Search Results

Search found 25660 results on 1027 pages for 'booting issue'.

Page 839/1027 | < Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >

• Writing to EEPROM on PIC

  - by JB

  Are there any PIC microcontroller programmers here? I'm learning some PIC microcontroller programming using a pickit2 and the 16F690 chip that came with it. I'm working through trying out the various facilities at the moment. I can sucessfully read a byte from the EEPROM in code if I set the EEPROM vaklue in MPLAB but I don't seem to be able to modify the value using the PIC itsself. Simply nothing happens and I don't read back the modified value, I always get the original which implies to me that the write isn't working? This is my code for that section, am I missing something? I know I'm doing a lot of unnecessary bank switches, I added most of them to ensure that being on the wrong bank wasn't the issue. ; ------------------------------------------------------ ; Now SET the EEPROM location ZERO to 0x08 ; ------------------------------------------------------ BANKSEL EEADR CLRF EEADR ; Set EE Address to zero BANKSEL EEDAT MOVLW 0x08 ; Store the value 0x08 in the EEPROM MOVWF EEDAT BANKSEL EECON1 BSF EECON1, WREN ; Enable writes to the EEPROM BANKSEL EECON2 MOVLW 0x55 ; Do the thing we have to do so MOVWF EECON2 ; that writes can work MOVLW 0xAA MOVWF EECON2 BANKSEL EECON1 BSF EECON1, WR ; And finally perform the write WAIT BTFSC EECON1, WR ; Wait for write to finish GOTO WAIT BANKSEL PORTC ; Just to make sure we are on the right bank

  Read the article

• Activate a python virtual environment using activate_this.py in a fabfile on Windows

  - by Rudy Lattae

  I have a Fabric task that needs to access the settings of my Django project. On Windows, I'm unable to install Fabric into the project's virtualenv (issues with Paramiko + pycrypto deps). However, I am able to install Fabric in my system-wide site-packages, no problem. I have installed Django into the project's virtualenv and I am able to use all the " python manage.py" commands easily when I activate the virtualenv with the "VIRTUALENV\Scripts\activate.bat" script. I have a fabric tasks file (fabfile.py) in my project that provides tasks for setup, test, deploy, etc. Some of the tasks in my fabfile need to access the settings of my django project through "from django.conf import settings". Since the only usable Fabric install I have is in my system-wide site-packages, I need to activate the virtualenv within my fabfile so django becomes available. To do this, I use the "activate_this" module of the project's virtualenv in order to have access to the project settings and such. Using "print sys.path" before and after I execute activate_this.py, I can tell the python path changes to point to the virtualenv for the project. However, I still cannot import django.conf.settings. I have been able to successfully do this on *nix (Ubuntu and CentOS) and in Cygwin. Do you use this setup/workflow on Windows? If so Can you help me figure out why this wont work on Windows or provide any tips and tricks to get around this issue? Thanks and Cheers. REF: http://virtualenv.openplans.org/#id9 | Using Virtualenv without bin/python Local development environment: Python 2.5.4 Virtualenv 1.4.6 Fabric 0.9.0 Pip 0.6.1 Django 1.1.1 Windows XP (SP3)

  Read the article

• JQUERY, AutoSuggest that doesn't kill the Server on ever keyup

  - by nobosh

  I'm working to build a JQUERY enabled AutoSuggest plugin, inspired by Apple's spotlight. Here is the general code: $(document).ready(function() { $('#q').bind('keyup', function() { if( $(this).val().length == 0) { // Hide the q-suggestions box $('#q-suggestions').fadeOut(); } else { // Show the AJAX Spinner $("#q").css("background-image","url(/images/ajax-loader.gif)"); $.ajax({ url: '/search/spotlight/', data: {"q": $(this).val()}, success: function(data) { $('#q-suggestions').fadeIn(); // Show the q-suggestions box $('#q-suggestions').html(data); // Fill the q-suggestions box // Hide the AJAX Spinner $("#q").css("background-image","url(/images/icon-search.gif)"); } }); } }); The issue I want to solve well & elegantly, is not killing the sever. Right now the code above hits the server every time you type a key and does not wait for you to essentially finish typing. What's the best way to solve this? A. Kill previous AJAX request? B. Some type of AJAX caching? C. Adding some type of delay to only submit .AJAX() when the person has stopped typing for 300ms or so? Thanks

  Read the article

• segmentation fault on Unix - possible stack corruption

  - by bob

  hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

  Read the article

• CURL & web.py: transfer closed with outstanding read data remaining

  - by Richard J

  Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

  Read the article

• Lotus Notes - Export emails to plain text file

  - by mbeckish

  I am setting up a Lotus Notes account to accept emails from a client, and automatically save each email as a plain text file to be processed by another application. So, I'm trying to create my very first Agent in Lotus to automatically export the emails to text. Is there a standard, best practices way to do this? I've created a LotusScript Agent that pretty much works. However, there is a bug - once the Body of the memo exceeds 32K characters, it starts inserting extra CR/LF pairs. I am using Lotus Notes 7.0.3. Here is my script: Sub Initialize On Error Goto ErrorCleanup Dim session As New NotesSession Dim db As NotesDatabase Dim doc As NotesDocument Dim uniqueID As Variant Dim curView As NotesView Dim docCount As Integer Dim notesInputFolder As String Dim notesValidOutputFolder As String Dim notesErrorOutputFolder As String Dim outputFolder As String Dim fileNum As Integer Dim bodyRichText As NotesRichTextItem Dim bodyUnformattedText As String Dim subjectText As NotesItem ''''''''''''''''''''''''''''''''''''''''''''''''''''''' 'INPUT OUTPUT LOCATIONS outputFolder = "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\" notesInputFolder = "IBEmails" notesValidOutputFolder = "IBEmailsDone" notesErrorOutputFolder="IBEmailsError" ''''''''''''''''''''''''''''''''''''''''''''''''''''''' Set db = session.CurrentDatabase Set curview = db.GetView(notesInputFolder ) docCount = curview.EntryCount Print "NUMBER OF DOCS " & docCount fileNum = 1 While (docCount > 0) 'set current doc to Set doc = curview.GetNthDocument(docCount) Set bodyRichText = doc.GetFirstItem( "Body" ) bodyUnformattedText = bodyRichText.GetUnformattedText() Set subjectText = doc.GetFirstItem("Subject") If subjectText.Text = "LotusAgentTest" Then uniqueID = Evaluate("@Unique") Open "\\PASCRIA\CignaDFS\CUser1\Home\mikebec\MyDocuments\email_" & uniqueID(0) & ".txt" For Output As fileNum Print #fileNum, "Subject:" & subjectText.Text Print #fileNum, "Date:" & Now Print #fileNum, bodyUnformattedText Close fileNum fileNum = fileNum + 1 Call doc.PutInFolder(notesValidOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End If doccount = doccount-1 Wend Exit Sub ErrorCleanup: Call sendErrorEmail(db,doc.GetItemValue("From")(0)) Call doc.PutInFolder(notesErrorOutputFolder) Call doc.RemoveFromFolder(notesInputFolder) End Sub Update Apparently the 32KB issue isn't consistent - so far, it's just one document that starts getting extra carriage returns after 32K.

  Read the article

• Fck editor problem

  - by Josemalive

  Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

  Read the article

• Windows update breaks dlls?

  - by shoosh

  I'm compiling a project which uses multiple DLL and compiles with VS2008. After a recent windows update DLLs compiled on my computer stopped working on other computers. After some investigation it turned out that it updated the CRT redistributable library which I'm compiling with from version "9.0.21022.8" to version "9.0.30729.4148" This is evident from the Manifest file of the EXE i'm compiling. it contains the following: <dependency> <dependentAssembly> <assemblyIdentity type="win32" name="Microsoft.VC90.CRT" version="9.0.21022.8" processorArchitecture="amd64" publicKeyToken="1fc8b3b9a1e18e3b"></assemblyIdentity> </dependentAssembly> </dependency> <dependency> <dependentAssembly> <assemblyIdentity type="win32" name="Microsoft.VC90.CRT" version="9.0.30729.4148" processorArchitecture="amd64" publicKeyToken="1fc8b3b9a1e18e3b"></assemblyIdentity> </dependentAssembly> </dependency> Meaning it wants to use two different versions of the CRT at the same time. the second version is needed by the code which I'm compiling right now and the first version is needed by older dlls which were compiled a few weeks ago. In the computers where the application is deployed this becomes a problem since they get their CRT dll from a local folder called Microsoft.VC90.CRT and not from WinSXS. This folder can't contain two different versions of the dll. Is there a known solution to this issue or do I need to start compiling all of the other DLLs with the new CRT?

  Read the article

• Display ñ on a C# .NET application

  - by mmr

  I have a localization issue. One of my industrious coworkers has replaced all the strings throughout our application with constants that are contained in a dictionary. That dictionary gets various strings placed in it once the user selects a language (English by default, but target languages are German, Spanish, French, Portuguese, Mandarin, and Thai). For our test of this functionality, we wanted to change a button to include text which has a ñ character, which appears both in Spanish and in the Arial Unicode MS font (which we're using throughout the application). Problem is, the ñ is appearing as a square block, as if the program did not know how to display it. When I debug into that particular string being read from disk, the debugger reports that character as a square block as well. So where is the failure? I think it could be in a few places: 1) Notepad may not be unicode aware, so the ñ displayed there is not the same as what vs2008 expects, and so the program interprets the character as a square (EDIT: notepad shows the same characters as vs; ie, they both show the ñ. In the same place.). 2) vs2008 can't handle ñ. I find that very, very hard to believe. 3) The text is read in properly, but the default font for vs2008 can't display it, which is why the debugger shows a square. 4) The text is not read in properly, and I should use something other than a regular StreamReader to get strings. 5) The text is read in properly, but the default String class in C# doesn't handle ñ well. I find that very, very hard to believe. 6) The version of Arial Unicode MS I have doesn't have ñ, despite it being listed as one of the 50k characters by http://www.fileinfo.info. Anything else I could have left out? Thanks for any help!

  Read the article

• SQL Stored Queries - use result of query as boolean based on existence of records

  - by Christian Mann

  Just getting into SQL stored queries right now... anyway, here's my database schema (simplified for YOUR convenience): member ------ id INT PK board ------ id INT PK officer ------ id INT PK If you're into OOP, Officer Inherits Board Inherits Member. In other words, if someone is listed on the officer table, s/he is listed on the board table and the member table. I want to find out the highest privilege level someone has. So far my SP looks like this: DELIMITER // CREATE PROCEDURE GetAuthLevel(IN targetID MEDIUMINT) BEGIN IF SELECT `id` FROM `member` WHERE `id` = targetID; THEN IF SELECT `id` FROM `board` WHERE `id` = targetID; THEN IF SELECT `id` FROM `officer` WHERE `id` = targetID; THEN RETURN 3; /*officer*/ ELSE RETURN 2; /*board member*/ ELSE RETURN 1; /*general member*/ ELSE RETURN 0; /*not a member*/ END // DELIMITER ; The exact text of the error is #1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'SELECT id FROM member WHERE id = targetID; THEN IF SEL' at line 4 I suspect the issue is in the arguments for the IF blocks. What I want to do is return true if the result-set is at least one -- i.e. the id was found in the table. Do any of you guys see anything to do here, or should I reconsider my database design into this:? person ------ id INT PK level SMALLINT

  Read the article

• Space in Directory Parameter of svcutil.exe

  - by Drew Frisk

  I'm attempting to download metadata for a WCF service using svcutil but I'm running into issues with the /directory:< parameter. The directory I want to save to has a space in it: C:\Service References\Logging so when I execute /t:metadata I receive the following error: Error: The directory 'C:\Program Files (x86)\Microsoft SDKs\Windows\v8.0A\bin\NETFX 4.0 Tools\References\Logging' could not be found. Verify that the directory exists and that you have the appropriate permissions to read it. It looks to me like the space in "Service References" is causing the issue. From my understanding of command shell (which is very little) spaces act as delimiters for an executable. So I tried escaping the space with a carrot Service^ References and surrounding the path in double quotes "C:\Service References\Logging" but neither of those seem to be working, as the /directory: parameter doesn't recognize them as valid characters in the value. I haven't been able to find any direction in regards to this and svcutil, so I'm at a loss right now. I could download the files to a temp folder and then move them, but I would prefer not to take that approach. I would appreciate any direction that could be given on trying to resolve this. Thanks in advance.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• CSS absolute DIV causing other absolute DIV problems

  - by Tim

  Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

  Read the article

• Using both chunked transfer encoding and gzip

  - by RadiantHeart

  I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

  Read the article

• Including variables inside curly braces in a Zend config ini file on Linux

  - by Dave Morris

  I am trying to include a variable in a .ini file setting by surrounding it with curly braces, and Zend is complaining that it cannot parse it properly on Linux. It works properly on Windows, though: welcome_message = Welcome, {0}. This is the error that is being thrown on Linux: : Uncaught exception 'Zend_Config_Exception' with message 'Error parsing /var/www/html/portal/application/configs/language/messages.ini on line 10 ' in /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php:181 Stack trace: 0 /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php(201): Zend_Config_Ini-&gt;_parseIniFile('/var/www/html/p...') 1 /usr/local/zend/share/ZendFramework/library/Zend/Config/Ini.php(125): Zend_Config_Ini-&gt;_loadIniFile('/var/www/html/p...') 2 /var/www/html/portal/library/Ingrain/Language/Base.php(49): Zend_Config_Ini-&gt;__construct('/var/www/html/p...', NULL) 3 /var/www/html/portal/library/Ingrain/Language/Base.php(23): Ingrain_Language_Base-&gt;setConfig('messages.ini', NULL, NULL) 4 /var/www/html/portal/library/Ingrain/Language/Messages.php(7): Ingrain_Language_Base-&gt;__construct('messages.ini', NULL, NULL, NULL) 5 /var/www/html/portal/library/Ingrain/Helper/Language.php(38): Ingrain_Language_Messages-&gt;__construct() 6 /usr/local/zend/share/ZendFramework/library/Zend/Contr in We are able to get the error to go away on Linux if we surround the braces with quotes, but that seems like a strange solution: welcome_message = Welcome, "{"0"}". Is there a better way to solve this issue for all platforms? Thanks for your help, Dave

  Read the article

• How to invalidate layout of listbox from custom children

  - by Stephen Price

  I have a custom panel for a listbox <ItemsPanelTemplate x:Key="FloatPanelTemplate"> <Controls:FloatPanel x:Name="CardPanel" /> </ItemsPanelTemplate> The panel lays out its children using its X and Y dependency properties. This all works nicely when the FloatPanel is used by itself - I'm using FrameworkPropertyMetadataOptions.AffectsArrange | FrameworkPropertyMetadataOptions.AffectsMeasure on the dependency properties of the child items to tell the FloatPanel to redraw its layout. When I use it in a Listbox (code above) then it draws fine the first time, but when I drag the children (which modifies the item's X and Y) it is not notifying the Listbox that it needs to redraw the FloatPanel's children. I think the issue is related to the fact that each item in the bound collection is wrapped with a ListBoxItem. Hopefully I've described what i'm doing well enough that someone can tell me how to make the panel (or its children) tell it needs to do the Layout routines again. As I said it works once (initial draw) but then dragging items doesn't work (Listbox isnt aware that its children have changed and needs to relayout.) If I drag an item and then resize the window, the listbox does a layout and the items are drawn in their new locations. How do I notify the ListBox (or more importantly the FloatPanel in the ItemsPanelTemplate) that it needs to do a Layout pass?

  Read the article

• Visual Studio 2005 - OleDbConnection throws "Invalid authorization specification" in Form Designer,

  - by Jason Dagit

  I have a form with an OleDbConnection object on it. This form fails to load in the Form Designer with the message: One or more errors encountered while loading the designer. The errors are listed below. Some errors can be fixed by rebuilding your project, while others may require code changes. Invalid authorization specification at ADODB.ConnectionClass.Open(String ConnectionString, String UserID, String Password, Int32 Options) ... (stack trace continues into user code) I've tracked this down to the OleDbConnection string. If I hardcode in the server IP, username/password/dbinstance into the constructor of the GUI form then the form will load in the designer. At run-time it is not an issue because we require the user to provide the login details. The question: Is it possible to use the OleDbConnection and the Form designer without supplying the database credentials in the source code of the form? For example, is there a property of the OleDbConnection or Form that I can set so that it doesn't need to access the database during Form design? My concern is that if we ever move the database server or change the login that the code will stop working in the designer.

  Read the article

• Detecting Xml namespace fast

  - by Anna Tjsoken

  Hello there, This may be a very trivial problem I'm trying to solve, but I'm sure there's a better way of doing it. So please go easy on me. I have a bunch of XSD files that are internal to our application, we have about 20-30 Xml files that implement datasets based off those XSDs. Some Xml files are small (<100Kb), others are about 3-4Mb with a few being over 10Mb. I need to find a way of working out what namespace these Xml files are in order to provide (something like) intellisense based off the XSD. The implementation of this is not an issue - another developer has written the code for this. But I'm not sure the best (and fastest!) way of detecting the namespace is without the use of XmlDocument (which does a full parse). I'm using C# 3.5 and the documents come through as a Stream (some are remote files). All the files are *.xml (I can detect if it was extension based) but unfortunately the Xml namespace is the only way. Right now I've tried XmlDocument but I've found it to be innefficient and slow as the larger documents are awaiting to be parsed (even the 100Kb docs). public string GetNamespaceForDocument(Stream document); Something like the above is my method signature - overloads include string for "content". Would a RegEx (compiled) pattern be good? How does Visual Studio manage this so efficiently? Another college has told me to find a fast Xml parser in C/C++, parse the content and have a stub that gives back the namespace as its slower in .NET, is this a good idea?

  Read the article

• How to scrape Google SERP based on copyright year?

  - by Michael Mao

  Hi all: I know there must be ways to do this sort of things. I am not pro in RoR or Python, not even an expert in PHP. So my solution tends to be quite dumb: It uses a FireFox add-on called imarcos to scrape the target urls from Google SERP, and use PHP to store info into the database. At the very core of my workaround there lies a problem: How to specifically find target urls based on their copyright year? I mean, something like "copyright 1998-2006" in the footer is to be considered a target, but my search results are not 100% accurate. I used the following url to search : http://www.google.com.au/#hl=en&q=inurl:.com.au+intext:copyright+1995..2007+--2008+--2009&start=0&cad=b&fp=6a8119b094529f00 It reads : search for pages that have .com.au in URL and a copyright range from 1995 to 2007 exclude the year of 2008 or 2009. Starting position is 0, of course the offset can be changed. I've already done a dummy list and honestly I am not pleased with the result. That's mostly because I cannot find a way to restrict search terms in the exact order as they are entered into the search url. copyright can appear in anywhere on page and doesn't necessarily before the years, that's the current story. Is there a more clear way to sort out this? Oh, almost forgot to say the client doesn't wanna spent too much in this - I cannot persuade him simply buy some cool software, unfortunately. I hope there is a way to use clever Google search operators or similar things to go around this issue. Many thanks in advance!

  Read the article

• How to debug anomalous C memory/stack problems

  - by EBM

  Hello, Sorry I can't be specific with code, but the problems I am seeing are anomalous. Character string values seem to be getting changed depending on other, unrelated code. For example, the value of the argument that is passed around below will change merely depending on if I comment out one or two of the fprintf() calls! By the last fprintf() the value is typically completely empty (and no, I have checked to make sure I am not modifying the argument directly... all I have to do is comment out a fprintf() or add another fprintf() and the value of the string will change at certain points!): static process_args(char *arg) { /* debug */ fprintf(stderr, "Function arg is %s\n", arg); ...do a bunch of stuff including call another function that uses alloc()... /* debug */ fprintf(stderr, "Function arg is now %s\n", arg); } int main(int argc, char *argv[]) { char *my_arg; ... do a bunch of stuff ... /* just to show you it's nothing to do with the argv array */ my_string = strdup(argv[1]); /* debug */ fprintf(stderr, "Argument 1 is %s\n", my_string); process_args(my_string); } There's more code all around, so I can't ask for someone to debug my program -- what I want to know is HOW can I debug why character strings like this are getting their memory changed or overwritten based on unrelated code. Is my memory limited? My stack too small? How do I tell? What else can I do to track down the issue? My program isn't huge, it's like a thousand lines of code give or take and a couple dynamically linked external libs, but nothing out of the ordinary. HELP! TIA!

  Read the article

• Generating equals / hashcode / toString using annotation

  - by Bruno Bieth

  I believe I read somewhere people generating equals / hashcode / toString methods during compile time (using APT) by identifying which fields should be part of the hash / equality test. I couldn't find anything like that on the web (I might have dreamed it ?) ... That could be done like that : public class Person { @Id @GeneratedValue private Integer id; @Identity private String firstName, lastName; @Identity private Date dateOfBirth; //... } For an entity (so we want to exlude some fields, like the id). Or like a scala case class i.e a value object : @ValueObject public class Color { private int red, green, blue; } Not only the file becomes more readable and easier to write, but it also helps ensuring that all the attributes are part of the equals / hashcode (in case you add another attribute later on, without updating the methods accordingly). I heard APT isn't very well supported in IDE but I wouldn't see that as a major issue. After all, tests are mainly run by continuous integration servers. Any idea if this has been done already and if not why ? Thanks

  Read the article

• How to effectively use WorkbookBeforeClose event correctly?

  - by Ahmad

  On a daily basis, a person needs to check that specific workbooks have been correctly updated with Bloomberg and Reuters market data ie. all data has pulled through and that the 'numbers look correct'. In the past, people were not checking the 'numbers' which led to inaccurate uploads to other systems etc. The idea is that 'something' needs to be developed to prevent the use from closing/saving the workbook unless he/she has checked that the updates are correct/accurate. The numbers look correct action is purely an intuitive exercise, thus will not be coded in any way. The simple solution was to prompt users prior to closing the specific workbook to verify that the data has been checked. Using VSTO SE for Excel 2007, an Add-in was created which hooks into the WorkbookBeforeClose event which is initialised in the add-in ThisAddIn_Startup private void wb_BeforeClose(Xl.Workbook wb, ref bool cancel) { //.... snip ... if (list.Contains(wb.Name)) { DailogResult result = MessageBox.Show("some message", "sometitle", MessageBoxButtons.YesNo); if (result != DialogResult.Yes) { cancel = true; // i think this prevents the whole application from closing } } } I have found the following ThisApplication.WorkbookBeforeSave vs ThisWorkbook.Application.WorkbookBeforeSave which recommends that one should use the ThisApplication.WorkbookBeforeClose event which I think is what I am doing since will span all files opened. The issue I have with the approach is that assuming that I have several files open, some of which are in my list, the event prevents Excel from closing all files sequentially. It now requires each file to be closed individually. Am I using the event correctly and is this effective & efficient use of the event? Should I use the Application level event or document level event? Is there a way to prevent the above behaviour? Any other suggestions are welcomed VS 2005 with VSTO SE

  Read the article

• Sharepoint: Integrity of lookup fields after a list import

  - by driAn

  Hi there I got a question about the behavior of lookup fields when importing data. I wonder how the lookup fields behave when the list they point to is being replaced/imported. To explain the issue, I will provide a quick example below: As example, assume we have these two sharepoint lists: Product Types ------------- + Type Name + Code Nr + etc Products -------- + Product Name + Product Type (Lookup field to list "Product Types") + etc In my scenario, the Products List contains production data on the production Sharepoint platform. It is filled with data by the business users. However the Product Types list contains rather static data and is maintained by the developer. Now after a development cycle, the developer wants to deploy his new webparts and his new data (product types list). The developer performs the following procedure: On the dev machine: Export "product type" list using stsadm On the production machine: Delete all items in the "product type" list On the production machine: Import the "product type" list using stsadm This means we basically replace the "product type" list on the production server while keeping the "product" list as it is. Now the question: Is this safe? Will the lookup references break under certain circumstances? Any downside of this import/export procedure? What happens if someone accesses a "product" during the import? Will the (now invalid) reference clear its own content (become a null value). What happens if the schema of the "product type" list changes (new column)? Will this cause any troubles? Thanks for all feedback and suggestions!

  Read the article

• CSS Tables & min-width container?

  - by neezer

  <div id="wrapper"> <div id="header">...</div> <div id="main"> <div id="content">...</div> <div id="sidebar">...</div> </div> </div> #wrapper { min-width: 900px; } #main { display: table-row; } #content { display: table-cell; } #sidebar { display: table-cell; width: 250px; } The problem is that the sidebar isn't always at the right-most part of the page (depending on the width of #content). As #content's width is variable (depending on the width of the window), how to I make it so that the sidebar is always at the right-most part of its parent? Ex. Here's what I have now: <--- variable window width ----> --------------------------------- | (header) | --------------------------------- [content] | [sidebar] | | | | | | | | | | | | | And here's what I want: <--- variable window width ----> --------------------------------- | (header) | --------------------------------- [content] | [sidebar] | | | | | | | | | | | | | Please let me know if you need anymore information to help me with this issue. Thanks! PS - I know I can accomplish this easily with floats. I'm looking for a solution that uses CSS tables.

  Read the article

• My button background seems stretched.

  - by Kyle Sevenoaks

  Hi, I have a button as made for you to see here. Looks fine,right? Well on the live site, euroworker.no/shipping it seems stretched. Renders fine in Chrome, IE and Safari, I thought it might have been a FF issue, but loaded the fiddle into FF and seems fine. Quick ref CSS and html: #fortsett_btn { background-image: url(http://euroworker.no/public/upload/fortsett.png?1269434047); background-repeat:no-repeat; background-position:left; background-color:none; border:none; outline;none; visibility: visible; position: relative; z-index: 2; width: 106px; height: 25px; cursor:pointer; }? And HTML <button type="submit" class="submit" id="fortsett_btn" title="Fortsett" value="">&nbsp;</button>? I wonder what's up with it.

  Read the article

< Previous Page | 835 836 837 838 839 840 841 842 843 844 845 846  | Next Page >