Search Results

Search found 30046 results on 1202 pages for 'document load'.

Page 911/1202 | < Previous Page | 907 908 909 910 911 912 913 914 915 916 917 918  | Next Page >

• Getting Error while running RED5 server - class path resource [red5.xml] cannot be opened because it does not exist

  - by sunil221

  HI , I have installed java version "1.6.0_14" and Ant version 1.8.2 for red5 Server. when i am trying to run red5 server i am getting the following error please help Root: /usr/local/red5 Deploy type: bootstrap Logback selector: org.red5.logging.LoggingContextSelector Setting default logging context: default 11:27:39.838 [main] INFO org.red5.server.Launcher - Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/local/red5/red5.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/local/red5/lib/logback-classic-0.9.26.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. 11:27:39.994 [main] INFO o.s.c.s.FileSystemXmlApplicationContext - Refreshing org.springframework.context.support.FileSystemXmlApplicationContext@39d85f79: startup date [Mon Dec 21 11:27:39 EST 2009]; root of context hierarchy 11:27:40.149 [main] INFO o.s.b.f.xml.XmlBeanDefinitionReader - Loading XML bean definitions from class path resource [red5.xml] Exception org.springframework.beans.factory.BeanDefinitionStoreException: IOException parsing XML document from class path resource [red5.xml]; nested exception is java.io.FileNotFoundException: class path resource [red5.xml] cannot be opened because it does not exist Bootstrap complete

  Read the article

• Flash plugin locks up Firefox, Chrome and Safari behind a corporate proxy, IE6 works fine

  - by Shevek

  At work I am forced by corporate policy to use IE6. Obviously this is not so good so I use FF for most of my browsing. However there is a problem once I have installed the Flash plug-in - FF locks up when trying to load Flash media. Looking at the status bar at the time of the lock up it appears this happens when the browser tries to get cross domain data. The Flash Active X plug-in in IE does not suffer this issue. I have tried it in a brand new profile in FF with Flash as the only plug in and it locks up. We have 2 different proxy servers and both exhibit the same problem. I have also tried Chrome and Safari and both lock up with the plug-in installed. So, has anyone else had this problem and solved it? Or, is there any way to disable cross domain data access in the flash plug-in? Or, is there any way to disable the "This site needs an additional plug-in" ribbon which appears when the plug-in is not installed. Many thanks!

  Read the article

• Looking for a help desk ticketing system..

  - by Dan

  Hi guys Im looking for a good help desk ticket solution. It must perform the following actions for it to be useful. It needs to have a single point of contact via email..e.g [email protected] If we recieve a telephone(or an email outside of the system) we need to be able to create a ticket as if had been added via the single point of contact, this needs to be done with ease in order to save time. Certain people within our organisation deal with certain customers, so if the email/ custom input support call as mentioned in bullet 2 is picked up as having a relationship with that certain person in our organisation it needs to be sent to them/put in their queue for them to work on. If a person is out of office or sick any tickets sent to them must be forwarded to somebody else or put into a seperate pool of tickets that anybody can access. Perhaps have an agent that sorts through tickets in the pool and assigns them to anybody who is available, preferably the person with fewest tickets in their queue/list. Once a customer emails and the system logs it they immediately get a response with a ticket number and maybe details of who is dealing with the problem. Any correspondance in relation to a particular ticket is automatically grouped into some sort of message, and not made into a load of separate tickets. I.e system scans incoming email subjects for ticket numbers and assosciates it with exisiting tickets if that number exists. Any help is much appreciated Thanks P.S I have taken a look at OTRS but i'm not feeling it so unless someone can convince me I guess i'm after an alternative.

  Read the article

• Can you "swap" the Sysprep answer file in Windows 7

  - by Ben

  I have a load of new Lenovo laptops which I am due to distribute in my company. We are distributed in multiple locations and I want to ship the laptops "boxed" and untouched by IT hand for distribution. We are using LANDesk to do all the software distribution and provisioning, but are currently falling at the first hurdle as when booted, the laptops kick into the Lenovo mini-setup wizard. I assume this is because they have been sysprepped at Lenovo. In order to keep with our (almost) zero touch strategy I want the users to PXE boot into a PE of some sort, which will run a script on startup which replaces the sysprep answer file with one of my own. (i.e. prepopulated with product key, company info etc.) and then reboot to complete Sysprep. The plan is that this will run, and then install the LANDesk agent as a post-sysprep task, which in turn will complete the provisioning. Anyone have any experience / know any pitfalls to look out for / can suggest a suitable, PXE-bootable PE environment? Apologies for the verbosity of the question - it takes a bit of explaining! Thanks in advance, Ben

  Read the article

• Setup site folders on Apache and PHP

  - by Cobus Kruger

  I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

  Read the article

• htaccess not properly rewriting urls

  - by Cameron Ball

  This is a bit of a weird one. I'm doing some work on a server, and I need rewrite rules for directories that actually exist (in some cases, they are more than one level deep) At the moment my .htaccess looks like this: RewriteEngine on RewriteRule ^simfiles/([-\ a-zA-Z0-9:/]+)$ http://mydomain.com/?portal=simfiles&folder=$1 [L] And this is working OK, for example, a url like: mydomain.com/sifmiles/my-files Will get redirected to mydomain.com/?portal=simfiles&folder=my-files Or in the case of a directory structure that is deeper than one level: mydomain.com/sifmiles/my-files/more-of-my-files Will get redirected to mydomain.com/?portal=simfiles&folder=my-files/more-of-my-files I wrote the regex so that it won't match things with a . in the path, because there are css and js files which reside in simfiles/somedirectory, and if I redirect everything then these cannot be loaded. I tried a configuration like this: RewriteEngine on RewriteCond %{REQUEST_FILENAME} !-f RewriteRule ^simfiles/([-\ a-zA-Z0-9:/\.]+)$ http://mydomain.com/?portal=simfiles&folder=$1 [L] But that doesn't work, things still don't load properly. So my first question is, how can I achieve this "properly"? I don't like my solution because it means redirects won't occur if the folder has a . in its name. My second problem, is that while the redirection is happening properly, the url becomes: http://mydomain.com/?portal=simfiles&folder=my-files I want the URL to remain clean, like: http://mydomain.com/sifmiles/my-files How can I achieve this?

  Read the article

• Samba 3.5 Shadow Copy for Windows 7

  - by Prashanth Sundaram

  Over the past several days I have been trying to get the shadow to work with samba but haven’t been successful. Can someone check below config and let me know if I am missing something? We are using Equallogic SAN and iSCSI LUNS to mount volumes. I can cleanly access samba shares on Windows 7 clients but just not shadow copy. I have referred the official how-to but couldn’t get it to work. I see these messages in the logs. Any help is deeply appreciated. [2012/10/31 12:20:53.549863, 0] smbd/nttrans.c:2170(call_nt_transact_ioctl) FSCTL_GET_SHADOW_COPY_DATA: connectpath /fs/test-01, failed. [2012/10/31 12:21:13.887198, 0] modules/vfs_shadow_copy2.c:734(shadow_copy2_get_shadow_copy2_data) shadow:snapdir not found for /fs/test-01 in get_shadow_copy_data [2012/10/31 12:21:13.887265, 0] smbd/nttrans.c:2170(call_nt_transact_ioctl) FSCTL_GET_SHADOW_COPY_DATA: connectpath /fs/test-01, failed. == Samba pkgs == samba-3.5.10-116.el6_2.x86_64 samba-common-3.5.10-116.el6_2.x86_64 samba-winbind-clients-3.5.10-116.el6_2.x86_64 samba-client-3.5.10-116.el6_2.x86_64 === df –h == First is the iSCSI LUN and 2 others are snapshots. /dev/mapper/eql-0-fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01 /dev/mapper/eql-2-0+fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01/@GMT-2012.10.26-17.32.42/fs/test-01 (SNAPSHOT-1) /dev/mapper/eql-d-0+fs-test01 5.0G 2.3G 2.5G 48% /fs/test-01/@GMT-2012.10.31-11.52.42/fs/test-01 (SNAPSHOT- 2) ===/etc/samba/smb.conf === [global] workgroup = DOMAIN server string = Samba Server Version %v security = ads realm = DOMAIN.CORP encrypt passwords = yes guest account = nobody map to guest = bad uid log file = /var/log/samba/%m.log domain master = no local master = no preferred master = no os level = 0 load printers = no show add printer wizard = no printable = no printcap name = /dev/null disable spoolss = yes follow symlinks = yes wide links = yes unix extensions = no [test] comment = Test Directories path = /fs/test-01 vfs objects = shadow_copy2 #shadow_copy2: sort = desc #shadow: localtime = yes #shadow: snapdir = /fs/test-01/test #shadow: basedir = /fs/test-01 guest ok = yes writeable = yes map archive = no force create mode = 0660 force directory mode = 2770 inherit owner = yes inherit permissions = yes All feedback is welcome. Thanks!

  Read the article

• Gmail and FB is not rendering properly in Firefox

  - by Andy

  I am unable read Gmail in my Firefox browser on my laptop. However, there are no problems when I try to access Gmail on my office desktop. In fact, Gmail renders fine on IE on both computers. Things I have tried: Uninstalling and reinstalling Firefox. Using Firefox 3.6.26 and Firefox 10; same problem. Clearing the cache. But all to no avail. For starters: My background image does not get loaded. It says "Oops. Your selected image failed to load". The buttons for the new look do not get rendered, but when I do a mouse-over I see text which helps me navigate. When I try to read a message, I see the subject line and I see the reply / forward box. The message body does not get rendered, it seems like a styling error. Check this screenshot where the icons in the GMail new look are not rendered properly Check this screenshot where even facebook is not getting rendered properly EDIT: 25th Feb 2012 GMAIL is getting rendered fine in the old look

  Read the article

• What characteristic of networking/TCP causes linear relation between TCP activity and latency?

  - by DeLongey

  The core of this problem is that our application uses websockets for real-time interfaces. We are testing our app in a new environment but strangely we're noticing an increasing delay in TCP websocket packets associated with an increase in websocket activity. For example, if one websocket event occurs without any other activity in a 1-minute period, the response from the server is instantaneous. However, if we slowly increase client activity the latency in server response increases with a linear relationship (each packet will take more time to reach the client with more activity). For those wondering this is NOT app-related since our logs show that our server is running and responding to requests in under 100ms as desired. The delay starts once the server processes the request and creates the TCP packet and sends it to the client (and not the other way around). Architecture This new environment runs with a Virtual IP address and uses keepalived on a load balancer to balance the traffic between instances. Two boxes sit behind the balancer and all traffic runs through it. Our host provider manages the balancer and we do not have control over that part of the architecture. Theory Could this somehow be related to something buffering the packets in the new environment? Thanks for your help.

  Read the article

• Server cost for smartphone app with web service

  - by FrankieA

  Hello, I am working on a smartphone application that will require a backend web service - but I have absolutely clueless to how much it will cost. Web Service will handle: - login of users - cataloging of our user base - holding minimal profile information for users (the only binary data is a display picture which will be < 20k each) - performing some very minor calculation/algorithm before return results - All the above will be communicated to server from a smartphone (iPhone/BlackBerry/Android) Bandwidth Requirements: - We want to handle up to 10k users throughout the day. - I predict 10k * 50 HTTP requests a day = 500,000 requests a day * 30 = 15 million requests a month Space Requirements: - Data will be in SQL database. - I predict 1MB/user * 10k = 10GB + overhead. In other words - space is not a big issue. Software Requirements: (unless someone knows an alternative) - Windows Server 2008 + IIS - MSFT SQL Server Note: This is 100% new to me, so please hit me with all you got. Do I need Windows Server or are there alternative? Is it better to get multiple cheap servers to distribute load? Will Amazon S3 work for me? How about Windows Azure? Thank you!!

  Read the article

• "Options ExecCGI is off in this directory" When try to run Ruby code using mod_ruby

  - by Itay Moav

  I am on Ubuntu, Apache 2.2 Installed the fcgi via apt-get then removed it via apt-get remove. Installed mod-ruby configuration I added to Apache: LoadModule ruby_module /usr/lib/apache2/modules/mod_ruby.so RubyRequire apache/ruby-run <Directory /var/www> Options +ExecCGI </Directory> <Files *.rb> SetHandler ruby-object RubyHandler Apache::RubyRun.instance </Files> <Files *.rbx> SetHandler ruby-object RubyHandler Apache::RubyRun.instance </Files> I have a file in the www direcoty with puts 'baba' I have other files in that directory, all accessible via Apache. Test file has been chmod 777 In the browser I get 403. In Apache error log I get: [error] access to /var/www/t.rb failed for (null), reason: Options ExecCGI is off in this directory If I move this to a sub folder rubytest and modify the relevant config to be: <Directory /var/www/rubytest> Options +ExecCGI </Directory> and making sure the directory has 755 permissions on it, it just try to download the file, as if it does not recognize the postfix *.rb any more If I give directory and files 777 it fails: usr/lib/ruby/1.8/apache/ruby-run.rb:53: warning: Insecure world writable dir /var/www/rubytest in LOAD_PATH, mode 040777 [Tue May 24 19:39:58 2011] [error] mod_ruby: error in ruby [Tue May 24 19:39:58 2011] [error] mod_ruby: /usr/lib/ruby/1.8/apache/ruby-run.rb:53:in load': loading from unsafe file /var/www/rubytest/t.rb (SecurityError) [Tue May 24 19:39:58 2011] [error] mod_ruby: from /usr/lib/ruby/1.8/apache/ruby-run.rb:53:in handler' BUT, IF I USE *.rbx it works like a charm...go figure.

  Read the article

• Puppet and Vim fighting over Ruby version

  - by devians

  I have installed puppet from the .dmg from puppetlabs. If I remove ruby 1.9.3, puppet works, but other things like my vim install (dependant plugins) do not. According to http://docs.puppetlabs.com/guides/platforms.html#ruby-versions 1.9.3 is supported. So whats going wrong with puppet? % uname -a Darwin Kusanagi.local 11.4.2 Darwin Kernel Version 11.4.2: Thu Aug 23 16:25:48 PDT 2012; root:xnu-1699.32.7~1/RELEASE_X86_64 x86_64 % which ruby /usr/local/bin/ruby % ruby --version ruby 1.9.3p327 (2012-11-10 revision 37606) [x86_64-darwin11.4.2] % /usr/bin/ruby --version ruby 1.8.7 (2012-02-08 patchlevel 358) [universal-darwin11.0] % brew info ruby 1 ? ruby: stable 1.9.3-p327, HEAD http://www.ruby-lang.org/en/ Depends on: pkg-config, readline, gdbm, libyaml /usr/local/Cellar/ruby/1.9.3-p327 (796 files, 17M) * https://github.com/mxcl/homebrew/commits/master/Library/Formula/ruby.rb ==> Options --with-tcltk Install with Tcl/Tk support --with-suffix Suffix commands with "19" --universal Build a universal binary --with-doc Install documentation ==> Caveats NOTE: By default, gem installed binaries will be placed into: /usr/local/Cellar/ruby/1.9.3-p327/bin You may want to add this to your PATH. % puppet /usr/local/Cellar/ruby/1.9.3-p327/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load such file -- puppet/util/command_line (LoadError) from /usr/local/Cellar/ruby/1.9.3-p327/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require' from /usr/bin/puppet:3:in `<main>'

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Reinserted a RAID disk. Defined as foreign. Is import or clear the correct choice?

  - by Petrus

  I have re-inserted a RAID disk, on a DELL server with Windows Server 2008. The drive-status indicator was changing between a green and amber light, and the monitor gave the following message: There are offline or missing virtual drives with preserved cache. Please check the cables and ensure that all drives are present. Press any key to enter the configuration utility. I pressed a key and the PERC 6/I Integrated BIOS Configuration Utility showed that the RAID Status for that disk was Offline. After reinsertion of the disk the monitor is giving the following message: Foreign configuration(s) found on adapter. Press any key to continue or ‘C’ load the configuration utility, or press ‘F’ to import foreign configuration(s) and continue. After checking around on the net I am uncertain if I should choose import or clear. I cannot find out if an import means importing information from the array/system to the now foreign disk or the other way, i.e. importing information from the foreign disk to the array/system that was actually working fine. Also; if clear is a necessary thing to do ahead of a rebuild of that disk, or if clear means to clear the system to somehow make it ready to import the information from the foreign disk to the array/system, which is not what I want. I imagine that making the wrong choice here might be fatal. Please help clearing this out by telling what to choose and why.

  Read the article

• IIS 7.5 / Windows 7: Error 500.19, error code 0x800700b7

  - by nikhiljoshi

  I have been trying to resolve this issue. I am using Windows 7 and VS2008 +iis7.5. My project is stuck because of this error. The error says: Error Summary HTTP Error 500.19 - Internal Server Error The requested page cannot be accessed because the related configuration data for the page is invalid. `Detailed Error Information Module IIS Web Core Notification BeginRequest Handler Not yet determined Error Code 0x800700b7 Config Error There is a duplicate 'system.web.extensions/scripting/scriptResourceHandler' section defined Config File \\?\C:\inetpub\wwwroot\test23\web.config Requested URL http://localhost:80/test23 Physical Path C:\inetpub\wwwroot\test23 Logon Method Not yet determined Logon User Not yet determined Config Source 15: <sectionGroup name="scripting" type="System.Web.Configuration.ScriptingSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> 16: <section name="scriptResourceHandler" type="System.Web.Configuration.ScriptingScriptResourceHandlerSection, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" requirePermission="false" allowDefinition="MachineToApplication"/> 17: <sectionGroup name="webServices" type="System.Web.Configuration.ScriptingWebServicesSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> ` I followed the instructions in this Microsoft solution document, but it didn't help. http://support.microsoft.com/kb/942055

  Read the article

• "postgres blocked for more than 120 seconds" - is my db still consistent?

  - by nn4l

  I am using an iscsi volume on an Open-E storage system for several virtual machines running on a XenServer host. Occasionally, when there is a very high disk I/O load on the virtual machines (and therefore also on the storage system), I got this error message on the vm consoles: [2594520.161701] INFO: task kjournald:117 blocked for more than 120 seconds. [2594520.161787] "echo 0 > /proc/sys/kernel/hung_task_timeout_secs" disables this message. [2594520.162194] INFO: task flush-202:0:229 blocked for more than 120 seconds. [2594520.162274] "echo 0 > /proc/sys/kernel/hung_task_timeout_secs" disables this message. [2594520.162801] INFO: task postgres:1567 blocked for more than 120 seconds. [2594520.162882] "echo 0 > /proc/sys/kernel/hung_task_timeout_secs" disables this message. I understand this error message is caused by the kernel to inform that these processes haven't been run for 120 seconds, most likely because a disk access to the storage system has not yet been processed. But what is the effect on the processes. For example, will the postgres process eventually write its data when the storage system is idle again after a few minutes, so that all data is still consistent? Or will it abort the write, leaving some tables in an inconsistent state? I certainly expect that the former should be the case - if the disk access is slow, postgres (or any other affected process) should just wait as long as it takes. I can live with the application hanging for a few minutes. But if there is a chance for data corruption then any of these errors is really bad news. Please advise what to do here.

  Read the article

• atl90.dll version 9.0.30729.4148 is missing in WinSxS folder

  - by mkva

  Hi I have the following problem: when starting Visual Studio 2008, it says "Cannot find one or more components. Please reinstall the application." and stops. With the help of Sysinternals ProcessMonitor, I found out that Visual Studio could not load the atl90.dll 9.0.30729.4148 from the WinSxS folder. I tried to manually copy the older atl90.dll 9.0.30729.1 with the result that Visual Studio works again. Now I call this a dirty workaround, and not a solution. Plus I still don't know the reason why the atl90.dll disappeared in the first place. So my questions: - Does anyone know of a reason why this might have happened? - Does anyone know a real solution to the problem, e.g. a Microsoft download that includes the atl90.dll in the correct version 9.0.30729.4148 that installs into WinSxS? Some details: - WinXp SP3 - missing DLL: C:\WINNT\WinSxS\x86_Microsoft.VC90.ATL_1fc8b3b9a1e18e3b_9.0.30729.4148_x-ww_353599c2\atl90.dll - workaround DLL: C:\WINNT\WinSxS\x86_Microsoft.VC90.ATL_1fc8b3b9a1e18e3b_9.0.30729.1_x-ww_d01483b2\atl90.dll - manifests in WinSxS seem to be alright, but unfortunately all point to the missing version 9.0.30729.4148 Thanks, Markus

  Read the article

• Remote search system for samba shares

  - by fostandy

  I have several shares residing on a samba server in a small business environment that I would like to provide search facilities for. Ideally this would be something like google desktop with some extra features (see below), but lacking this the idea is to take what I can get, or at least get an idea for what is out there. Using google desktop search as a reference model, the principle additional requirement is that it is usable from clients over the network. In addition there are some other notes (note that none of these are hard requirements) The content is always files, residing on a single server, accessible from samba shares. Standard ms office document fare Also a lot of rars and zips which it is necessary to search inside. Permissions support, allowing for user-based control to reflect current permission access in samba shares. The userbase will remain fairly static, so manual management of users is fine. majority of users will be Windows based I know there are plenty of search indexers out there: beagle and tracker seem to be the most popular. Most do not seem to offer access control and web-based/remote search does not seem to be high priority. I've also seen a recent post on the samba mailing list asking for pretty much the exact same thing. (They mention a product called IBM OmniFind Yahoo! Edition and while their initial reception seems positive, I am pretty skeptical. RHEL 4? Firefox 2? Updated much?) What else is out there? Are you in a similar situation? What do you use?

  Read the article

• Solaris TCP stack tuning

  - by disserman

  We have a large web project (about 2-3k requests per second), using haproxy (http://haproxy.1wt.eu/) as a frontend and load balancer between the java application servers. The frontend (haproxy) is running on Linux but we are going to migrate it to the Solaris 10 as all our other servers are running under Solaris. After switching a traffic I see the two things: a) the web site became loading slower (5-10 seconds with images in comparison to 2-3 seconds on Linux) b) sometimes haproxy fails to perform a "lifecheck" (get a special web page and analyze http response code) due to the socket timeout. After switching traffic back to Linux everything is okay. I've tried to tune all params I found in /dev/tcp but no progress. I believe the problem is in some open socket limitations. If someone can point me to the answer, I would be greatly appreciated. p.s. haproxy is running under Xen DomU on Linux (Kernel 2.6.18, Debian 5), under zone on Solaris (10 u8). the only thing we did on Linux is increasing of ip_conntrack_max (I believe Solaris option tcp_conn_req_max_q is the equivalent).

  Read the article

• How do i tell if my drivers are up to date on Acer?

  - by joe

  Hoping some kind souls can help me out ? I got a blue screen the other day after trying to load sandboxie. So its obviously conflicting with something. I checked if my drivers were up to date on my acer aspire one AOD270 on this intel based site; http://www.drivermanager.com/en/down...tel&Logo=intel Its showing i have 2 drivers that need updating ; Intel NM10 Express chipset and the Realtek PCIE Cardreader. I have no idea whether to do the update via the Intel Driver update site or the Acer drivers download page? I then ran Bluescreenview and on the dump file its showing ; ''caused by driver'' igdkmd32.sys ''file description'' Intel (R) WDDM Kernel mode driver ''product name''Intel Graphics Accelerator Drivers for Windows 7(R) I bought the laptop here in SE Asia about a year ago. The ''HOT!! NEW download tool'' on the acer drivers site (below) doesnt seem to work and the info about removing and installing drivers is limited. Not sure what to trust on non acer/manufacturer sites. http://support.acer.com/us/en/produc...1&modelId=4040 I've located the igdkmd32.sys file inside the INTEL GRAPHICS MEDIA ACCELERATOR 3600 SERIES 8.14.8.1064. When i click on ''update driver'' in control panel it searches and says its up to date. In windows maintenance it says this intel had a problem, but no solution. For all i know my drivers could be up to date and its something else. Can anybody advise a dummy step by step the process i should follow ? I've never done this before. eg do i delete the old driver first and then download the new one.how much of a problem i could cause by downloading this type of thing wrongly? As yet i havent downloaded any drivers. I've asked on other forums but no luck as yet. Thanks for any help!

  Read the article

• Using smartctl to get vendor specific Attributes from ssd drive behind a SmartArray P410 controller

  - by Lairsdragon

  Recently I have deployed some HP server with SSD's behind a SmartArray P410 controller. While not official supported from HP the server work well sofar. Now I like to get wear level info's, error statistics etc from the drive. While the SA P410 supports a passthru of the SMART Command to a single drive in the array the output I was not able to the the interesting things from the drive. In this case especially the value the Wear level indicator is from interest for me (Attr.ID 233), but this is ony present if the drive is directly attanched to a SATA Controller. smartctl on directly connected ssd: # smartctl -A /dev/sda smartctl version 5.38 [x86_64-unknown-linux-gnu] Copyright (C) 2002-8 Bruce Allen Home page is http://smartmontools.sourceforge.net/ === START OF READ SMART DATA SECTION === SMART Attributes Data Structure revision number: 5 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 3 Spin_Up_Time 0x0000 100 000 000 Old_age Offline In_the_past 0 4 Start_Stop_Count 0x0000 100 000 000 Old_age Offline In_the_past 0 5 Reallocated_Sector_Ct 0x0002 100 100 000 Old_age Always - 0 9 Power_On_Hours 0x0002 100 100 000 Old_age Always - 8561 12 Power_Cycle_Count 0x0002 100 100 000 Old_age Always - 55 192 Power-Off_Retract_Count 0x0002 100 100 000 Old_age Always - 29 232 Unknown_Attribute 0x0003 100 100 010 Pre-fail Always - 0 233 Unknown_Attribute 0x0002 088 088 000 Old_age Always - 0 225 Load_Cycle_Count 0x0000 198 198 000 Old_age Offline - 508509 226 Load-in_Time 0x0002 255 000 000 Old_age Always In_the_past 0 227 Torq-amp_Count 0x0002 000 000 000 Old_age Always FAILING_NOW 0 228 Power-off_Retract_Count 0x0002 000 000 000 Old_age Always FAILING_NOW 0 smartctl on P410 connected ssd: # ./smartctl -A -d cciss,0 /dev/cciss/c1d0 smartctl 5.39.1 2010-01-28 r3054 [x86_64-unknown-linux-gnu] (local build) Copyright (C) 2002-10 by Bruce Allen, http://smartmontools.sourceforge.net (Right, it is complety empty) smartctl on P410 connected hdd: # ./smartctl -A -d cciss,0 /dev/cciss/c0d0 smartctl 5.39.1 2010-01-28 r3054 [x86_64-unknown-linux-gnu] (local build) Copyright (C) 2002-10 by Bruce Allen, http://smartmontools.sourceforge.net Current Drive Temperature: 27 C Drive Trip Temperature: 68 C Vendor (Seagate) cache information Blocks sent to initiator = 1871654030 Blocks received from initiator = 1360012929 Blocks read from cache and sent to initiator = 2178203797 Number of read and write commands whose size <= segment size = 46052239 Number of read and write commands whose size > segment size = 0 Vendor (Seagate/Hitachi) factory information number of hours powered up = 3363.25 number of minutes until next internal SMART test = 12 Do I hunt here a bug, or is this a limitation of the p410 SMART cmd Passthru?

  Read the article

• How can a Linux Administrator improve their shell scripting and automation skills?

  - by ewwhite

  In my organization, I work with a group of NOC staff, budding junior engineers and a handful of senior engineers; all with a focus on Linux. One interesting step in the way the company grows talent is that there's a path from the NOC to the senior engineering ranks. Viewing the talent pool as a relative newcomer, I see that there's a split in the skill sets that tends to grow over time... There are engineers who know one or several particular technologies well and are constantly immersed... e.g. MySQL, firewalls, SAN storage, load balancers... There are others who are generalists and can navigate multiple technologies. All learn enough Linux (commands, processes) to do what they need and use on a daily basis. A differentiating factor between some of the staff is how well they embrace scripting, automation and configuration management methodologies. For instance, we have two engineers who do the bulk of Amazon AWS CloudFormation work, and another who handles most of the Puppet infrastructure. Perhaps a quarter of the engineers are adept at BASH shell scripting. Looking at this in the context of the incredibly high demand for DevOps skills in the job market, I'm curious how other organizations foster the development of these skills and grow their internal talent. Scripting doesn't seem like a particularly-teachable concept. How does a sysadmin improve their shell scripting? Is there still a place for engineers who do not/cannot keep up in the DevOps paradigm? Are we simply to assume that some people will be left behind as these technologies evolve? Is that okay?

  Read the article

• nf_conntrack complaints in dmesg

  - by Alexander Gladysh

  While investigating complains on bad HTTP server performance, I've discovered these lines in dmesg of my Xen XCP host that contains a guest OS with said server: [11458852.811070] net_ratelimit: 321 callbacks suppressed [11458852.811075] nf_conntrack: table full, dropping packet. [11458852.819957] nf_conntrack: table full, dropping packet. [11458852.821083] nf_conntrack: table full, dropping packet. [11458852.822195] nf_conntrack: table full, dropping packet. [11458852.824987] nf_conntrack: table full, dropping packet. [11458852.825298] nf_conntrack: table full, dropping packet. [11458852.825891] nf_conntrack: table full, dropping packet. [11458852.826225] nf_conntrack: table full, dropping packet. [11458852.826234] nf_conntrack: table full, dropping packet. [11458852.826814] nf_conntrack: table full, dropping packet. Complains are repeated every five seconds (number of suppressed callbacks is different each time). What can these sympthoms mean? Is that bad? Any hints? (Note that the question is more narrow than "how to solve specific case of bad HTTP server performance", so I do not give more details on that.) Additional info: $ uname -a Linux MYHOST 3.2.0-24-generic #37-Ubuntu SMP Wed Apr 25 08:43:22 UTC 2012 x86_64 x86_64 x86_64 GNU/Linux $ lsb_release -a No LSB modules are available. Distributor ID: Ubuntu Description: Ubuntu 12.04 LTS Release: 12.04 Codename: precise $ cat /proc/sys/net/netfilter/nf_conntrack_max 1548576 The server is under about 10M hits / day load.

  Read the article

• Apche ssl is not working

  - by user1703321

  I have configure virtual host on 80 and 443 port(Centos 5.6 and apache 2.2.3), following is the sample, i have wrote the configuration in same order Listen 80 Listen 443 NameVirtualHost *:80 NameVirtualHost *:443 <VirtualHost *:80> ServerAdmin [email protected] ServerName www.abc.be ServerAlias abc.be . . </VirtualHost> <VirtualHost *:80> ServerAdmin [email protected] ServerName www.abc.fr ServerAlias abc.fr . . </VirtualHost> then i have define 443 <VirtualHost *:443> ServerAdmin [email protected] ServerName www.abc.be ServerAlias abc.be . . SSLEngine on SSLCertificateFile /etc/ssl/private/abc.be.crt SSLCertificateKeyFile /etc/ssl/private/abc.be.key SSLCertificateChainFile /etc/ssl/private/gd_bundle_be.crt </VirtualHost> <VirtualHost *:443> ServerAdmin [email protected] ServerName www.abc.fr ServerAlias abc.fr . . SSLEngine on SSLCertificateFile /etc/ssl/private/abc.fr.crt SSLCertificateKeyFile /etc/ssl/private/abc.fr.key SSLCertificateChainFile /etc/ssl/private/gd_bundle_fr.crt </VirtualHost> First ssl certificate for abc.be is working fine, but 2nd domian abc.fr still load first ssl. following the output of apachictl -s VirtualHost configuration: wildcard NameVirtualHosts and _default_ servers: *:443 is a NameVirtualHost default server www.abc.be (/etc/httpd/conf/httpd.conf:1071) port 443 namevhost www.abc.fr (/etc/httpd/conf/httpd.conf:1071) Thanks

  Read the article

• saslauthd using too much memory

  - by Brian Armstrong

  Woke up today to see my site slow/unresponsive. Pulled up top and it looks like a ton of saslauthd processes have spun up using about 64m of RAM each, causing the machine to enter swap space. I've never seen this many used on there. top - 16:54:13 up 85 days, 11:48, 1 user, load average: 0.32, 0.50, 0.38 Tasks: 143 total, 1 running, 142 sleeping, 0 stopped, 0 zombie Cpu(s): 0.7%us, 0.3%sy, 0.0%ni, 97.3%id, 0.2%wa, 0.0%hi, 0.0%si, 1.4%st Mem: 1048796k total, 1025904k used, 22892k free, 14032k buffers Swap: 2097144k total, 332460k used, 1764684k free, 194348k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 848 admin 20 0 263m 115m 4840 S 0 11.3 5:02.91 ruby 906 admin 20 0 265m 113m 4828 S 0 11.1 5:37.24 ruby 30484 admin 20 0 248m 91m 4256 S 6 9.0 219:02.30 delayed_job 4075 root 20 0 160m 65m 952 S 0 6.4 0:24.22 saslauthd 4080 root 20 0 162m 64m 936 S 0 6.3 0:24.48 saslauthd 4079 root 20 0 162m 64m 936 S 0 6.3 0:24.70 saslauthd 4078 root 20 0 164m 63m 936 S 0 6.2 0:24.66 saslauthd 4077 root 20 0 163m 62m 936 S 0 6.1 0:24.66 saslauthd 3718 mysql 20 0 312m 52m 3588 S 1 5.1 3499:40 mysqld 699 root 20 0 72744 7640 2164 S 0 0.7 0:00.50 ruby 15701 postfix 20 0 106m 5712 4164 S 1 0.5 0:00.50 smtpd 15702 postfix 20 0 52444 3252 2452 S 1 0.3 0:00.06 cleanup 4062 postfix 20 0 41884 3104 1788 S 0 0.3 125:26.01 qmgr 15683 root 20 0 51504 2780 2180 S 0 0.3 0:00.04 sshd 14595 postfix 20 0 52308 2548 2304 S 1 0.2 0:24.60 proxymap 15483 postfix 20 0 43380 2544 1992 S 0 0.2 0:00.38 smtp 15486 postfix 20 0 43380 2544 1992 S 0 0.2 0:00.36 smtp 15488 postfix 20 0 43380 2540 1992 S 0 0.2 0:00.38 smtp 15485 postfix 20 0 43380 2532 1984 S 0 0.2 0:00.36 smtp 15489 postfix 20 0 43380 2532 1984 S 0 0.2 0:00.40 smtp Wasn't sure what Saslauthd is, Google says it handles plantext authentication. The machine has been sending a lot of email through postfix, so this could be related. Anyone know why so many may have spun up? Are they safe to kill? Thanks!

  Read the article

< Previous Page | 907 908 909 910 911 912 913 914 915 916 917 918  | Next Page >