Search Results

Search found 35400 results on 1416 pages for 'string interpolation'.

Page 918/1416 | < Previous Page | 914 915 916 917 918 919 920 921 922 923 924 925  | Next Page >

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • How do I get the Jetty 6 FileServerXml example to work?

    - by Norm
    I have followed along with the Tutorial and the examples. Yet I always get this error when I copy and paste the code: Exception in thread "main" java.lang.NullPointerException at net.test.FileServerXml.main(FileServerXml.java:13) In Eclipse I have the directory structured as such: package net.test -FileServerXml.java -fileserver.xml -index.html FileServerXml.java package net.test; import org.mortbay.jetty.Server; import org.mortbay.resource.Resource; import org.mortbay.xml.XmlConfiguration; public class FileServerXml { public static void main(String[] args) throws Exception { Resource fileserver_xml = Resource.newSystemResource("fileserver.xml"); XmlConfiguration configuration = new XmlConfiguration(fileserver_xml.getInputStream()); Server server = (Server)configuration.configure(); server.start(); server.join(); } } ` fileserver.xml `<?xml version="1.0"?> <Call name="addConnector"> <Arg> <New class="org.eclipse.jetty.server.nio.SelectChannelConnector"> <Set name="port">8080</Set> </New> </Arg> </Call> <Set name="handler"> <New class="org.eclipse.jetty.server.handler.HandlerList"> <Set name="handlers"> <Array type="org.eclipse.jetty.server.Handler"> <Item> <New class="org.eclipse.jetty.server.handler.ResourceHandler"> <Set name="directoriesListed">true</Set> <Set name="welcomeFiles"> <Array type="String"><Item>index.html</Item></Array> </Set> <Set name="resourceBase">.</Set> </New> </Item> <Item> <New class="org.eclipse.jetty.server.handler.DefaultHandler"> </New> </Item> </Array> </Set> </New> </Set> ` Thanks for your input. Norm

    Read the article

  • How to compute palindrome from a stream of characters in sub-linear space/time?

    - by wrick
    I don't even know if a solution exists or not. Here is the problem in detail. You are a program that is accepting an infinitely long stream of characters (for simplicity you can assume characters are either 1 or 0). At any point, I can stop the stream (let's say after N characters were passed through) and ask you if the string received so far is a palindrome or not. How can you do this using less sub-linear space and/or time.

    Read the article

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • What is the equivalent of REGEXP_SUBSTR in mysql?

    - by KandadaBoggu
    I want to extract a word from a string column of a table. description =========================== abc order_id: 2 xxxx yyy aa mmm order_id: 3 nn kk yw Expected result set order_id =========================== 2 3 Table will at most have 100 rows, text length is ~256 char and column always has one order_id present. So performance is not an issue. In Oracle, I can use REGEXP_SUBSTR for this problem. How would I solve this in MySQL?

    Read the article

  • Typecast cross-platform compatibility

    - by kaykun
    Hi, what I'm trying to do is append a binary integer into a string object. So far I have this: int number = 5; cppstring.append((char*)&number, 4); It works fine on a x86 system with Windows, but some people are saying its not cross-platform and is unsafe. What is the preferred method to do this?

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • How to call a script that expects $_POST from inside a function

    - by donpal
    My script.php accepts $_POST input and echos a string. $theinput = $_POST['theinput']; $output = //some processing; echo $output; I would like to use this script inside a function where the same input is now a $_POST function processinput($someinput){ //I need to call the above script and give it //the same input `$someinput` which is not a `$_POST` anymore } Any ideas how to do that?

    Read the article

  • What url encoding web browser uses?

    - by Prince123
    What url encoding a web browser uses while submitting data to server? with my application i use HttpUtility.UrlEncode(string data) but do not get result as i get with web browser. My application submit some text data to forum. When i am submitting data with web browser (Google Chrome) the exact text i can see submitted to server but when i am submitting using my application it showing some character different. So is this necessary to submit any data to server must be url encoded?

    Read the article

  • Java accessing variables using extends

    - by delo
    So here I have two classes: Customer Order Class and Confirmation Class. I want to access the data stored in LastNameTextField (Customer Order Class) and set it as the text for UserLastNameLabel (Confirmation Class) after clicking a "Submit" button. For some reason however, the output displays nothing. Snippet of my code: package customer_order; public class customer_order extends Frame{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; private JLabel LastNameLabel = null; protected JTextField LastNameTextField = null; private JButton SubmitButton = null; public String s; public customer_order() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Customer Order"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes LastNameTextField * * @return javax.swing.JTextField */ public JTextField getLastNameTextField() { if (LastNameTextField == null) { LastNameTextField = new JTextField(); LastNameTextField.setBounds(new Rectangle(120, 100, 164, 28)); LastNameTextField.setName("LastNameTextField"); } return LastNameTextField; } /** * This method initializes SubmitButton * * @return javax.swing.JButton */ private JButton getSubmitButton() { if (SubmitButton == null) { SubmitButton = new JButton(); SubmitButton.setBounds(new Rectangle(501, 225, 96, 29)); SubmitButton.setName("SubmitButton"); SubmitButton.setText("Submit"); SubmitButton.addActionListener(new java.awt.event.ActionListener() { public void actionPerformed(java.awt.event.ActionEvent e) { System.out.println("actionPerformed()"); // TODO Auto-generated Event stub actionPerformed() //THE STRING I WANT s = LastNameTextField.getText(); java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new confirmation().setVisible(true); } }); } }); } return SubmitButton; } package customer_order; public class confirmation extends customer_order{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; // @jve:decl-index=0:visual-constraint="58,9" private JLabel LastNameLabel = null; private JLabel UserLastNameLabel = null; // @jve:decl-index=0: /** * This method initializes frame * * @return java.awt.Frame */ public confirmation() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Confirmation"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes jPanel * * @return javax.swing.JPanel */ private JPanel getJPanel() { if (jPanel == null) { UserLastNameLabel = new JLabel(); UserLastNameLabel.setBounds(new Rectangle(121, 60, 167, 26)); //THE PROBLEM? UserLastNameLabel.setText(s); } return jPanel; }

    Read the article

  • Testing custom constraints in Grails App

    - by WaZ
    Hi there, I have the following as my unit test: void testCreateDealer() { mockForConstraintsTests(Dealer) def _dealer= new Dealer( dealerName:"ABC", Email:"[email protected]", HeadOffice:"", isBranch:false) assertFalse _dealer.validate() } But when I run the test I get the following error: No signature of method: static com.myCompany.Dealer.findByDealerNameIlike() is applicable for argument types: (java.lang.String) values: [ABC] I use some custom constraints in my domain class. How Can I test this? static constraints = { dealerName(blank:false, validator: { val, obj -> def similarDealer = Dealer.findByDealerNameIlike(val) return !similarDealer || (obj.id == similarDealer.id) } )

    Read the article

  • SimpleDateFormat

    - by manu
    Hi, The following code is giving me the parsed date as "Wed Jan 13 00:00:00 EST 2010" instead of "Wed Jun 13 00:00:00 EST 2010". Any ideas much appreciated. SimpleDateFormat sf = new SimpleDateFormat("yyyy-mm-dd'T'HH:mm:ss"); String str = "2010-06-13T00:00:00"; Date date = sf.parse(str); System.out.println(" Date " + date.toString());

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Inject filter into Zend_View

    - by chelmertz
    Hi! I wish to set some properties in MyFilter with constructor injection but it seems impossible with Zend_View::addFilter(string $filter_class_name) since it loads a new instance upon usage. MyFilter implements Zend_Filter_Interface. Can I somehow inject an instance of a filter to an instance of Zend_View?

    Read the article

  • Best way to return result from business layer to presentation layer when using LINQ-to-SQL

    - by samsur
    I have a business layer that has DTOs that are used in the presentation layer. This application uses entity framework. Here is an example of a class called RoleDTO: public class RoleDTO { public Guid RoleId { get; set; } public string RoleName { get; set; } public string RoleDescription { get; set; } public int? OrganizationId { get; set; } } In the BLL I want to have a method that returns a list of DTO. I would like to know which is the better approach: returning IQueryable or list of DTOs. Although I feel that returning IQueryable is not a good idea because the connection needs to be open. Here are the 2 different methods using the different approaches: First approach public class RoleBLL { private servicedeskEntities sde; public RoleBLL() { sde = new servicedeskEntities(); } public IQueryable<RoleDTO> GetAllRoles() { IQueryable<RoleDTO> role = from r in sde.Roles select new RoleDTO() { RoleId = r.RoleID, RoleName = r.RoleName, RoleDescription = r.RoleDescription, OrganizationId = r.OrganizationId }; return role; } Note: in the above method the DataContext is a private attribute and set in the constructor, so that the connection stays opened. Second approach public static List<RoleDTO> GetAllRoles() { List<RoleDTO> roleDTO = new List<RoleDTO>(); using (servicedeskEntities sde = new servicedeskEntities()) { var roles = from pri in sde.Roles select new { pri.RoleID, pri.RoleName, pri.RoleDescription }; //Add the role entites to the DTO list and return. This is necessary as anonymous types can be returned acrosss methods foreach (var item in roles) { RoleDTO roleItem = new RoleDTO(); roleItem.RoleId = item.RoleID; roleItem.RoleDescription = item.RoleDescription; roleItem.RoleName = item.RoleName; roleDTO.Add(roleItem); } return roleDTO; } } Please let me know, if there is a better approach.

    Read the article

  • Different ways of accessing configuration parameters from a JAX-WS service

    - by ecerulm
    As far as I know I can access the web.xml <context-param>s by making my class implement ServletContextListener and use the ServletContext.getInitParam(String) to read them, but it´s cumbersome as only one instance of the class will receive the contextInitialized(ServletContextEvent sce) call, so I need to make the ServletContext an static member of the class. What other ways exist of setting conf params at deployment time and what are the recommended ones?

    Read the article

  • How to refresh a fragment in a viewpager?

    - by aut_silvia
    I know there are already some questions to this problem. But I am really new in Android and ecspecially to Fragments and Viewpager. Pls have passion with me. I didn't found a answer which fits to my code. I dont know how to refresh a fragment or reload it when it's "active" again. TabsPagerAdapter.java: public class TabsPagerAdapter extends FragmentPagerAdapter{ public TabsPagerAdapter(FragmentManager fm){ super(fm); } @Override public Fragment getItem(int index) { switch (index) { case 0: return new KFZFragment(); case 1: return new LogFragment(); case 2: return new TrackFragment(); } return null; } @Override public int getCount() { // get item count - equal to number of tabs return 3; } } I have this 3 Fragments (KFZFragment,LogFragment,TrackFragment) and on the TrackFragment I calculate some data and this data should be display in a ListView in LogFragment. But when I change to LogFragment it's not the latest data. So it doesnt refresh. Now how should I modify my code to refresh the fragments when it's "active"? MainActivityFragment.java: public class MainActivityFragment extends FragmentActivity implements ActionBar.TabListener{ private ViewPager viewPager; private TabsPagerAdapter mAdapter; private ActionBar actionBar; List<Fragment> fragments; private String[] tabs = { "KFZ", "Fahrten Log", "Kosten Track" }; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main_fragment); // Initilization viewPager = (ViewPager) findViewById(R.id.pager); actionBar = getActionBar(); mAdapter = new TabsPagerAdapter(getSupportFragmentManager()); fragments = new Vector<Fragment>(); fragments.add(Fragment.instantiate(this, KFZFragment.class.getName(),savedInstanceState)); fragments.add(Fragment.instantiate(this, LogFragment.class.getName(),savedInstanceState)); viewPager.setAdapter(mAdapter); actionBar.setHomeButtonEnabled(false); actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_TABS); // Adding Tabs for (String tab_name : tabs) { actionBar.addTab(actionBar.newTab().setText(tab_name) .setTabListener(this)); } viewPager.setOnPageChangeListener(new ViewPager.OnPageChangeListener() { @Override public void onPageSelected(int position) { // on changing the page // make respected tab selected actionBar.setSelectedNavigationItem(position); } @Override public void onPageScrolled(int arg0, float arg1, int arg2) { } @Override public void onPageScrollStateChanged(int arg0) { } }); } @Override public void onTabReselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public void onTabSelected(Tab tab, FragmentTransaction ft) { viewPager.setCurrentItem(tab.getPosition()); } @Override public void onTabUnselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { if (keyCode == KeyEvent.KEYCODE_BACK) { } return super.onKeyDown(keyCode, event); } } Pls help me out.

    Read the article

  • RadioButton checkedchanged event firing multiple times

    - by kash3
    Hi, I am trying to add multiple radiobutton columns to my gridview dynamically in the code and i want to implement some logic which involves database fetch in the checkedchanged event of radiobuttons but some how the checked changed event is being fired multiple times for each row. Following is the code: aspx: <asp:GridView ID="GridView1" runat="server" AutoGenerateColumns="False" BackColor="White" BorderColor="#CC9966" BorderStyle="None" EnableViewState="true" BorderWidth="1px" CellPadding="4" Font-Names="Verdana"> <FooterStyle BackColor="#FFFFCC" ForeColor="#330099" /> <Columns> <asp:TemplateField HeaderText="Select One"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField HeaderText="Select Two"> <ItemTemplate> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="lblval" runat="server" Text="!" ForeColor="Red" Visible="false"/> </ItemTemplate> </asp:TemplateField> </Columns> **code behind** void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { if (e.Row.DataItem != null) { DataRowView dvRowview = (DataRowView)e.Row.DataItem; int currentRow = GridView1.Rows.Count; RadioButton rdoSelect1 = new RadioButton(); rdoSelect1.GroupName = "Select" + currentRow; rdoSelect1.ID = string.Concat("rdoSelect1", currentRow); rdoSelect1.AutoPostBack = true; rdoSelect1.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[0].Controls.Add(rdoSelect1); RadioButton rdoSelect2 = new RadioButton(); rdoSelect2.GroupName = "Select" + currentRow; rdoSelect2.ID = string.Concat("rdoSelect2", currentRow); rdoSelect2.AutoPostBack = true; rdoSelect2.CheckedChanged += new EventHandler(rdoSelect_CheckedChanged); e.Row.Cells[1].Controls.Add(rdoSelect2); if (!IsPostBack) { e.Row.Cells[e.Row.Cells.Count - 1].Controls[1].Visible = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select1"]) == true) rdoSelect1.Checked = true; else rdoSelect1.Checked = false; if (e.Row.Cells[0] != null && Convert.ToBoolean(dvRowview["Select2"]) == true) rdoSelect2.Checked = true; else rdoSelect2.Checked = false; } } } void rdoSelect_CheckedChanged(object sender, EventArgs e) { RadioButton rdoSelectedOption = (RadioButton)sender; GridViewRow selRow = rdoSelectedOption.NamingContainer as GridViewRow; if (rdoSelectedOption.Checked) selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = true; else selRow.Cells[selRow.Cells.Count - 1].Controls[1].Visible = false; } i want the checkedchanged event to fire only once for a group name and row.

    Read the article

  • Sqlite issues with HTC Desire HD

    - by Greg
    Recently I have been getting a lot of complaints about the HTC Desire series and it failing while invoking sql statements. I have received reports from users with log snapshots that contain the following. I/Database( 2348): sqlite returned: error code = 8, msg = statement aborts at 1: [pragma journal_mode = WAL;] E/Database( 2348): sqlite3_exec to set journal_mode of /data/data/my.app.package/files/localized_db_en_uk-1.sqlite to WAL failed followed by my app basically burning in flames because the call to open the database results in a serious runtime error that manifests itself as the cursor being left open. There shouldn't be a cursor at this point as we are trying to open it. This only occurs with the HTC Desire HD and Z. My code basically does the following (changed a little to isolate the problem area). SQLiteDatabase db; String dbName; public SQLiteDatabase loadDb(Context context) throws IOException{ //Close any old db handle if (db != null && db.isOpen()) { db.close(); } // The name of the database to use from the bundled assets. String dbAsset = "/asset_dir/"+dbName+".sqlite"; InputStream myInput = context.getAssets().open(dbAsset, Context.MODE_PRIVATE); // Create a file in the app's file directory since sqlite requires a path // Not ideal but we will copy the file out of our bundled assets and open it // it in another location. FileOutputStream myOutput = context.openFileOutput(dbName, Context.MODE_PRIVATE); byte[] buffer = new byte[1024]; int length; while ((length = myInput.read(buffer)) > 0) { myOutput.write(buffer, 0, length); } // Close the streams myOutput.flush(); // Guarantee Write! myOutput.getFD().sync(); myOutput.close(); myInput.close(); // Not grab the newly written file File fileObj = context.getFileStreamPath(dbName); // and open the database return db = SQLiteDatabase.openDatabase(fileObj.getAbsolutePath(), null, SQLiteDatabase.OPEN_READONLY | SQLiteDatabase.NO_LOCALIZED_COLLATORS); } Sadly this phone is only available in the UK and I don't have one in my inventory. I am only getting reports of this type from the HTC Desire series. I don't know what changed as this code has been working without any problem. Is there something I am missing?

    Read the article

< Previous Page | 914 915 916 917 918 919 920 921 922 923 924 925  | Next Page >