet; row["Gateway"] = finishedGateway; rowsToAdd.Add(row); Then when the timer elapses; void timerToAddRows_Elapsed(object sender, System.Timers.ElapsedEventArgs e) { timerToAddRows.Enabled = false; try { int count = 0; foreach (DataRow rowToAdd in rowsToAdd) { DGSource.Rows.Add(rowToAdd); count++; } rowsToAdd.Clear(); DGAutoDevices.InvokeEx(f => DGAutoDevices.Refresh()); lblNumberFound.InvokeEx(f => lblNumberFound.Text = count + " new devices found."); } catch { } } So at this point, each row has been added, and i call the re paint, by doing refresh. (Note: i've also tried refreshing the form itself, no avail). However, when the datagrid shows the rows, the scroll bar / datagrid seems to have weird behavour..for example i can't highlight anything with clicks (It's set to full row selection), and the scroll bar looks like so; Calling refresh doesn't work, although if i resize the window even 1 pixel, or minimize and maximise, the problem is solved. Other things to note : The method that get's the packets and adds the rows to the list, and then from the list to the datagrid runs in it's own thread. Any ideas as to something i might be missing here?

    Read the article

< Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >