Search Results

Search found 22841 results on 914 pages for 'aspect orientated program'.

Page 867/914 | < Previous Page | 863 864 865 866 867 868 869 870 871 872 873 874  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Random generates same number in java

    - by user1613360
    This is my java code. import java.io.*; import java.util.*; import java.util.concurrent.TimeUnit; class search { private int numelem; private int[] input=new int[100]; public void setNumofelem() { System.out.println("Enter the total numebr of elements"); Scanner yz=new Scanner(System.in); numelem=yz.nextInt(); } public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { input[j]=rand.nextInt(max)+1; } } public void printinput() { int b=numelem,t=0; while(true) if(b!=0) { System.out.print(" "+input[t]); b--; t++; } else break; } } public class mycode { public static void main(String args[]) throws Exception { search a=new search(); a.setNumofelem(); a.randomnumber(); a.printinput(); } } Now the function randomnumber() just returns the same number.The function executes perfectly if I execute it as a separate java program but fails miserably if I call it using an object.I have also tried the following variations but nothing works everything return the same number. Variation 1: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { TimeUnit.SECONDS.sleep(1); input[j]=rand.nextInt(max)+1; } } Variation 2: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { rand.setSeed(System.nanoTime()); input[j]=rand.nextInt(max)+1; } } Variation 3: public void randomnumber() throws Exception { int max=500,min=1,n=numelem; Random rand = new Random(); for (int j=0;j < n;j++) { TimeUnit.SECONDS.sleep(1); rand.setSeed(System.nanoTime()); input[j]=rand.nextInt(max)+1; } } Sample input/Output: Enter the number of elements: 5 23 23 23 23 23 23

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • Ideas on implementing threads and cross process communication. - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

    Read the article

  • Pointers to class fields

    - by newbie_cpp
    My task is as follows : Using pointers to class fields, create menu allowing selection of ice, that Person can buy in Ice shop. Buyer will be charged with waffel and ice costs. Selection of ice and charging buyers account must be shown in program. Here's my Person class : #include <iostream> using namespace std; class Iceshop { const double waffel_price = 1; public: } class Person { static int NUMBER; char* name; int age; const int number; double plus, minus; public: class Account { int number; double resources; public: Account(int number, double resources) : number(number), resources(resources) {} } Person(const char* n, int age) : name(strcpy(new char[strlen(n)+1],n)), number(++NUMBER), plus(0), minus(0), age(age) {} Person::~Person(){ cout << "Destroying resources" << endl; delete [] name; } friend void show(Person &p); int* take_age(){ return &age; } char* take_name(){ return name; } void init(char* n, int a) { name = n; age = a; } Person& remittance(double d) { plus += d; return *this; } Person& paycheck(double d) { minus += d; return *this; } Account* getAccount(); }; int Person:: Person::Account* Person::getAccount() { return new Account(number, plus - minus); } void Person::Account::remittance(double d){ resources = resources + d; } void Person::Account::paycheck(double d){ resources = resources - d; } void show(Person *p){ cout << "Name: " << p->take_name() << "," << "age: " << p->take_age() << endl; } int main(void) { Person *p = new Person; p->init("Mary", 25); show(p); p->remittance(100); system("PAUSE"); return 0; } How to start this task ? Where and in what form should I store menu options ?

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Correct usage of socket_select().

    - by Mark Tomlin
    What is the correct way to use socket_select within PHP to send and receive data? I have a connection to the server that allows for both TCP & UDP packet connections, I am utilizing both. Within these connections I'm both sending and receiving packets on the same port, but the TCP packet will be sent on one port (29999) and UDP will be sent on another port (30000). The transmission type will be that of AF_INET. The IP address will be loopback 127.0.0.1. I have many questions on how to create a socket connection within this scenario. For example, is it better to use socket_create_pair to make the connection, or use just socket_create followed by socket_connect, and then implement socket_select? There is a chance that no data will be sent from the server to the client, and it is up to the client to maintain the connection. This will be done by utilizing the time out function within the socket_select call. Should no data be sent within the time limit, the socket_select function will break and a keep alive packet can then be sent. The following script is of the client. // Create $TCP = socket_create(AF_INET, SOCK_STREAM, SOL_TCP); $UDP = socket_create(AF_INET, SOCK_DGRAM, SOL_UDP); // Misc $isAlive = TRUE; $UDPPort = 30000; define('ISP_ISI', 1); // Connect socket_connect($TCP, '127.0.0.1', 29999); socket_connect($UDP, '127.0.0.1', $UDPPort); // Construct Parameters $recv = array($TCP, $UDP); $null = NULL; // Make The Packet to Send. $packet = pack('CCCxSSxCSa16a16', 44, ISP_ISI, 1, $UDPPort, 0, '!', 0, 'AdminPass', 'SocketSelect'); // Send ISI (InSim Init) Packet socket_write($TCP, $packet); /* Main Program Loop */ while ($isAlive == TRUE) { // Socket Select $sock = socket_select($recv, $null, $null, 5); // Check Status if ($sock === FALSE) $isAlive = FALSE; # Error else if ($sock > 0) # How does one check to find what socket changed? else # Something else happed, don't know what as it's not in the documentation, Could this be our timeout getting tripped? }

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Displaying xaml resources dynamically?

    - by Robert
    I used Mike Swanson's illustrator to xaml converter to convert some of my images to xaml. The convert creates a viewbox that contains the image. These viewboxes I made resource files in my program. The code below shows what I'm trying to do: I have a viewmodel that has an enum variable called PrimaryWinding of type Windings. The values PrimD and PrimY of the enum select the respective PrimD and PrimY xaml files in the resources. <UserControl.Resources> <DataTemplate x:Key="PrimTrafo" DataType="{x:Type l:Windings}"> <Frame Source="{Binding}" x:Name="PART_Image" NavigationUIVisibility="Hidden"> <Frame.LayoutTransform> <ScaleTransform ScaleX="0.5" ScaleY="0.5"/> </Frame.LayoutTransform> </Frame> <DataTemplate.Triggers> <DataTrigger Binding="{Binding}" Value="PrimD"> <Setter TargetName="PART_Image" Property="Source" Value="Resources\PrimD.xaml" /> </DataTrigger> <DataTrigger Binding="{Binding}" Value="PrimY"> <Setter TargetName="PART_Image" Property="Source" Value="Resources\PrimY.xaml" /> </DataTrigger> </DataTemplate.Triggers> </DataTemplate> </UserControl.Resources> <!--The contentcontrol that holds the datatemplate defined above--> <Grid > <Grid.ColumnDefinitions> <ColumnDefinition Width="2*"></ColumnDefinition> <ColumnDefinition Width="2*"></ColumnDefinition> <ColumnDefinition Width="1*"></ColumnDefinition> </Grid.ColumnDefinitions> <ContentControl Grid.Column="0" Content="{Binding PrimaryWinding}" ContentTemplate="{StaticResource PrimTrafo}"/> </Grid> This code works. Only I can't resize the drawings to the size of the grid cell. I added the ScaleTransform class to resize the image. Is a Frame the wrong class to hold the drawings? Should I use the ScaleTransform class to resize the drawing to the size of the cell? And how can I do that dynamically?

    Read the article

  • Two loops speeds drawing in a Jframe

    - by noahn567
    I have a program that requires two classes. The player-Names class, and the Player-Model class. I want the player-Names class to repaint every half second, and the Player-Model class to repaint 60 times per second because i want the movement to be smooth. The problem that i am having is that i want all of this to be done on one J-frame. How would i go about doing this? If you could lead me in the right direction or give me a little example that would be great! Thank you :). for some reason it wont let me post so i'm going to put in some random code import java.awt.Color; import java.awt.Font; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.RenderingHints; import javax.swing.JComponent; import javax.swing.JFrame; public class PlayerNames extends JFrame { static int connectionTimer = 0; static int connectionTimer2 = 0; static int reconnect = 0; static int reconnectValue = 1; static int x = 0; static int reconnectWait = connectionTimer + reconnectValue; private static final long serialVersionUID = 1L; public graph gg = new graph(); public graph g = new graph(); private static GameClient socketClient; private GameServer socketServer; public static void main(int width, int height) { PlayerNames tt = new PlayerNames(); // PlayerGraphics t = new PlayerGraphics(); tt.setSize(width, height); if (Game.ServerOwner == 1) { tt.setTitle("Server: " + Game.username); } else { tt.setTitle("Username: " + Game.username); } tt.setVisible(true); tt.getContentPane().add(tt.gg); tt.getContentPane().add(tt.g); tt.setDefaultCloseOperation(EXIT_ON_CLOSE); tt.setResizable(false); }

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • C++ segmentation error when first parameter is null in comparison operator overload

    - by user1774515
    I am writing a class called Word, that handles a c string and overloads the <, , <=, = operators. word.h: friend bool operator<(const Word &a, const Word &b); word.cc: bool operator<(const Word &a, const Word &b) { if(a == NULL && b == NULL) return false; if(a == NULL) return true; if(b == NULL) return false; return a.wd < b.wd; //wd is a valid c string } main: char* temp = NULL; //EDIT: i was mistaken, temp is a char pointer Word a("blah"); //a.wd = [b,l,a,h] cout << (temp<a); i get a segmentation error before the first line of the operator< method after the last line in the main. I can correct the problem by writing cout << (a>temp); where the operator> is similarly defined and i get no errors. but my assignment requires (temp < a) to work so this is where i ask for help. EDIT: i made a mistake the first time and i said temp was of type Word, but it is actually of type char*. so i assume that the compiler converts temp to a Word using one of my constructors. i dont know which one it would use and why this would work since the first parameter is not Word. here is the constructor i think is being used to make the Word using temp: Word::Word(char* c, char* delimeters=NULL) { char *temporary = "\0"; if(c == NULL) c = temporary; check(stoppers!=NULL, "(Word(char*,char*))NULL pointer"); //exits the program if the expression is false if(strlen(c) == 0) size = DEFAULT_SIZE; //10 else size = strlen(c) + 1 + DEFAULT_SIZE; wd = new char[size]; check(wd!=NULL, "Word(char*,char*))heap overflow"); delimiters = new char[strlen(stoppers) + 1]; //EDIT: changed to [] check(delimiters!=NULL,"Word(char*,char*))heap overflow"); strcpy(wd,c); strcpy(delimiters,stoppers); count = strlen(wd); } wd is of type char* thanks for looking at this big question and trying to help. let me know if you need more code to look at

    Read the article

  • OpenGL Coordinate system confusion

    - by user146780
    Maybe I set up GLUT wrong. Basically I want verticies to be reletive to their size in pixels. Ex:right now if I create a hexagon, it hakes up the whole screen even though the units are 6. #include <iostream> #include <stdlib.h> //Needed for "exit" function #include <cmath> //Include OpenGL header files, so that we can use OpenGL #ifdef __APPLE__ #include <OpenGL/OpenGL.h> #include <GLUT/glut.h> #else #include <GL/glut.h> #endif using namespace std; //Called when a key is pressed void handleKeypress(unsigned char key, //The key that was pressed int x, int y) { //The current mouse coordinates switch (key) { case 27: //Escape key exit(0); //Exit the program } } //Initializes 3D rendering void initRendering() { //Makes 3D drawing work when something is in front of something else glEnable(GL_DEPTH_TEST); } //Called when the window is resized void handleResize(int w, int h) { //Tell OpenGL how to convert from coordinates to pixel values glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); //Switch to setting the camera perspective //Set the camera perspective glLoadIdentity(); //Reset the camera gluPerspective(45.0, //The camera angle (double)w / (double)h, //The width-to-height ratio 1.0, //The near z clipping coordinate 200.0); //The far z clipping coordinate } //Draws the 3D scene void drawScene() { //Clear information from last draw glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glLoadIdentity(); //Reset the drawing perspective glPolygonMode(GL_FRONT_AND_BACK, GL_FILL); glBegin(GL_POLYGON); //Begin quadrilateral coordinates //Trapezoid glColor3f(255,0,0); for(int i = 0; i < 6; ++i) { glVertex2d(sin(i/6.0*2* 3.1415), cos(i/6.0*2* 3.1415)); } glEnd(); //End quadrilateral coordinates glutSwapBuffers(); //Send the 3D scene to the screen } int main(int argc, char** argv) { //Initialize GLUT glutInit(&argc, argv); glutInitDisplayMode(GLUT_DOUBLE | GLUT_RGBA | GLUT_DEPTH); glutInitWindowSize(400, 400); //Set the window size //Create the window glutCreateWindow("Basic Shapes - videotutorialsrock.com"); initRendering(); //Initialize rendering //Set handler functions for drawing, keypresses, and window resizes glutDisplayFunc(drawScene); glutKeyboardFunc(handleKeypress); glutReshapeFunc(handleResize); glutMainLoop(); //Start the main loop. glutMainLoop doesn't return. return 0; //This line is never reached } How can I make it so that a polygon of 0,0 10,0 10,10 0,10 defines a polygon starting at the top left of the screen and is a width and height of 10 pixels? Thanks

    Read the article

  • bad file descriptor with close() socket (c++)

    - by user321246
    hi everybody! I'm running out of file descriptors when my program can't connect another host. The close() system call doesn't work, the number of open sockets increases. I can se it with cat /proc/sys/fs/file-nr Print from console: connect: No route to host close: Bad file descriptor connect: No route to host close: Bad file descriptor .. Code: #include <stdio.h> #include <stdlib.h> #include <sys/socket.h> #include <netinet/in.h> #include <netdb.h> #include <string.h> #include <iostream> using namespace std; #define PORT 1238 #define MESSAGE "Yow!!! Are we having fun yet?!?" #define SERVERHOST "192.168.9.101" void write_to_server (int filedes) { int nbytes; nbytes = write (filedes, MESSAGE, strlen (MESSAGE) + 1); if (nbytes < 0) { perror ("write"); } } void init_sockaddr (struct sockaddr_in *name, const char *hostname, uint16_t port) { struct hostent *hostinfo; name->sin_family = AF_INET; name->sin_port = htons (port); hostinfo = gethostbyname (hostname); if (hostinfo == NULL) { fprintf (stderr, "Unknown host %s.\n", hostname); } name->sin_addr = *(struct in_addr *) hostinfo->h_addr; } int main() { for (;;) { sleep(1); int sock; struct sockaddr_in servername; /* Create the socket. */ sock = socket (PF_INET, SOCK_STREAM, 0); if (sock < 0) { perror ("socket (client)"); } /* Connect to the server. */ init_sockaddr (&servername, SERVERHOST, PORT); if (0 > connect (sock, (struct sockaddr *) &servername, sizeof (servername))) { perror ("connect"); sock = -1; } /* Send data to the server. */ if (sock > -1) write_to_server (sock); if (close (sock) != 0) perror("close"); } return 0; }

    Read the article

  • Implementing default constructors

    - by James
    Implement the default constructor, the constructors with one and two int parameters. The one-parameter constructor should initialize the first member of the pair, the second member of the pair is to be 0. Overload binary operator + to add the pairs as follows: (a, b) + (c, d) = (a + c, b + d); Overload the - analogously. Overload the * on pairs ant int as follows: (a, b) * c = (a * c, b * c). Write a program to test all the member functions and overloaded operators in your class definition. You will also need to write accessor (get) functions for each member. The definition of the class Pairs: class Pairs { public: Pairs(); Pairs(int first, int second); Pairs(int first); // other members and friends friend istream& operator>> (istream&, Pair&); friend ostream& operator<< (ostream&, const Pair&); private: int f; int s; }; Self-Test Exercise #17: istream& operator (istream& ins, Pair& second) { char ch; ins ch; // discard init '(' ins second.f; ins ch; // discard comma ',' ins second.s; ins ch; // discard final '(' return ins; } ostream& operator<< (ostream& outs, const Pair& second) { outs << '('; outs << second.f; outs << ", " ;// I followed the Author's suggestion here. outs << second.s; outs << ")"; return outs; }

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • urgent..haskell mini interpreter

    - by mohamed elshikh
    i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

    Read the article

  • Calculating the Angle Between Two vectors Using Dot Product

    - by P. Avery
    I'm trying to calculate the angle between two vectors so that I can rotate a character in the direction of an object in 3D space. I have two vectors( character & object), loc_look, and modelPos respectively. For simplicity's sake I am only trying to rotate along the up axis...yaw. loc_look = D3DXVECTOR3 (0, 0, 1), modelPos = D3DXVECTOR3 (0, 0, 15); I have written this code which seems to be the correct calculations. My problem arises, seemingly, because the rotation I apply to the character's look vector(loc_look) exceeds the value of the object's position (modelPos). Here is my code: BOOL CEntity::TARGET() { if(graphics.m_model->m_enemy) { D3DXVECTOR3 modelPos = graphics.m_model->position; D3DXVec3Normalize(&modelPos, &modelPos); //D3DXVec3Normalize(&loc_look, &loc_look); float dot = D3DXVec3Dot(&loc_look, &modelPos); float yaw = acos(dot); BOOL neg = (loc_look.x > modelPos.x) ? true : false; switch ( neg ) { case false: Yaw(yaw); return true; case true: Yaw(-yaw); return true; } } else return false; } I rotate the character's orientation matrix with the following code: void CEntity::CalculateOrientationMatrix(D3DXMATRIX *orientationMatrix) { D3DXMatrixRotationAxis(&rotY, &loc_up, loc_yaw); D3DXVec3TransformCoord(&loc_look, &loc_look, &rotY); D3DXVec3TransformCoord(&loc_right, &loc_right, &rotY); D3DXMatrixRotationAxis(&rotX, &loc_right, loc_pitch); D3DXVec3TransformCoord(&loc_look, &loc_look, &rotX); D3DXVec3TransformCoord(&loc_up, &loc_up, &rotX); D3DXMatrixRotationAxis(&rotZ, &loc_look, loc_roll); D3DXVec3TransformCoord(&loc_up, &loc_up, &rotZ); D3DXVec3TransformCoord(&loc_right, &loc_right, &rotZ); *orientationMatrix *= rotX * rotY * rotZ; orientationMatrix->_41 = loc_position.x; orientationMatrix->_42 = loc_position.y; orientationMatrix->_43 = loc_position.z; //D3DXVec3Normalize(&loc_look, &loc_look); SetYawPitchRoll(0,0,0); // Reset Yaw, Pitch, & Roll Amounts } Also to note, the modelPos.x increases by 0.1 each iteration so the character will face the object as it moves along the x-axis... Now, when I run program, in the first iteration everything is fine(I haven't rotated the character yet). On the second iteration, the loc_look.x value is greater than the modelPos.x value(I rotated the character too much using the angle specified with the dot product calculations in the TARGET function). Therefore on the second iteration my code will rotate the character left to adjust for the difference in the vectors' x values... How can I tighten up the measurements so that I do not rotate my character's look vector by too great a value?

    Read the article

  • Nested WHILE loops not acting as expected - Javascript / Google Apps Script

    - by dthor
    I've got a function that isn't acting as intended. Before I continue, I'd like preface this with the fact that I normally program in Mathematica and have been tasked with porting over a Mathematica function (that I wrote) to JavaScript so that it can be used in a Google Docs spreadsheet. I have about 3 hours of JavaScript experience... The entire (small) project is calculating the Gross Die per Wafer, given a wafer and die size (among other inputs). The part that isn't working is where I check to see if any corner of the die is outside of the effective radius, Reff. The function takes a list of X and Y coordinates which, when combined, create the individual XY coord of the center of the die. That is then put into a separate function "maxDistance" that calculates the distance of each of the 4 corners and returns the max. This max value is checked against Reff. If the max is inside the radius, 1 is added to the die count. // Take a list of X and Y values and calculate the Gross Die per Wafer function CoordsToGDW(Reff,xSize,ySize,xCoords,yCoords) { // Initialize Variables var count = 0; // Nested loops create all the x,y coords of the die centers for (var i = 0; i < xCoords.length; i++) { for (var j = 0; j < yCoords.length, j++) { // Add 1 to the die count if the distance is within the effective radius if (maxDistance(xCoords[i],yCoords[j],xSize,ySize) <= Reff) {count = count + 1} } } return count; } Here are some examples of what I'm getting: xArray={-52.25, -42.75, -33.25, -23.75, -14.25, -4.75, 4.75, 14.25, 23.75, 33.25, 42.75, 52.25, 61.75} yArray={-52.5, -45.5, -38.5, -31.5, -24.5, -17.5, -10.5, -3.5, 3.5, 10.5, 17.5, 24.5, 31.5, 38.5, 45.5, 52.5, 59.5} CoordsToGDW(45,9.5,7.0,xArray,yArray) returns: 49 (should be 72) xArray={-36, -28, -20, -12, -4, 4, 12, 20, 28, 36, 44} yArray={-39, -33, -27, -21, -15, -9, -3, 3, 9, 15, 21, 27, 33, 39, 45} CoordsToGDW(32.5,8,6,xArray,yArray) returns: 39 (should be 48) I know that maxDistance() is returning the correct values. So, where's my simple mistake? Also, please forgive me writing some things in Mathematica notation... Edit #1: A little bit of formatting. Edit #2: Per showi, I've changed WHILE loops to FOR loops and replaced <= with <. Still not the right answer. It did clean things up a bit though... Edit #3: What I'm essentially trying to do is take [a,b] and [a,b,c] and return [[a,a],[a,b],[a,c],[b,a],[b,b],[b,c]]

    Read the article

  • What makes a Winform position initially stale?

    - by msorens
    The code below demonstrates a very simple problem; I am hoping that I am just missing a setting that someone might be able to reveal. Goal (1) Launch main winform (MainForm). (2) Press button to display secondary winform (ShadowForm) that is semi-transparent and should exactly overlay MainForm. What Actually Happens Scenario 1: Launch main winform then press button: ShadowForm displays with correct size but incorrect location, lower and to the right (as if it was cascaded). Press button to close ShadowForm again. Press button once more to reopen ShadowForm and now it is in the correct position, covering MainForm. Scenario 2: Launch main winform, move it around, then press button: ShadowForm displays with correct size but incorrect location (where the MainForm was before moving it). Press button to close; press again to reopen and now ShadowForm is in the correct position. using System; using System.Windows.Forms; namespace LocationTest { static class Program { static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new MainForm()); } } public class MainForm : Form { ShadowForm shadowForm = new ShadowForm(); Button button1 = new Button(); System.ComponentModel.IContainer components = null; public MainForm() { this.SuspendLayout(); this.button1.Location = new System.Drawing.Point(102, 44); this.button1.Size = new System.Drawing.Size(75, 23); this.button1.Text = "button1"; this.button1.Click += new System.EventHandler(this.button1_Click); this.ClientSize = new System.Drawing.Size(292, 266); this.Controls.Add(this.button1); this.ResumeLayout(false); } private void button1_Click(object sender, EventArgs e) { if (shadowForm.Visible) { shadowForm.Hide(); } else { shadowForm.Size = Size; // this always works shadowForm.Location = Location; // this fails first time, but works second time! shadowForm.Show(); } } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } public class ShadowForm : Form { private System.ComponentModel.IContainer components = null; public ShadowForm() { this.SuspendLayout(); this.BackColor = System.Drawing.Color.Black; this.FormBorderStyle = System.Windows.Forms.FormBorderStyle.None; this.Opacity = 0.5; this.Click += new System.EventHandler(this.ShadowForm_Click); this.ResumeLayout(false); } private void ShadowForm_Click(object sender, EventArgs e) { Hide(); } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } }

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Weird Datagrid / paint behaviour

    - by Shane.C
    The scenario: A method sends out a broadcast packet, and returned packets that are validated are deemed okay to be added as a row in my datagrid (The returned packets are from devices i want to add into my program). So for each packet returned, containing information about a device, i create a new row. This is done by first sending packets out, creating rows and adding them to a list of rows that are to be added, and then after 5 seconds (In which case all packets would have returned by then) i add the rows. Here's a few snippets of code. Here for each returned packet, i create a row and add it to a list; DataRow row = DGSource.NewRow(); row["Name"] = deviceName; row["Model"] = deviceModel; row["Location"] = deviceLocation; row["IP"] = finishedIP; row["MAC"] = finishedMac; row["Subnet"] = finishedSubnet; row["Gateway"] = finishedGateway; rowsToAdd.Add(row); Then when the timer elapses; void timerToAddRows_Elapsed(object sender, System.Timers.ElapsedEventArgs e) { timerToAddRows.Enabled = false; try { int count = 0; foreach (DataRow rowToAdd in rowsToAdd) { DGSource.Rows.Add(rowToAdd); count++; } rowsToAdd.Clear(); DGAutoDevices.InvokeEx(f => DGAutoDevices.Refresh()); lblNumberFound.InvokeEx(f => lblNumberFound.Text = count + " new devices found."); } catch { } } So at this point, each row has been added, and i call the re paint, by doing refresh. (Note: i've also tried refreshing the form itself, no avail). However, when the datagrid shows the rows, the scroll bar / datagrid seems to have weird behavour..for example i can't highlight anything with clicks (It's set to full row selection), and the scroll bar looks like so; Calling refresh doesn't work, although if i resize the window even 1 pixel, or minimize and maximise, the problem is solved. Other things to note : The method that get's the packets and adds the rows to the list, and then from the list to the datagrid runs in it's own thread. Any ideas as to something i might be missing here?

    Read the article

< Previous Page | 863 864 865 866 867 868 869 870 871 872 873 874  | Next Page >