Search Results

Search found 35400 results on 1416 pages for 'string interpolation'.

Page 922/1416 | < Previous Page | 918 919 920 921 922 923 924 925 926 927 928 929  | Next Page >

  • Is there a Better Way to Retreive Raw XML from a URL than WebClient or HttpWebRequest? [.NET]

    - by DaMartyr
    I am working on a Geocoding app where I put the address in the URL and retreive the XML. I need the complete XML response for this project. Is there any other class for downloading the XML from a website that may be faster than using WebClient or HttpWebRequest? Can the XMLReader be used to get the full XML without string manipulation and would that be faster and/or more efficient?

    Read the article

  • Create a dynamic control and AddHandle WITH Values/Brackets

    - by Jacob Kofoed
    Hi, it seems that adding for example a button Dim myButton as New Button and then addHandler to mySub("lol", 255) is not possible. Where mySub is Shared Sub MySub(byRef myString as string, myInteger as Integer) So: addHandler myButton.click, addressOf mySub("lol", 255) - returns an error saying it does not work with parentheses or whatever. I somehow see why this might not be possible, so I'm looking for a work-around on this problem. Please help _jakeCake

    Read the article

  • jQuery question

    - by Fuxi
    hi all, i'm having the following string <img alt="over 40 world famous brandedWATCHES BRANDs to choose from " src="http://www.fastblings.com/images/logo.jpg"></strong></a><br> i want to define a regex pattern like <img alt="(.+?)" src="http://(.+?).(jpg|gif)"> but as u can see the target strings has a linebreak in the alt attribute - so how can i incorporate this? the rule should be like "anything in the alt-attribute including linebreaks" thx

    Read the article

  • excluding posts in Wordpress

    - by Ayrton
    I wondered how I could exclude posts in Wordpress. E.g. I have a string $exclude_ids (= "4,5,6") or (="-4,-5,-6") and I would like to prevent these posts from showing up. How would I do that? I already tried: query_posts('p=' . $exclude_ids); but that didn't really work out and I didn't really find any information regarding this topic on google. Cheers

    Read the article

  • Contravariant Delegates Value Types

    - by ChloeRadshaw
    Can anyone shed light on why contravariance does not work with C# value types? The below does not work private delegate Asset AssetDelegate(int m); internal string DoMe() { AssetDelegate aw = new AssetDelegate(DelegateMethod); aw(32); return "Class1"; } private static House DelegateMethod(object m) { return null; }

    Read the article

  • What is the wrong of this converted code?

    - by Gum Slashy
    I'm developing shape identification project using javacv and I have found some opencv code to identify U shapes in particular image and I have try to convert it in to javacv but it doesn't provide same out put. Can you please help me to convert this opencv code into javacv? This is Opencv code import cv2 import numpy as np img = cv2.imread('sofud.jpg') gray = cv2.cvtColor(img,cv2.COLOR_BGR2GRAY) ret,thresh = cv2.threshold(gray,127,255,1) contours,hierarchy = cv2.findContours(thresh,cv2.RETR_LIST,cv2.CHAIN_APPROX_SIMPLE) for cnt in contours: x,y,w,h = cv2.boundingRect(cnt) if 10 < w/float(h) or w/float(h) < 0.1: cv2.rectangle(img,(x,y),(x+w,y+h),(0,0,255),2) cv2.imshow('res',img) cv2.waitKey(0) cv2.destroyAllWindows() This is the expected output This is the code that I have converted import com.googlecode.javacpp.Loader; import com.googlecode.javacv.CanvasFrame; import static com.googlecode.javacpp.Loader.*; import static com.googlecode.javacv.cpp.opencv_core.*; import static com.googlecode.javacv.cpp.opencv_imgproc.*; import static com.googlecode.javacv.cpp.opencv_highgui.*; import java.io.File; import javax.swing.JFileChooser; public class TestBeam { public static void main(String[] args) { CvMemStorage storage=CvMemStorage.create(); CvSeq squares = new CvContour(); squares = cvCreateSeq(0, sizeof(CvContour.class), sizeof(CvSeq.class), storage); JFileChooser f=new JFileChooser(); int result=f.showOpenDialog(f);//show dialog box to choose files File myfile=null; String path=""; if(result==0){ myfile=f.getSelectedFile();//selected file taken to myfile path=myfile.getAbsolutePath();//get the path of the file } IplImage src = cvLoadImage(path);//hear path is actual path to image IplImage grayImage = IplImage.create(src.width(), src.height(), IPL_DEPTH_8U, 1); cvCvtColor(src, grayImage, CV_RGB2GRAY); cvThreshold(grayImage, grayImage, 127, 255, CV_THRESH_BINARY); CvSeq cvSeq=new CvSeq(); CvMemStorage memory=CvMemStorage.create(); cvFindContours(grayImage, memory, cvSeq, Loader.sizeof(CvContour.class), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); System.out.println(cvSeq.total()); for (int i = 0; i < cvSeq.total(); i++) { CvRect rect=cvBoundingRect(cvSeq, i); int x=rect.x(),y=rect.y(),h=rect.height(),w=rect.width(); if (10 < (w/h) || (w/h) < 0.1){ cvRectangle(src, cvPoint(x, y), cvPoint(x+w, y+h), CvScalar.RED, 1, CV_AA, 0); //cvSeqPush(squares, rect); } } CanvasFrame cnvs=new CanvasFrame("Beam"); cnvs.setDefaultCloseOperation(javax.swing.JFrame.EXIT_ON_CLOSE); cnvs.showImage(src); //cvShowImage("Final ", src); } } This is the out put that I got please can some one help me to solve this problem ?

    Read the article

  • PHP - preg_replace with multiple matches

    - by Neil
    Let's say I have a string like: $text = "<object>item_id1a2b3</object>xxx<object>item_id4c5d6</object>" I want to convert it to: %ITEM:1a2b3xxx%ITEM:4c5d6 Here's what I've got: $text = preg_replace("/<object.*item_id([a-zA-Z0-9]+).*<\/object/","%ITEM:$1",$text); This isn't quite right, as the search is greedy. Thoughts? Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Abstract attributes in Python

    - by deamon
    What is the shortest / most elegant way to implement the following Scala code with an abstract attribute in Python? abstract class Controller { val path: String } A subclass of Controller is enforced to define "path" by the Scala compiler. A subclass would look like this: class MyController extends Controller { override val path = "/home" }

    Read the article

  • Bizarre Escape Character Question

    - by William Calleja
    I have the following c# code embedded in a literal <% %> of a c# asp.net page string commandString = "SELECT tblData.Content " + "FROM tblData " + "WHERE (tblData.ref = N\'%"+myCurrentREF+"%\')"; This is breaking my code since it apparently cannot use the \' escape character. Why is it so? other escape characters like \" are working so why isn't \' working?

    Read the article

  • Import? Initialize? what do to?

    - by Jeremy B
    I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

    Read the article

  • Convert month number to month short name

    - by Roland
    I have a variable with the following value $month = 201002; the first 4 numbers represent the year, and the last 2 numbers represent the month. I need to get the last 2 numbers in the month string name eg. Feb My code looks like this <?php echo date('M',substr($month,4,6)); ?> I can I go about to obtain the month name

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • Is it possible to use multiple languages in .NET resource files?

    - by Gabe Brown
    We’ve got an interesting requirement that we’ll want to support multiple languages at runtime since we’re a service. If a user talks to us using Japanese or English, we’ll want to respond in the appropriate language. FxCop likes us to store our strings in resource files, but I was curious to know if there was an integrated way to select resource string at runtime without having to do it manually. Bottom Line: We need to be able to support multiple languages in a single binary. :)

    Read the article

  • How to save byte[] to varbinary(64) field in database

    - by shamim
    I have byte[] a = HashEncrypt("a"); with public byte[] HashEncrypt(string password) { SHA512Managed sha = new SHA512Managed(); byte[] hash = sha.ComputeHash(UnicodeEncoding.Unicode.GetBytes(password)); return hash; } I want to save byte[] a to my database. My database field is a varbinary(64). I'm using SQL Server 2008. I want to know the insert query with C# code. I am using ADO.NET

    Read the article

  • Escape hyperlink with exclamation marks in php.ini

    - by Ciaran McNulty
    I have a config file that takes text warnings like follows: warnings.1 = Please check the date These are presented to the user as HTML. I need to embed a hyperlink like the following: warnings.1 = <a href="http://foo.com/!FOO!/">check with foo</a> I can't for the life of me figure out how to escape this such that parse_ini_file() can read it and get that string the way I want.

    Read the article

  • WPF ClickOnce Bootstrap Dection Failure on One Machine

    - by Dexter Morgan
    Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

    Read the article

  • Lua template processor question

    - by PeterMmm
    I'm going to use that template engine LTP . There is not so much doc available. Now i'm stuck how to pass an environment into the render engine. I have basically this: local ltp = require("ltp.template") ltp.render(io.stdout, 1, "index.dhtm", false, {}, "<?lua", "?>", { total="2400" }) What data structure should be the last parameter (env_code), a string, a table with key=val ?

    Read the article

< Previous Page | 918 919 920 921 922 923 924 925 926 927 928 929  | Next Page >