Search Results

Search found 35400 results on 1416 pages for 'string interpolation'.

Page 922/1416 | < Previous Page | 918 919 920 921 922 923 924 925 926 927 928 929  | Next Page >

  • sql query not executing

    - by sarah
    Hi, Not able to execute a query ,i need to check if end date is greater than today in the following query Getting an error invalid query select * from table1 where user in ('a') and END_DATE >'2010-05-22' getting an error liter string does not match

    Read the article

  • PHP - preg_replace with multiple matches

    - by Neil
    Let's say I have a string like: $text = "<object>item_id1a2b3</object>xxx<object>item_id4c5d6</object>" I want to convert it to: %ITEM:1a2b3xxx%ITEM:4c5d6 Here's what I've got: $text = preg_replace("/<object.*item_id([a-zA-Z0-9]+).*<\/object/","%ITEM:$1",$text); This isn't quite right, as the search is greedy. Thoughts? Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • excluding posts in Wordpress

    - by Ayrton
    I wondered how I could exclude posts in Wordpress. E.g. I have a string $exclude_ids (= "4,5,6") or (="-4,-5,-6") and I would like to prevent these posts from showing up. How would I do that? I already tried: query_posts('p=' . $exclude_ids); but that didn't really work out and I didn't really find any information regarding this topic on google. Cheers

    Read the article

  • Hiding a LinkButton in DataList

    - by sanfra1983
    Hi someone can tell me how to hide a LinkButton inside a DataList? I've tried to do this but I do not work: protected void Page_PreRender(object sender, EventArgs e) { foreach (var item in listanews) { DataList container = dlgestionenews; if (string.IsNullOrEmpty(item.IdNews)) { DataListItem itemdatalist = null; foreach (DataListItem itemdl in container.Items) { foreach (Control control in itemdatalist.Controls) { if (control.GetType().FullName == "LinkButton") { ((LinkButton)control).Visible = false; } } } } } } Thanks!

    Read the article

  • Convert month number to month short name

    - by Roland
    I have a variable with the following value $month = 201002; the first 4 numbers represent the year, and the last 2 numbers represent the month. I need to get the last 2 numbers in the month string name eg. Feb My code looks like this <?php echo date('M',substr($month,4,6)); ?> I can I go about to obtain the month name

    Read the article

  • Server.Execute - render .ASP from MVC controller action

    - by David Lively
    I need to render an ASP page to a string from an MVC controller action. I can use Server.Execute() to render a .aspx page, but not a .asp page. Here's what I'm using: public ActionResult Index() { Server.Execute("/default.asp"); return new EmptyResult(); } which returns `No http handler was found for request type 'GET'` Any suggestions? I can do something similar with with a web request, but I'd rather avoid the overhead of a loopback request.

    Read the article

  • Contravariant Delegates Value Types

    - by ChloeRadshaw
    Can anyone shed light on why contravariance does not work with C# value types? The below does not work private delegate Asset AssetDelegate(int m); internal string DoMe() { AssetDelegate aw = new AssetDelegate(DelegateMethod); aw(32); return "Class1"; } private static House DelegateMethod(object m) { return null; }

    Read the article

  • What is the wrong of this converted code?

    - by Gum Slashy
    I'm developing shape identification project using javacv and I have found some opencv code to identify U shapes in particular image and I have try to convert it in to javacv but it doesn't provide same out put. Can you please help me to convert this opencv code into javacv? This is Opencv code import cv2 import numpy as np img = cv2.imread('sofud.jpg') gray = cv2.cvtColor(img,cv2.COLOR_BGR2GRAY) ret,thresh = cv2.threshold(gray,127,255,1) contours,hierarchy = cv2.findContours(thresh,cv2.RETR_LIST,cv2.CHAIN_APPROX_SIMPLE) for cnt in contours: x,y,w,h = cv2.boundingRect(cnt) if 10 < w/float(h) or w/float(h) < 0.1: cv2.rectangle(img,(x,y),(x+w,y+h),(0,0,255),2) cv2.imshow('res',img) cv2.waitKey(0) cv2.destroyAllWindows() This is the expected output This is the code that I have converted import com.googlecode.javacpp.Loader; import com.googlecode.javacv.CanvasFrame; import static com.googlecode.javacpp.Loader.*; import static com.googlecode.javacv.cpp.opencv_core.*; import static com.googlecode.javacv.cpp.opencv_imgproc.*; import static com.googlecode.javacv.cpp.opencv_highgui.*; import java.io.File; import javax.swing.JFileChooser; public class TestBeam { public static void main(String[] args) { CvMemStorage storage=CvMemStorage.create(); CvSeq squares = new CvContour(); squares = cvCreateSeq(0, sizeof(CvContour.class), sizeof(CvSeq.class), storage); JFileChooser f=new JFileChooser(); int result=f.showOpenDialog(f);//show dialog box to choose files File myfile=null; String path=""; if(result==0){ myfile=f.getSelectedFile();//selected file taken to myfile path=myfile.getAbsolutePath();//get the path of the file } IplImage src = cvLoadImage(path);//hear path is actual path to image IplImage grayImage = IplImage.create(src.width(), src.height(), IPL_DEPTH_8U, 1); cvCvtColor(src, grayImage, CV_RGB2GRAY); cvThreshold(grayImage, grayImage, 127, 255, CV_THRESH_BINARY); CvSeq cvSeq=new CvSeq(); CvMemStorage memory=CvMemStorage.create(); cvFindContours(grayImage, memory, cvSeq, Loader.sizeof(CvContour.class), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); System.out.println(cvSeq.total()); for (int i = 0; i < cvSeq.total(); i++) { CvRect rect=cvBoundingRect(cvSeq, i); int x=rect.x(),y=rect.y(),h=rect.height(),w=rect.width(); if (10 < (w/h) || (w/h) < 0.1){ cvRectangle(src, cvPoint(x, y), cvPoint(x+w, y+h), CvScalar.RED, 1, CV_AA, 0); //cvSeqPush(squares, rect); } } CanvasFrame cnvs=new CanvasFrame("Beam"); cnvs.setDefaultCloseOperation(javax.swing.JFrame.EXIT_ON_CLOSE); cnvs.showImage(src); //cvShowImage("Final ", src); } } This is the out put that I got please can some one help me to solve this problem ?

    Read the article

  • Regex, replace path to resource, modify resource name

    - by jerome
    Hi all, I'd like to use a JS regex to take a string such as the following: 'http://www.somedomain.com/some_directory/some_other_directory/some_image.jpg' And turn it into this: 'http://www.some_other_domain.com/another_directory/yet_another_directory/size1_some_image.jpg' Any hints? Additionally, any pointers for books or other resources that give a gentle introduction to mastering regexes in JS and other languages?

    Read the article

  • Is it possible to use multiple languages in .NET resource files?

    - by Gabe Brown
    We’ve got an interesting requirement that we’ll want to support multiple languages at runtime since we’re a service. If a user talks to us using Japanese or English, we’ll want to respond in the appropriate language. FxCop likes us to store our strings in resource files, but I was curious to know if there was an integrated way to select resource string at runtime without having to do it manually. Bottom Line: We need to be able to support multiple languages in a single binary. :)

    Read the article

  • Different ways of accessing configuration parameters from a JAX-WS service

    - by ecerulm
    As far as I know I can access the web.xml <context-param>s by making my class implement ServletContextListener and use the ServletContext.getInitParam(String) to read them, but it´s cumbersome as only one instance of the class will receive the contextInitialized(ServletContextEvent sce) call, so I need to make the ServletContext an static member of the class. What other ways exist of setting conf params at deployment time and what are the recommended ones?

    Read the article

  • Checking if a record in datareader is NULL

    - by user279521
    I have browsed thru other postings on S/O, but I can't find a solution that works for me. I have a datareader that might return a null value, and if so, I want to value to equal blank txtMiddleName.Text = rdrGetUserInfo.GetString(1) ?? ""; The string above does not work. When I walk thru the code, the code jumps to my error trapping block; Any ideas?

    Read the article

  • How to save byte[] to varbinary(64) field in database

    - by shamim
    I have byte[] a = HashEncrypt("a"); with public byte[] HashEncrypt(string password) { SHA512Managed sha = new SHA512Managed(); byte[] hash = sha.ComputeHash(UnicodeEncoding.Unicode.GetBytes(password)); return hash; } I want to save byte[] a to my database. My database field is a varbinary(64). I'm using SQL Server 2008. I want to know the insert query with C# code. I am using ADO.NET

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • capturing user IP address information for audit

    - by Samuel
    We have a requirement to log IP address information of all users who use a certain web application based on JEE 5. What would be an appropriate sql data type for storing IPv4 or IPv6 addressses in the following supported databases (h2, mysql, oracle). There is also a need to filter activity from certain IP addresses. Should I just treat the representation as a string field (say varchar(32) to hold ipv4, ipv6 addresses)

    Read the article

  • Java NoSuchElementException using scanner.nextInt()

    - by othnin
    I am trying to read in a pgm file (512x512 array) and when I read in a larger file I get the error: java.util.NoSuchElementException on reading element (3,97). I have created a much smaller file to read (23x23) and it reads fine. Is there a size limit? I have checked the file and confirmed that there is an int for the value: This appears to be the line it crashes at: fileArray[row][col] = scan.nextInt(); Here is the file: import java.util.Scanner; import java.io.*; public class FileReader { public static void main(String[] args) throws IOException { String fileName = "lena.pgma"; int width, height, maxValue; FileInputStream fileInputStream = null; fileInputStream = new FileInputStream(fileName); Scanner scan = new Scanner(fileInputStream); // Discard the magic number scan.nextLine(); // Discard the comment line scan.nextLine(); // Read pic width, height and max value width = scan.nextInt(); System.out.println("Width: " + width); height = scan.nextInt(); System.out.println("Heigth: " + height); maxValue = scan.nextInt(); fileInputStream.close(); // Now parse the file as binary data FileInputStream fin = new FileInputStream(fileName); DataInputStream dis = new DataInputStream(fin); // look for 4 lines (i.e.: the header) and discard them int numnewlines = 4; while (numnewlines > 0) { char c; do { c = (char)(dis.readUnsignedByte()); } while (c != '\n'); numnewlines--; } // read the image data int[][] fileArray = new int[height][width]; for (int row = 0; row < height; row++) { for (int col = 0; col < width; col++) { fileArray[row][col] = scan.nextInt(); System.out.print("(" + row + " ," + col +"): " + fileArray[row][col]+ " "); } System.out.println(); } dis.close(); } } any advise would be appreciated.

    Read the article

  • Hibernate naturalID

    - by DD
    Hibernate doesnt seem to generate a notnull constraint on a field I marked as naturalID. Is this normal? @MappedSuperclass public class AbstractDomainObject extends PersistentObject { @NaturalId private String code; DB Schema: CONSTRAINT SYS_CT_47 UNIQUE(CODE) There is no not null constraint here.

    Read the article

< Previous Page | 918 919 920 921 922 923 924 925 926 927 928 929  | Next Page >