Search Results

Search found 35400 results on 1416 pages for 'string interpolation'.

Page 918/1416 | < Previous Page | 914 915 916 917 918 919 920 921 922 923 924 925  | Next Page >

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • WPF ClickOnce Bootstrap Dection Failure on One Machine

    - by Dexter Morgan
    Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • HTML Encoding with ASP.NET

    - by Corin
    I am currently html encoding all user entered text before inserting/updating a db table record. The problem is that on any subsequent updates, the previously encoded string is reencoded. This endless loop is starting to eat up alot of column space in my tables. I am using parameterized queries for all sql statements but am wondering would it be safe to just let the .NET Framework handle this part without the HTML Encoding?

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • I need to speed this code at least 2 times!

    - by Dominating
    include include include include using namespace std; inline void PrintMapName(multimap pN, string s) { pair::iterator, multimap::iterator ii; multimap::iterator it; ii = pN.equal_range(s); multimap tmp; for(it = ii.first; it != ii.second; ++it) { tmp.insert(pair(it-second,1)); } multimap::iterator i; bool flag = false; for(i = tmp.begin(); i != tmp.end(); i++) { if(flag) { cout<<" "; } cout<first; if(flag) { cout<<" "; } flag = true; } cout< int main() { multimap phoneNums; multimap numPhones; int N; cinN; int tests; string tmp, tmp1,tmp2; while(N 0) { cintests; while(tests 0) { cintmp; if(tmp == "add") { cintmp1tmp2; phoneNums.insert(pair(tmp1,tmp2)); numPhones.insert(pair(tmp2,tmp1)); } else { if(tmp == "delnum") { cintmp1; multimap::iterator it; multimap::iterator tmpr; for(it = phoneNums.begin(); it != phoneNums.end();it++) { tmpr = it; if(it-second == tmp1) { phoneNums.erase(it,tmpr); } } numPhones.erase(tmp1); } else { if(tmp == "delname") { cintmp1; phoneNums.erase(tmp1); multimap::iterator it; multimap::iterator tmpr; for(it = numPhones.begin(); it != numPhones.end();it++) { tmpr = it; if(it-second == tmp1) { numPhones.erase(it,tmpr); } } } else { if(tmp =="queryname") { cintmp1; PrintMapName(phoneNums, tmp1); } else//querynum { cintmp1; PrintMapName(numPhones, tmp1); } } } } tests--; } N--; } return 0; }

    Read the article

  • What makes an input vulnerable to XSS?

    - by vtortola
    Hi! I've been reading about XSS and I made a simple form with a text and submit input, but when I execute <script>alert();</script> on it, nothing happens, the server gets that string and that's all. What do I have to do for make it vulnerable?? (then I'll learn what I shouldn't do hehe) Cheers.

    Read the article

  • PHP regular expression for positive number with 0 or 2 decimal places

    - by Peter
    Hi I am trying to use the following regular expression to check whether a string is a positive number with either zero decimal places, or 2: ^\d+(\.(\d{2}))?$ When I try to match this using preg_match, I get the error: Warning: preg_match(): No ending delimiter '^' found in /Library/WebServer/Documents/lib/forms.php on line 862 What am I doing wrong?

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • How to do a proper search with nhibernate

    - by Denis Rosca
    Hello everyone, i'm working on a small project that is supposed to allow basic searches of the database. Currently i'm using nhibernate for the database interaction. In the database i have 2 tables: Person and Address. The Person table has a many-to-one relationship with Address. The code i've come up with for doing searches is: public IList<T> GetByParameterList(List<QueryParameter> parameterList) { if (parameterList == null) { return GetAll(); } using (ISession session = NHibernateHelper.OpenSession()) { ICriteria criteria = session.CreateCriteria<T>(); foreach (QueryParameter param in parameterList) { switch (param.Constraint) { case ConstraintType.Less: criteria.Add(Expression.Lt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.More: criteria.Add(Expression.Gt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.LessOrEqual: criteria.Add(Expression.Le(param.ParameterName, param.ParameterValue)); break; case ConstraintType.EqualOrMore: criteria.Add(Expression.Ge(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Equals: criteria.Add(Expression.Eq(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Like: criteria.Add(Expression.Like(param.ParameterName, param.ParameterValue)); break; } } try { IList<T> result = criteria.List<T>(); return result; } catch { //TODO: Implement some exception handling throw; } } } The query parameter is a helper object that i use to create criterias and send it to the dal, it looks like this: public class QueryParameter { public QueryParameter(string ParameterName, Object ParameterValue, ConstraintType constraintType) { this.ParameterName = ParameterName; this.ParameterValue = ParameterValue; this.Constraint = constraintType; } public string ParameterName { get; set; } public Object ParameterValue { get; set; } public ConstraintType Constraint { get; set; } } Now this works well if i'm doing a search like FirstName = "John" , but not when i try to give a parameter like Street = "Some Street". It seems that nhibernate is looking for a street column in the Person table but not in the Address table. Any idea on how should i change my code for so i could do a proper search? Tips? Maybe some alternatives? Disclaimer: i'm kind of a noob so please be gentle ;) Thanks, Denis.

    Read the article

  • error C2297: '<<' : illegal, right operand has type 'double'

    - by Gopal Sharma
    string mesag=""; mesag="aDoubleArray value at 0------->"<<aDoubleArray[0]<<" aDoubleArray value at 1 is "<<aDoubleArray[1]; addLog(AMR_LT_WARN, mesag);// this part not working addLog(AMR_LT_WARN, "this works well"); i dont know anythng about c++ just want to print aDoubleArray values to log file but it throws error C2297: '<<' : illegal, right operand has type 'double'

    Read the article

  • regular expression for letters, numbers and - _ .

    - by Jorre
    I'm having trouble checking in PHP if a value is is any of the following combinations letters (upper or lowercase) numbers (0-9) underscore (_) dash (-) point (.) no spaces! or other characters a few examples: OK: "screen123.css" OK: "screen-new-file.css" OK: "screen_new.js" NOT OK: "screen new file.css" I guess I need a regex for this, since I need to throw an error when a give string has other characters in it than the ones mentioned above.

    Read the article

  • Huge Graph Structure

    - by Harph
    I'm developing an application in which I need a structure for represent a huge graph (between 1000000 and 6000000 nodes and 100 or 600 edges) in memory. The edges representation will contain some attribute of the relation. I have tried a memory map representation, arrays, dictionaries and string for represent that structure in memory, but this always crash because the memory limit. I would to get an advice of how can I represent this, or something similar. By the way, I'm using python.

    Read the article

  • Creating a unique URL safe hash

    - by Ben Foster
    I want to hash/encode a unique integer (database ID) to create a similarly unique string. It needs to meet the following requirements: Must start with a letter or number, and can contain only letters and numbers. All letters in a container name must be lowercase. Must be from 3 through 63 characters long (although the shorter the better) The result does not need to be reversible, just repeatable - so a 1-way hash would be fine.

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 914 915 916 917 918 919 920 921 922 923 924 925  | Next Page >