Search Results

Search found 25660 results on 1027 pages for 'booting issue'.

Page 838/1027 | < Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >

  • Java Runtime command line Process

    - by AEIOU
    I have a class with the following code: Process process = null; try { process = Runtime.getRuntime().exec("gs -version"); System.out.println(process.toString()); } catch (Exception e1) { e1.printStackTrace(); } finally { process.destroy(); } I can run "gs -version" on my command line and get: GPL Ghostscript 8.71 (2010-02-10) Copyright (C) 2010 Artifex Software, Inc. All rights reserved. So I know I have the path at least set somewhere. I can run that class from command line and it works. But when I run it using eclipse I get the following error: java.io.IOException: Cannot run program "gs": error=2, No such file or directory at java.lang.ProcessBuilder.start(ProcessBuilder.java:459) at java.lang.Runtime.exec(Runtime.java:593) at java.lang.Runtime.exec(Runtime.java:431) at java.lang.Runtime.exec(Runtime.java:328) at clris.batchdownloader.TestJDBC.main(TestJDBC.java:17) Caused by: java.io.IOException: error=2, No such file or directory at java.lang.UNIXProcess.forkAndExec(Native Method) at java.lang.UNIXProcess.(UNIXProcess.java:53) at java.lang.ProcessImpl.start(ProcessImpl.java:91) at java.lang.ProcessBuilder.start(ProcessBuilder.java:452) ... 4 more In my program, i can replace "gs" with: "java", "mvn", "svn" and it works. But "gs" does not. It's only in eclipse I have this problem. Any ideas, on what I need to do to resolve this issue?

    Read the article

  • Fck editor problem

    - by Josemalive
    Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

    Read the article

  • Problems with jQuery load and getJSON only when using Chrome

    - by leftend
    I'm having an issue with two jQuery calls. The first is a "load" that retrieves HTML and displays it on the page (it does include some Javascript and CSS in the code that is returned). The second is a "getJSON" that returns JSON - the JSON returned is valid. Everything works fine in every other browser I've tried - except Chrome for either Windows or Mac. The page in question is here: http://urbanistguide.com/category/Contemporary.aspx When you click on a Restaurant name in IE/FF, you should see that item expand with more info - and a map displayed to the right. However, if you do this in Chrome all you get is the JSON data printed to the screen. The first problem spot is when the "load" function is called here: var fulllisting = top.find(".listingfull"); fulllisting.load(href2, function() { fulllisting.append("<div style=\"width:99%;margin-top:10px;text-align:right;\"><a href=\"#\" class=\"" + obj.attr("id") + "\">X</a>"); itemId = fulllisting.find("a.listinglink").attr("id"); ... In the above code, the callback function doesn't seem to get invoked. The second problem spot is when the "getJSON" function is called: $.getJSON(href, function(data) { if (data.error.length > 0) { //display error message } else { ... } In this case - it just seems to follow the link instead of performing the callback... and yes, I am doing a "return false;" at the end of all of this to prevent the link from executing. All of the rest of the code is inline on that page if you want to view the source code. Any ideas?? Thanks

    Read the article

  • How to figure out what error my Java Eclipse project has?

    - by Greg Mattes
    I've created a Java project from existing source with an Ant build script in Eclipse. I cannot run my project because Eclipse tells me that there is at least one error in it. Now, I know that the project runs fine on the command line, so I suspect an Eclipse configuration error. As far as I can tell, the only feedback that I have from Eclipse is a little red X on my project in the Package Explorer window and dialog window when I try to run the project says there are errors in the project This is all wonderful, but what is the error? Is there a "show me the next error" button somewhere? In the past, on other Eclipse projects, I've notice other little red X's on folders containing source files with errors, the little red X's appear on the source files as well. I scanned (manually) through all of the source files and I haven't found any other red X's (again, where is the "next error" button?). If I select the "Proceed" button I am greeted with a java.lang.NoClassDefFoundError for my main class, which makes me suspect a classpath issue. I've checked the classpath, and I'm fairly certain that it's correct. Is there a way to see the exact jvm command line that Eclipse is invoking? I realize that it might be invoking the JVM programmatically, and not on a "real" command line. In any case, is there a way, other than the run configuration dialog, to see what is actually happening when I hit the "Proceed" button?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • python: how to design a container with elements that must reference their container

    - by Luke404
    (the title is admittedly not that great. Please forgive my English, this is the best I could think of) I'm writing a python script that will manage email domains and their accounts, and I'm also a newby at OOP design. My two (related?) issues are: the Domain class must do special work to add and remove accounts, like adding/removing them to the underlying implementation how to manage operations on accounts that must go through their container To solve the former issue I'd add a factory method to the Domain class that'll build an Account instance in that domain, and a 'remove' (anti-factory?) method to handle deletions. For the latter this seems to me "anti-oop" since what would logically be an operation on an Account (eg, change password) must always reference the containing Domain. Seems to me that I must add to the Account a reference back to the Domain and use that to get data (like the domain name) or call methods on the Domain class. Code example (element uses data from the container) that manages an underlying Vpopmail system: class Account: def __init__(self, name, password, domain): self.name = name self.password = password self.domain = domain def set_password(self, password): os.system('vpasswd %s@%s %s' % (self.name, self.domain.name, password) self.password = password class Domain: def __init__(self, domain_name): self.name = domain_name self.accounts = {} def create_account(self, name, password): os.system('vadduser %s@%s %s' % (name, self.name, password)) account = Account(name, password, self) self.accounts[name] = account def delete_account(self, name): os.system('vdeluser %s@%s' % (name, self.name)) del self.accounts[name] another option would be for Account.set_password to call a Domain method that would do the actual work - sounds equally ugly to me. Also note the duplication of data (account name also as dict key), it sounds logical (account names are "primary key" inside a domain) but accounts need to know their own name.

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • Good resources for building web-app in Tapestry

    - by Rich
    Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

    Read the article

  • segmentation fault on Unix - possible stack corruption

    - by bob
    hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

    Read the article

  • Using both chunked transfer encoding and gzip

    - by RadiantHeart
    I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

    Read the article

  • Amazon S3 and swfaddress

    - by justinbach
    I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • Sharepoint: Integrity of lookup fields after a list import

    - by driAn
    Hi there I got a question about the behavior of lookup fields when importing data. I wonder how the lookup fields behave when the list they point to is being replaced/imported. To explain the issue, I will provide a quick example below: As example, assume we have these two sharepoint lists: Product Types ------------- + Type Name + Code Nr + etc Products -------- + Product Name + Product Type (Lookup field to list "Product Types") + etc In my scenario, the Products List contains production data on the production Sharepoint platform. It is filled with data by the business users. However the Product Types list contains rather static data and is maintained by the developer. Now after a development cycle, the developer wants to deploy his new webparts and his new data (product types list). The developer performs the following procedure: On the dev machine: Export "product type" list using stsadm On the production machine: Delete all items in the "product type" list On the production machine: Import the "product type" list using stsadm This means we basically replace the "product type" list on the production server while keeping the "product" list as it is. Now the question: Is this safe? Will the lookup references break under certain circumstances? Any downside of this import/export procedure? What happens if someone accesses a "product" during the import? Will the (now invalid) reference clear its own content (become a null value). What happens if the schema of the "product type" list changes (new column)? Will this cause any troubles? Thanks for all feedback and suggestions!

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Detecting Xml namespace fast

    - by Anna Tjsoken
    Hello there, This may be a very trivial problem I'm trying to solve, but I'm sure there's a better way of doing it. So please go easy on me. I have a bunch of XSD files that are internal to our application, we have about 20-30 Xml files that implement datasets based off those XSDs. Some Xml files are small (<100Kb), others are about 3-4Mb with a few being over 10Mb. I need to find a way of working out what namespace these Xml files are in order to provide (something like) intellisense based off the XSD. The implementation of this is not an issue - another developer has written the code for this. But I'm not sure the best (and fastest!) way of detecting the namespace is without the use of XmlDocument (which does a full parse). I'm using C# 3.5 and the documents come through as a Stream (some are remote files). All the files are *.xml (I can detect if it was extension based) but unfortunately the Xml namespace is the only way. Right now I've tried XmlDocument but I've found it to be innefficient and slow as the larger documents are awaiting to be parsed (even the 100Kb docs). public string GetNamespaceForDocument(Stream document); Something like the above is my method signature - overloads include string for "content". Would a RegEx (compiled) pattern be good? How does Visual Studio manage this so efficiently? Another college has told me to find a fast Xml parser in C/C++, parse the content and have a stub that gives back the namespace as its slower in .NET, is this a good idea?

    Read the article

  • AsyncTask and Contexts

    - by Michael
    So I'm working out my first multi-threaded application using Android with the AsyncTask class. I'm trying to use it to fire off a Geocoder in a second thread, then update the UI with onPostExecute, but I keep running into an issue with the proper Context. I kind of hobbled my way through using Contexts on the main thread, but I'm not exactly sure what the Context is or how to use it on background threads, and I haven't found any good examples on it. Any help? Here is an excerpt of what I'm trying to do: public class GeoCode extends AsyncTask<GeoThread, Void, GeoThread> { @Override protected GeoThread doInBackground(GeoThread... i) { List<Address> addresses = null; Geocoder geoCode = null; geoCode = new Geocoder(null); //Expects at minimum Geocoder(Context context); addresses = geoCode.getFromLocation(GoldenHour.lat, GoldenHour.lng, 1); } } It keeps failing at the sixth line there, because of the improper Context.

    Read the article

  • Using Word COM objects in .NET, InlineShapes not copied from template to document

    - by Keith
    Using .NET and the Word Interop I am programmatically creating a new Word doc from a template (.dot) file. There are a few ways to do this but I've chosen to use the AttachedTemplate property, as such: Dim oWord As New Word.Application() oWord.Visible = False Dim oDocuments As Word.Documents = oWord.Documents Dim oDoc As Word.Document = oDocuments.Add() oDoc.AttachedTemplate = sTemplatePath oDoc.UpdateStyles() (I'm choosing the AttachedTemplate means of doing this over the Documents.Add() method because of a memory leak issue I discovered when using Documents.Add() to open from templates.) This works fine EXCEPT when there is an image (represented as an InlineShape) in the template footer. In that case the image does not appear in the resulting document. Specifically the image should appear in the oDoc.Sections.Item(1).Footers.Item(WdHeaderFooterIndex.wdHeaderFooterPrimary).Range.InlineShapes collection but it does not. This is not a problem when using Documents.Add(), however as I said that method is not an option for me. Is there an extra step I have to take to get the images from the template? I already discovered that when using AttachedTemplate I have to explicitly call UpdateStyles() (as you can see in my code snippet) to apply the template styles to the document, whereas that is done automatically when using Documents.Add(). Or maybe there's some crazy workaround? Your help is much appreciated! :)

    Read the article

  • CSS absolute DIV causing other absolute DIV problems

    - by Tim
    Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

    Read the article

  • My button background seems stretched.

    - by Kyle Sevenoaks
    Hi, I have a button as made for you to see here. Looks fine,right? Well on the live site, euroworker.no/shipping it seems stretched. Renders fine in Chrome, IE and Safari, I thought it might have been a FF issue, but loaded the fiddle into FF and seems fine. Quick ref CSS and html: #fortsett_btn { background-image: url(http://euroworker.no/public/upload/fortsett.png?1269434047); background-repeat:no-repeat; background-position:left; background-color:none; border:none; outline;none; visibility: visible; position: relative; z-index: 2; width: 106px; height: 25px; cursor:pointer; }? And HTML <button type="submit" class="submit" id="fortsett_btn" title="Fortsett" value="">&nbsp;</button>? I wonder what's up with it.

    Read the article

  • Broken flash movie player! allowFullScreen does not work with anything other than a wmode value of "

    - by lhnz
    I have a flash player on a page which plays videos. I also have modal popups which need to be able to display over the top of the flash player when they are opened, etc... I can't change either of these requirements since they are part of the spec I have been given. Flash seems to ignore z-indexes I set on it with css, and the modal popups will therefore only appear above the video player if I set the video player's wmode to opaque or transparent. However, if I do this then the full screen functionality stops working correctly: when I un-fullscreen the video it stays zoomed in. In short If you open a popup on an item page or another page containing flash the popup should be displayed above this. Flash ignores z-index values. You can stop flash ignoring z-index values by setting wmode to opaque or transparent rather than the default: window. This stops full screen from working correctly. Has anybody else faced this issue before? What can I do to fix it? I was thinking of recreating the video player with wmode=opaque whenever I opened a modal popup and then switching it back to wmode=window when the modal popup is closed, since this would mean that the popup should display above it (as wmode=opaque) and the fullscreen should work correct (as wmode=window). However, this is not ideal at all: as well as being a hack it would also mean that the video would stop playing if somebody clicked a button which opened a popup. Cheers!

    Read the article

  • Backbone Model fetched from Lithium controller is not loaded properly in bb Model

    - by Nilesh Kale
    I'm using backbone.js and Lithium. I'm fetching a model from the server by passing in a _id that is received as a hidden parameter on the page. The database MongoDB has stored the data correctly and can be viewed from console as: { "_id" : ObjectId("50bb82694fbe3de417000001"), "holiday_name" : "SHREE15", "description": "", "star_rating" : "3", "holiday_type" : "family", "rooms" : "1", "adults" : "2", "child" :"0", "emails" : "" } The Lithium Model class is so: class Holidays extends \lithium\data\Model { public $validates = array( 'holiday_name' => array( array( 'notEmpty', 'required' => true, 'message' => 'Please key-in a holiday name! (eg. Family trip for summer holidays)' ))); } The backbone Holiday model is so: window.app.IHoliday = Backbone.Model.extend({ urlRoot: HOLIDAY_URL, idAttribute: "_id", id: "_id", // Default attributes for the holiday. defaults: { }, // Ensure that each todo created has `title`. initialize: function(props) { }, The code for backbone/fetch is: var Holiday = new window.app.IHoliday({ _id: holiday_id }); Holiday.fetch( { success: function(){ alert('Holiday fetched:' + JSON.stringify(Holiday)); console.log('HOLIDAY Fetched: \n' + JSON.stringify(Holiday)); console.log('Holiday name:' + Holiday.get('holiday_name')); } } ); Lithium Controller Code is: public function load($holiday_id) { $Holiday = Holidays::find($holiday_id); return compact('Holiday'); } PROBLEM: The output of the backbone model fetched from server is as below and the Holiday model is not correctly 'formed' when data returns into backbone Model: HOLIDAY Fetched: {"_id":"50bb82694fbe3de417000001","Holiday":{"_id":"50bb82694fbe3de417000001","holiday_name":"SHREE15","description":"","star_rating":"3","holiday_type":"family","rooms":"1","adults":"2","child":"0","emails":""}} iplann...view.js (line 68) Holiday name:undefined Clearly there is some issue when the data is passed/translated from Lithium and loaded up as a model into backbone Holiday model. Is there something very obviously wrong in my code?

    Read the article

  • VPython in Eclipse - thinks it has the wrong architecture type.

    - by Duncan Tait
    Evening, So I've recently installed VPython on my MacBook (OS X, Snow Leopard) - and it works absolutely fine in IDLE and from the command line (interactive mode). However, eclipse has issues. Firstly it couldn't find it (which is a bit of an issue actually with all these 'easy install' python modules - when they don't tell you where they actually install to!) but I searched it out in the depths of Library\Frameworks... and added that to the System PYTHONPATH listbox in Eclipse. Now it can find it, but it says the following: Traceback (most recent call last): File "/Users/duncantait/dev/workspace/Network_Simulation/src/Basic/Net_Sim1.py", line 15, in <module> import visual File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/__init__.py", line 59, in <module> import cvisual ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so: mach-o, but wrong architecture I am guessing that VPython might not be built for a 64-bit architecture (Intel), but the fact remains that it works in both IDLE and command prompt... So there must be a way to configure Eclipse to run it right? (Wishful thinking). Thanks for any help! Duncan

    Read the article

  • ColdFusion 8: Database Connection Reset Error

    - by Gavin
    I have been getting these intermittent ColdFusion Database connection reset errors and was wondering if anyone had experience with this and had a particular solution that worked? Here is the error: Error Executing Database Query.[Macromedia][SQLServer JDBC Driver]A problem occurred when attempting to contact the server (Server returned: Connection reset). Please ensure that the server parameters passed to the driver are correct and that the server is running. Also ensure that the maximum number of connections have not been exceeded for this server. This doesn't happen with any particular query, the code breaks in different queries every time, returning a SQLState error 08s01. These query's logic are fine, no logic errors etc. I checked the network logs and there were no database server connection refusals at the time of the error. Once the first error occurs, it keeps happening for no more than a minute or so at random times of the day, every few days. I've googled this thing and so far anyone that has had this issue was only on CF6 or 7, which the fixes coldFusion put out are only for CF6 or 7. Server configuration wise: The ColdFusion server is version 8 The database server is SQL Server 2005 Standard The database connections allowed setting is set to unlimited on both SQL Server and ColdFusion Any help would be greatly appreciated, Thanks!

    Read the article

  • problem getting info from a cookie with javascript

    - by Jason
    I am having an issue with my cookies and I can't figure it out. Basically I have it set up so it checks for the cookie to see if the user is logged in, and then displays either a welcome message or a login link. It works - except that instead of returning the persons name in the welcome message it just is blank where the name should be. The cookie is there, with all the appropriate info.. not sure what I am doing wrong. var itm = new Array(); itm[0] = findCookie("ui"); if (itm[0] == null) { document.write("<h2><a href='logreg.html'>Log In or Sign Up</a></h2>"); } else { var c1 = itm[0].indexOf(","); var c2 = itm[0].indexOf(",",c1); var c3 = itm[0].indexOf(",",c2); var gname = itm[0].substring(c2,c3); document.write("<h2>Welcome "+gname+"!</h2>"); } The findCookie function is.. function findCookie(val){ var cookie = null; var findVal = val + "="; var dc = document.cookie; if (dc.length > 0) { var start = dc.indexOf(findVal); if (start >= 0) { start += findVal.length; lastVal = dc.indexOf(";", start); if (lastVal == -1) { lastVal = dc.length; } cookie = (dc.substring(start, lastVal)); } else { return cookie; } } return cookie; }

    Read the article

  • Playing video from URL -Android

    - by Rajeev
    In the following code what ami doing wrong the video dosnt seem to play here.Is that the permission issue if so what should be included in the manifest file this main.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content" android:orientation="horizontal" android:baselineAligned="true"> <LinearLayout android:layout_height="match_parent" android:layout_width="wrap_content" android:id="@+id/linearLayout2"></LinearLayout> <MediaController android:id="@+id/mediacnt" android:layout_width="wrap_content" android:layout_height="wrap_content"></MediaController> <LinearLayout android:layout_height="match_parent" android:layout_width="wrap_content" android:id="@+id/linearLayout1" android:orientation="vertical"></LinearLayout> <Gallery android:layout_height="wrap_content" android:id="@+id/gallery" android:layout_width="wrap_content" android:layout_weight="1"></Gallery> <VideoView android:layout_height="match_parent" android:id="@+id/vv" android:layout_width="wrap_content"></VideoView> </LinearLayout> this is java class package com.gallery; import java.net.URL; import android.app.Activity; import android.app.Activity; import android.net.Uri; import android.os.Bundle; import android.widget.MediaController; import android.widget.Toast; import android.widget.VideoView; public class GalleryActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Toast.makeText(GalleryActivity.this, "Hello world", Toast.LENGTH_LONG).show(); VideoView videoView = (VideoView) findViewById(R.id.vv); MediaController mediaController = new MediaController(this); mediaController.setAnchorView(videoView); // Set video link (mp4 format ) Uri video = Uri.parse("http://www.youtube.com/watch?v=lEbxLDuecHU&playnext=1&list=PL040F3034C69B1674"); videoView.setMediaController(mediaController); videoView.setVideoURI(video); videoView.start(); } }

    Read the article

< Previous Page | 834 835 836 837 838 839 840 841 842 843 844 845  | Next Page >