Search Results

Search found 20586 results on 824 pages for 'virtual methods'.

Page 95/824 | < Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >

  • C# Exception when retrieving rows from a datagrid in virtual mode

    - by JamesM
    Hi all, I keep getting an exception (see below) when I retrieve a list of rows from a Virtual Mode datagrid, this only happens when I have more rows than I can display on screen and it doesn't happen every time. Is there anything I'm missing with regards to virtual mode? Update The image below shows the problem, the index is now outside the list range. The reason for this is say I have 10 items and I hide 5 as they are not needed and I want to run some code on the 5 that are visible, there are now 5 items but the index of some maybe between 5-9, how can I re-index? When I have run some code on the visible 5 I then show the hidden 5 so I don't want to disgard these, I'd need to reindex again when they are all visible. Many thanks.

    Read the article

  • Maven 2.1.0 not passing on system properties to Java virtual machine

    - by raisercostin
    We use the command line to pass on system properties to the Java virtual machine when running our Hudson builds on a Linux box. It used to work quite well in 2.0.9 by since we upgraded to 2.1.0 it has stopped working altogether. The system properties just never make it to the Java virtual machine. I have created a small test project and indeed it does not work at all. I have attached it in case you want to give it a go. This should work just fine with Maven 2.0.9: mvn2.0.9 -Dsystem.test.property=test test But this will fail: mvn2.1 -Dsystem.test.property=test test The Java code simply does this assertTrue( System.getProperty("system.test.property") != null); , Apr 20, 2009; 12:44pm edward eric pedersson

    Read the article

  • Portable way to determining of printer is physical or virtual

    - by Mud
    I need direct-to-printer functionality for my website, with the ability to distinguish a physical printer from a virtual printer (file). Coupons.com has this functionality via a native binary which must be installed by the user. I'd prefer to avoid that. SmartSource.com does it via Java applet: Does anybody know how this is done? I dug through that Java APIs a bit, and don't see anything that would let you determine physical vs virtual, except looking at the name (that seems prone to misidentification). It would be nice to be able to do it in Java, because I already know how to write Java applets. Failing that, is there a way to do this in Flash or Silverlight? Thanks in advance. EDIT: Well deserved bounty awarded to Jason Sperske who worked out an elegant solution. Thanks to those of you who shared ideas, as well as those who actually investigated SmartSource.com's solution (like Adrian).

    Read the article

  • How to rewrite to a virtual directory with a different application

    - by Eytan Levit
    Hi, I have a CMS application that manages multiple websites, today whenever i change the codebehind of one of these websites - i have to rebuild the dll for all websites, deploy it - this disconnects all current sessions and is really bad. The iis is configured to listen to all domain requests, if the request is to one of the websites' domain , the application rewrites it, or example, if someone requests for http://www.example.com, and example.com is configured in the application to be website 12, it is rewritten to http://www.example.com/websites/12/default.aspx. This is done for all websites. We want to seperate the dlls of the websites from each other, and from the main CMS, we have a virtual directory to each websites, but when trying to rewrite to it, we discover that IIS support this (we get an "Could not load type '_12._Default'". error). How can we perform this rewrite so it does rewrite to virtual directories, or if anyone has any other solution for the initial dll seperation problem. Thanks in advance

    Read the article

  • SQL server virtual memory usage and perofrmance

    - by user365035
    Hello, I have a very large DB used mostly for analytics. The performance overall is very sluggish. I just noticed that when running the query below, the amount of virtual memory used greatly exceed the amount of physical memory available. Currently, phsycial memory is 10GB (10238 bytes) where as the virtual memory returns significantly more 8388607 bytes. That seems really wrong, but I'm at a bit of a loss on how to proceed. USE [master]; GO select cpu_count , hyperthread_ratio , physical_memory_in_bytes / 1048576 as 'mem_MB' , virtual_memory_in_bytes / 1048576 as 'virtual_mem_MB' , max_workers_count , os_error_mode , os_priority_class from sys.dm_os_sys_info

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • What to name 2 methods with same signatures

    - by coffeeaddict
    Initially I had a method in our DL that would take in the object it's updating like so: internal void UpdateCash(Cash Cash) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set captureID = @captureID, ac_code = @acCode, captureDate = @captureDate, errmsg = @errorMessage, isDebit = @isDebit, SourceInfoID = @sourceInfoID, PayPalTransactionInfoID = @payPalTransactionInfoID, CreditCardTransactionInfoID = @CreditCardTransactionInfoID where id = @cashID"; conn.AddParam("@captureID", cash.CaptureID); conn.AddParam("@acCode", cash.ActionCode); conn.AddParam("@captureDate", cash.CaptureDate); conn.AddParam("@errorMessage", cash.ErrorMessage); conn.AddParam("@isDebit", cyberCash.IsDebit); conn.AddParam("@PayPalTransactionInfoID", cash.PayPalTransactionInfoID); conn.AddParam("@CreditCardTransactionInfoID", cash.CreditCardTransactionInfoID); conn.AddParam("@sourceInfoID", cash.SourceInfoID); conn.AddParam("@cashID", cash.Id); conn.ExecuteNonQuery(); } } My boss felt that creating an object every time just to update one or two fields is overkill. But I had a couple places in code using this. He recommended using just UpdateCash and sending in the ID for CAsh and field I want to update. Well the problem is I have 2 places in code using my original method. And those 2 places are updating 2 completely different fields in the Cash table. Before I was just able to get the existing Cash record and shove it into a Cash object, then update the properties I wanted to be updated in the DB, then send back the cash object to my method above. I need some advice on what to do here. I have 2 methods and they have the same signature. I'm not quite sure what to rename these because both are updating 2 completely different fields in the Cash table: internal void UpdateCash(int cashID, int paypalCaptureID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set CaptureID = @paypalCaptureID where id = @cashID"; conn.AddParam("@captureID", paypalCaptureID); conn.ExecuteNonQuery(); } } internal void UpdateCash(int cashID, int PayPalTransactionInfoID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set PaymentSourceID = @PayPalTransactionInfoID where id = @cashID"; conn.AddParam("@PayPalTransactionInfoID", PayPalTransactionInfoID); conn.ExecuteNonQuery(); } } So I thought hmm, maybe change the names to these so that they are now unique and somewhat explain what field its updating: UpdateCashOrderID UpdateCashTransactionInfoID ok but that's not really very good names. And I can't go too generic, for example: UpdateCashTransaction(int cashID, paypalTransactionID) What if we have different types of transactionIDs that the cash record holds besides just the paypalTransactionInfoID? such as the creditCardInfoID? Then what? Transaction doesn't tell me what kind. And furthermore what if you're updating 2 fields so you have 2 params next to the cashID param: UpdateCashTransaction(int cashID, paypalTransactionID, someOtherFieldIWantToUpdate) see my frustration? what's the best way to handle this is my boss doesn't like my first route?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Pure virtual destructor in interface

    - by ALOR
    Hello all. Here is my problem. I'm making C++ dll, which extensively relies on instance object exports. So i return my actual instances as a pointers to interface through some exported factory method. Interfaces i use are purely virtual, to avoid linking problame. So i need a pure virtual destructor too, and i implemented one (with empty body, as i googled it). All compiles perfectly well, except... I can't see, if the actual destructors are called or not - because when i added some std::cout << "hello destructor"; i never get to see it. I have some explicit "delete obj", that's not the problem. Am i missing something? Is there another way to delete my object through interface?

    Read the article

  • convert from physical path to virtual path

    - by user710502
    I have this function that gets the fileData as a byte array and a file path. The error I am getting is when it tries to set the fileInfo in the code bewlo. It says 'Physical Path given, Virtual Path expected' public override void WriteBinaryStorage(byte[] fileData, string filePath) { try { // Create directory if not exists. System.IO.FileInfo fileInfo = new System.IO.FileInfo(System.Web.HttpContext.Current.Server.MapPath(filePath)); //when it gets to this line the error is caught if (!fileInfo.Directory.Exists) { fileInfo.Directory.Create(); } // Write the binary content. System.IO.File.WriteAllBytes(System.Web.HttpContext.Current.Server.MapPath(filePath), fileData); } catch (Exception) { throw; } } When debugging it, is providing the filePath as "E:\\WEBS\\webapp\\default\\images\\mains\\myimage.jpg" . And the error message is 'E:/WEBS/webapp/default/images/mains/myimage.jpg' is a physical path, but a virtual path was expected. Also, what it is triggering this to happen is the following call properties.ResizeImage(imageName, Configurations.ConfigSettings.MaxImageSize, Server.MapPath(Configurations.EnvironmentConfig.LargeImagePath));

    Read the article

  • How to unit test private methods in BDD / TDD?

    - by robert_d
    I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

    Read the article

  • Physical Cores vs Virtual Cores in Parallelism

    - by Code Curiosity
    When it comes to virtualization, I have been deliberating on the relationship between the physical cores and the virtual cores, especially in how it effects applications employing parallelism. For example, in a VM scenario, if there are less physical cores than there are virtual cores, if that's possible, what's the effect or limits placed on the application's parallel processing? I'm asking, because in my environment, it's not disclosed as to what the physical architecture is. Is there still much advantage to parallelizing if the application lives on a dual core VM hosted on a single core physical machine?

    Read the article

  • Using virtual fields in Doctrine_Query

    - by James Maroney
    Is there a way to insert logic based on virtual fields into a Doctrine_Query? I have defined a virtual field in my model, "getStatus()" which I would ultimately like to utilize in a Where clause in my Doctrine_Query. ... ->AndWhere('x.status = ?',$status); "status", however, is not a column in the table it is instead computed by business logic in the model. Filtering the Collection after executing the query works in some situations, but not when a Doctrine_Pager is thrown in the mix, as it computes it's offsets and such before you have access to the Collection. Am I best off ditching Doctrine_Pager and rebuilding that functionality after modifying the Doctrine_Collection?

    Read the article

  • Hudson + gitolite + virtual host on staging server

    - by takeshin
    I have a Ubuntu server which I want to be my continous integration server (for the Zend Application based projects) and the staging server as well. The team is pushing source files to the repository: /home/git/repositories/testing.git Then Hudson does the build, and the master branch is exported (maybe cloned is a better word) by git hudson plugin to: /var/lib/hudson/jobs/test/workspace/ The workspace contains .git folder as well, which is not necessary on my staging website. How do you set up virtual host to see the staging version of the content of the repository? Does the virtual host point to the workspace, or shall I export the files to another directory? What about the permissions and security? Hudson is the owner of all the workspace files. Do I have to do some post-build actions to set up access? P.S. If this question is more apropriate to serverfault, please migrate.

    Read the article

  • Error becuase Virtual directory not being configured as an application in IIS

    - by Cipher
    Hi, I was trying to install a CMS in a folder in my website. After the installation on trying to run, it shows this error: Error 14 It is an error to use a section registered as allowDefinition='MachineToApplication' beyond application level. This error can be caused by a virtual directory not being configured as an application in IIS. E:\Users\Sarin\Documents\Visual Studio 2010\WebSites\WebAssist\blog\web.config 61 I added the webiste as a Virtual Directory and also converted that to application. On trying to browse this application, the following error occurs as shown in the screenshot: http://i.imgur.com/jcRJe.jpg How to make this work?

    Read the article

  • Trouble with abstract generic methods

    - by DanM
    Let's say I have a class library that defines a couple entity interfaces: public interface ISomeEntity { /* ... */ } public interface ISomeOtherEntity { /* ... */ } This library also defines an IRepository interface: public interface IRepository<TEntity> { /* ... */ } And finally, the library has an abstract class called RepositorySourceBase (see below), which the main project needs to implement. The goal of this class is to allow the base class to grab new Repository objects at runtime. Because certain repositories are needed (in this example a repository for ISomeEntity and ISomeOtherEntity), I'm trying to write generic overloads of the GetNew<TEntity>() method. The following implementation doesn't compile (the second GetNew() method gets flagged as "already defined" even though the where clause is different), but it gets at what I'm trying to accomplish: public abstract class RepositorySourceBase // This doesn't work! { public abstract Repository<TEntity> GetNew<TEntity>() where TEntity : SomeEntity; public abstract Repository<TEntity> GetNew<TEntity>() where TEntity : SomeOtherEntity; } The intended usage of this class would be something like this: public class RepositorySourceTester { public RepositorySourceTester(RepositorySourceBase repositorySource) { var someRepository = repositorySource.GetNew<ISomeEntity>(); var someOtherRepository = repositorySource.GetNew<ISomeOtherEntity>(); } } Meanwhile, over in my main project (which references the library project), I have implementations of ISomeEntity and ISomeOtherEntity: public class SomeEntity : ISomeEntity { /* ... */ } public class SomeOtherEntity : ISomeOtherEntity { /* ... */ } The main project also has an implementation for IRepository<TEntity>: public class Repository<TEntity> : IRepository<TEntity> { public Repository(string message) { } } And most importantly, it has an implementation of the abstract RepositorySourceBase: public class RepositorySource : RepositorySourceBase { public override Repository<SomeEntity> GetNew() { return new Repository<SomeEntity>("stuff only I know"); } public override Repository<SomeOtherEntity> GetNew() { return new Repository<SomeOtherEntity>("other stuff only I know"); } } Just as with RepositorySourceBase, the second GetNew() method gets flagged as "already defined". So, C# basically think I'm repeating the same method because there's no way to distinguish the methods from parameters, but if you look at my usage example, it seems like I should be able to distinguish which GetNew() I want from the generic type parameter, e.g, <ISomeEntity> or <ISomeOtherEntity>. What do I need to do to get this to work?

    Read the article

  • private virtual function in derived class

    - by user1706047
    class base { public: virtual void doSomething() = 0; }; class derived : public base { **private:** virtual void doSomething(){cout<<"Derived fn"<<endl;} }; now if i do the following: base *b=new child; b->doSomething(); //it calls the derived class fn even if that is private. Question: 1.its able to call the derived class fn even if that is private.How is it possible? Now if i change the inheritance access specifier from public to protected/private then i get compilation error as "'type cast' : conversion from 'Derived *' to 'base *' exists, but is inaccessible" Notes: I am aware on the concepts of the inheritance access specifiers.So in second case as its derived private/protected, its inaccessible. But here it confuses me for the first question. Any input will be highly appreciated

    Read the article

  • Raising C# events with an extension method - is it bad?

    - by Kyralessa
    We're all familiar with the horror that is C# event declaration. To ensure thread-safety, the standard is to write something like this: public event EventHandler SomethingHappened; protected virtual void OnSomethingHappened(EventArgs e) { var handler = SomethingHappened; if (handler != null) handler(this, e); } Recently in some other question on this board (which I can't find now), someone pointed out that extension methods could be used nicely in this scenario. Here's one way to do it: static public class EventExtensions { static public void RaiseEvent(this EventHandler @event, object sender, EventArgs e) { var handler = @event; if (handler != null) handler(sender, e); } static public void RaiseEvent<T>(this EventHandler<T> @event, object sender, T e) where T : EventArgs { var handler = @event; if (handler != null) handler(sender, e); } } With these extension methods in place, all you need to declare and raise an event is something like this: public event EventHandler SomethingHappened; void SomeMethod() { this.SomethingHappened.RaiseEvent(this, EventArgs.Empty); } My question: Is this a good idea? Are we missing anything by not having the standard On method? (One thing I notice is that it doesn't work with events that have explicit add/remove code.)

    Read the article

  • Most awkward/misleading method in Java Base API ?

    - by JG
    I was recently trying to convert a string literal into a boolean, when the method "boolean Boolean.getBoolean(String name)" popped out of the auto-complete window. There was also another method ("boolean Boolean.parseBoolean(String s)") appearing right after, which lead me to search to find out what were the differences between these two, as they both seemed to do the same. It turns out that what Boolean.getBoolean(String name) really does is to check if there exists a System property (!) of the given name and if its value is true. I think this is very misleading, as I'm definitely not expecting that a method of Boolean is actually making a call to System.getProperty, and just by looking at the method signature, it sure looks (at least to me) like it should be used to parse a String as a boolean. Sure, the javadoc states it clearly, but I still think the method has a misleading name and is not in the right place. Other primitive type wrappers, such as Integer also have a similar method. Also, it doesn't seem to be a very useful method to belong in the base API, as I think it's not very common to have something like -Darg=true. Maybe it's a good question for a Java position interview: "What is the output of Boolean.getBoolean("true")?". I believe a more appropriate place for those methods would be in the System class, e.g., getPropertyAsBoolean; but again, I still think it's unnecessary to have these methods in the base API. It'd make sense to have these in something like the Properties class, where it's very common to do this kind of type conversions. What do you think of all this ? Also, if there's another "awkward" method that you're aware of, please post it. N.B. I know I can use Boolean.valueOf or Boolean.parseBoolean to convert a string literal into a boolean, but I'm just looking to discuss the API design.

    Read the article

< Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >