Search Results

Search found 7742 results on 310 pages for 'continuous learning'.

Page 97/310 | < Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >

  • Hiring New IT Employees versus Promoting Internally for IT Positions

    Recently I was asked my opinion regarding the hiring of IT professionals in regards to the option of hiring new IT employees versus promoting internally for IT positions. After thinking a little more about this question regarding staffing, specifically pertaining to promoting internally verses new employees; I think my answer to this question is that it truly depends on the situation. However, in most cases I would side with promoting internally. The key factors in this decision should be based on a company/department’s current values, culture, attitude, and existing priorities.  For example if a company values retaining all of its hard earned business knowledge then they would tend to promote existing employees internal over hiring a new employee. Moreover, the company will have to pay to train an existing employee to learn a new technology and the learning curve for some technologies can be very steep. Conversely, if a company values new technologies and technical proficiency over business knowledge then a company would tend to hire new employees because they may already have experience with a technology that the company is planning on using. In this scenario, the company would have to take on the additional overhead of allowing a new employee to learn how the business operates prior to them being fully effective. To illustrate my points above let us look at contractor that builds in ground pools for example.  He has the option to hire employees that are very strong but use small shovels to dig, or employees weak in physical strength but use large shovels to dig. Which employee should the contractor use to dig a hole for a new in ground pool? If we compare the possible candidates for this job we will find that they are very similar to hiring someone internally verses a new hire. The first example represents the existing workers that are very strong regarding the understanding how the business operates and the reasons why in a specific manner. However this employee could be potentially weaker than an outsider pertaining to specific technologies and would need some time to build their technical prowess for a new position much like the strong worker upgrading their shovels in order to remove more dirt at once when digging. The other employee is very similar to hiring a new person that may already have the large shovel but will need to increase their strength in order to use the shovel properly and efficiently so that they can move a maximum amount of dirt in a minimal amount of time. This can be compared to new employ learning how a business operates before they can be fully functional and integrated in the company/department. Another key factor in this dilemma pertains to existing employee and their passion for their work, their ability to accept new responsibility when given, and the willingness to take on responsibilities when they see a need in the business. As much as possible should be considered in this decision down to the mood of the team, the quality of existing staff, learning cure for both technology and business, and the potential side effects of the existing staff.  In addition, there are many more consideration based on the current team/department/companies culture and mood. There are several factors that need to be considered when promoting an individual or hiring new blood for a team. They both can provide great benefits as well as create controversy to a group. Personally, staffing especially in the IT world is like building a large scale system in that all of the components and modules must fit together and preform as one cohesive system in the same way a team must come together using their individually acquired skills so that they can work as one team.  If a module is out of place or is nonexistent then the rest of the team will suffer until the all of its issues are addressed and resolved. Benefits of Promoting Internally Internal promotions give employees a reason to constantly upgrade their technology, business, and communication skills if they want to further their career Employees can control their own destiny based on personal desires Employee already knows how the business operates Companies can save money by promoting internally because the initial overhead of allowing new hires to learn how a company operates is very expensive Newly promoted employees can assist in training their replacements while transitioning to their new role within a company. Existing employees already have a proven track record in regards fitting in with the business culture; this is always an unknown with all new hires Benefits of a New Hire New employees can energize and excite existing employees New employees can bring new ideas and advancements in technology New employees can offer a different perspective on existing issues based on their past experience. As you can see the decision to promote an existing employee from within a company verses hiring a new person should be based on several factors that should ultimately place the business in the best possible situation for the immediate and long term future. How would you handle this situation? Would you hire a new employee or promote from within?

    Read the article

  • Oracle Data Integration 12c: Simplified, Future-Ready, High-Performance Solutions

    - by Thanos Terentes Printzios
    In today’s data-driven business environment, organizations need to cost-effectively manage the ever-growing streams of information originating both inside and outside the firewall and address emerging deployment styles like cloud, big data analytics, and real-time replication. Oracle Data Integration delivers pervasive and continuous access to timely and trusted data across heterogeneous systems. Oracle is enhancing its data integration offering announcing the general availability of 12c release for the key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c, delivering Simplified and High-Performance Solutions for Cloud, Big Data Analytics, and Real-Time Replication. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions : Supporting Current and Emerging Initiatives Extreme Performance : Even higher performance than ever before Fast Time-to-Value : Higher IT Productivity and Simplified Solutions  With the new capabilities in Oracle Data Integrator 12c, customers can benefit from: Superior developer productivity, ease of use, and rapid time-to-market with the new flow-based mapping model, reusable mappings, and step-by-step debugger. Increased performance when executing data integration processes due to improved parallelism. Improved productivity and monitoring via tighter integration with Oracle GoldenGate 12c and Oracle Enterprise Manager 12c. Improved interoperability with Oracle Warehouse Builder which enables faster and easier migration to Oracle Data Integrator’s strategic data integration offering. Faster implementation of business analytics through Oracle Data Integrator pre-integrated with Oracle BI Applications’ latest release. Oracle Data Integrator also integrates simply and easily with Oracle Business Analytics tools, including OBI-EE and Oracle Hyperion. Support for loading and transforming big and fast data, enabled by integration with big data technologies: Hadoop, Hive, HDFS, and Oracle Big Data Appliance. Only Oracle GoldenGate provides the best-of-breed real-time replication of data in heterogeneous data environments. With the new capabilities in Oracle GoldenGate 12c, customers can benefit from: Simplified setup and management of Oracle GoldenGate 12c when using multiple database delivery processes via a new Coordinated Delivery feature for non-Oracle databases. Expanded heterogeneity through added support for the latest versions of major databases such as Sybase ASE v 15.7, MySQL NDB Clusters 7.2, and MySQL 5.6., as well as integration with Oracle Coherence. Enhanced high availability and data protection via integration with Oracle Data Guard and Fast-Start Failover integration. Enhanced security for credentials and encryption keys using Oracle Wallet. Real-time replication for databases hosted on public cloud environments supported by third-party clouds. Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c and other Oracle technologies, such as Oracle Database 12c and Oracle Applications, provides a number of benefits for organizations: Tight integration between Oracle Data Integrator 12c and Oracle GoldenGate 12c enables developers to leverage Oracle GoldenGate’s low overhead, real-time change data capture completely within the Oracle Data Integrator Studio without additional training. Integration with Oracle Database 12c provides a strong foundation for seamless private cloud deployments. Delivers real-time data for reporting, zero downtime migration, and improved performance and availability for Oracle Applications, such as Oracle E-Business Suite and ATG Web Commerce . Oracle’s data integration offering is optimized for Oracle Engineered Systems and is an integral part of Oracle’s fast data, real-time analytics strategy on Oracle Exadata Database Machine and Oracle Exalytics In-Memory Machine. Oracle Data Integrator 12c and Oracle GoldenGate 12c differentiate the new offering on data integration with these many new features. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. Find out much more about the new release in the video webcast "Introducing 12c for Oracle Data Integration", where customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Resource Kits Meet Oracle Data Integration 12c  Discover what's new with Oracle Goldengate 12c  Oracle EMEA DIS (Data Integration Solutions) Partner Community is available for all your questions, while additional partner focused webcasts will be made available through our blog here, so stay connected. For any questions please contact us at partner.imc-AT-beehiveonline.oracle-DOT-com Stay Connected Oracle Newsletters

    Read the article

  • Welcome Oracle Data Integration 12c: Simplified, Future-Ready Solutions with Extreme Performance

    - by Irem Radzik
    Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 The big day for the Oracle Data Integration team has finally arrived! It is my honor to introduce you to Oracle Data Integration 12c. Today we announced the general availability of 12c release for Oracle’s key data integration products: Oracle Data Integrator 12c and Oracle GoldenGate 12c. The new release delivers extreme performance, increase IT productivity, and simplify deployment, while helping IT organizations to keep pace with new data-oriented technology trends including cloud computing, big data analytics, real-time business intelligence. With the 12c release Oracle becomes the new leader in the data integration and replication technologies as no other vendor offers such a complete set of data integration capabilities for pervasive, continuous access to trusted data across Oracle platforms as well as third-party systems and applications. Oracle Data Integration 12c release addresses data-driven organizations’ critical and evolving data integration requirements under 3 key themes: Future-Ready Solutions Extreme Performance Fast Time-to-Value       There are many new features that support these key differentiators for Oracle Data Integrator 12c and for Oracle GoldenGate 12c. In this first 12c blog post, I will highlight only a few:·Future-Ready Solutions to Support Current and Emerging Initiatives: Oracle Data Integration offer robust and reliable solutions for key technology trends including cloud computing, big data analytics, real-time business intelligence and continuous data availability. Via the tight integration with Oracle’s database, middleware, and application offerings Oracle Data Integration will continue to support the new features and capabilities right away as these products evolve and provide advance features. E    Extreme Performance: Both GoldenGate and Data Integrator are known for their high performance. The new release widens the gap even further against competition. Oracle GoldenGate 12c’s Integrated Delivery feature enables higher throughput via a special application programming interface into Oracle Database. As mentioned in the press release, customers already report up to 5X higher performance compared to earlier versions of GoldenGate. Oracle Data Integrator 12c introduces parallelism that significantly increases its performance as well. Fast Time-to-Value via Higher IT Productivity and Simplified Solutions:  Oracle Data Integrator 12c’s new flow-based declarative UI brings superior developer productivity, ease of use, and ultimately fast time to market for end users.  It also gives the ability to seamlessly reuse mapping logic speeds development.Oracle GoldenGate 12c ‘s Integrated Delivery feature automatically optimally tunes the process, saving time while improving performance. This is just a quick glimpse into Oracle Data Integrator 12c and Oracle GoldenGate 12c. On November 12th we will reveal much more about the new release in our video webcast "Introducing 12c for Oracle Data Integration". Our customer and partner speakers, including SolarWorld, BT, Rittman Mead will join us in launching the new release. Please join us at this free event to learn more from our executives about the 12c release, hear our customers’ perspectives on the new features, and ask your questions to our experts in the live Q&A. Also, please continue to follow our blogs, tweets, and Facebook updates as we unveil more about the new features of the latest release. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • First Day of Data Integration Track at Oracle OpenWorld 2012

    - by Irem Radzik
    OpenWorld started full speed for us today with a great set of sessions in the Data Integration track. After the exciting keynote session on Oracle Database 12c in the morning; Brad Adelberg, VP of Development for Data Integration products, presented Oracle’s data integration product strategy. His session highlighted the new requirements for data integration to achieve pervasive and continuous access to trusted data. The new requirements and product focus areas presented in this session are: Provide access to any data at any source On premise or on cloud Enable zero downtime operations and maximum performance Leverage real-time data for accurate business insights And ensure high quality data is used across the enterprise During the session Brad walked over how Oracle’s data integration products, Oracle Data Integrator, Oracle GoldenGate, Oracle Enterprise Data Quality, and Oracle Data Service Integrator, deliver on these requirements and how recent product releases build on this strategy. Soon after Brad’s session we heard from a panel of Oracle GoldenGate customers, St. Jude Medical, Equifax, and Bank of America, how they achieved zero downtime operations using Oracle GoldenGate. The panel presented different use cases of GoldenGate, from Active-Active replication to offloading reporting. Especially St. Jude Medical’s implementation, which involves the alert management system for patients that use their pacemakers, reminded me in some cases downtime of mission-critical systems can be a matter of life or death. It is very comforting to hear that GoldenGate delivers highly-reliable continuous availability for life-saving medical systems. In the afternoon, Nick Wagner from the Product Management team and I followed the customer panel with the review of Oracle GoldenGate 11gR2’s New Features.  Many questions we received from audience were about GoldenGate’s new Integrated Capture for Oracle Database and the enhanced Conflict Management features, as well as how GoldenGate compares to Oracle Streams. In addition to giving details on GoldenGate’s unique capability to capture changed data with a direct integration to the Oracle DBMS engine, we reminded the audience that enhancements to Oracle GoldenGate will continue, while Streams will be primarily maintained. Last but not least, Tim Garrod and Ryan Fonnett from Raymond James presented a unified real-time data integration solution using Oracle Data Integrator and GoldenGate for their operational data store (ODS). The ODS supports application services across the enterprise and providing timely data is a critical requirement. In this solution, Oracle GoldenGate does the log-based change data capture for Oracle Data Integrator’s near real-time data integration between heterogeneous systems. As Raymond James’ ODS supports mission-critical services for their advisors, the project team had to set up this integration environment to be highly available. During the session, Ryan and Tim explained how they use ODI to enable automated process execution and “always-on” integration processes. Their presentation included 2 demonstrations that focused on CDC patterns deployed with ODI and the automated multi-instance execution and monitoring. We are very grateful to Tim and Ryan for their very-well prepared presentation at OpenWorld this year. Day 2 (Tuesday) will be also a busy day in our track. In addition to the Fusion Middleware Innovation Awards ceremony at 11:45am at Moscone West 3001, we have the following DI sessions Real-World Operational Reporting Customer Panel 11:45am Moscone West- 3005 Oracle Data Integrator Product Update and Future Strategy 1:15pm Moscone West- 3005 High-volume OLTP with Oracle GoldenGate: Best Practices from Comcast 1:15pm Moscone West- 3005 Everything You need to Know about Monitoring Oracle GoldenGate 5pm Moscone West-3005 If you are at OpenWorld please join us in these sessions. For a full review of data integration track at OpenWorld please see our Focus-On document.

    Read the article

  • Three Key Tenets of Optimal Social Collaboration

    - by kellsey.ruppel
    Today's blog post comes to us from John Bruswick! This post is an abridged version of John’s white paper in which he discusses three principals to optimize social collaboration within an enterprise.   By [email protected], Oracle Principal Sales Consultant Effective social collaboration is actionable, deeply contextual and inherently derives its value from business entities outside of itself. How does an organization begin the journey from traditional, siloed collaboration to natural, business entity based social collaboration? Successful enablement of enterprise social collaboration requires that organizations embrace the following tenets and understand that traditional collaborative functionality has inherent limits - it is innovation and integration in accordance with the following tenets that will provide net-new efficiency benefits. Key Tenets of Optimal Social Collaboration Leverage a Ubiquitous Social Fabric - Collaborative activities should be supported through a ubiquitous social fabric, providing a personalized experience, broadcasting key business events and connecting people and business processes.  This supports education of participants working in and around a specific business entity that will benefit from an implicit capture of tacit knowledge and provide continuity between participants.  In the absence of this ubiquitous platform activities can still occur but are essentially siloed causing frequent duplication of effort across similar tasks, with critical tacit knowledge eluding capture. Supply Continuous Context to Support Decision Making and Problem Solving - People generally engage in collaborative behavior to obtain a decision or the resolution for a specific issue.  The time to achieve resolution is referred to as "Solve Time".  Users have traditionally been forced to switch or "alt-tab" between business systems and synthesize their own context across disparate systems and processes.  The constant loss of context forces end users to exert a large amount of effort that could be spent on higher value problem solving. Extend the Collaborative Lifecycle into Back Office - Beyond the solve time from decision making efforts, additional time is expended formalizing the resolution that was generated from collaboration in a system of record.  Extending collaboration to result in the capture of an explicit decision maximizes efficiencies, creating a closed circuit for a particular thread.  This type of structured action may exist today within your organization's customer support system around opening, solving and closing support issues, but generally does not extend to Sales focused collaborative activities. Excelling in the Unstructured Future We will always have to deal with unstructured collaborative processes within our organizations.  Regardless of the participants and nature of the collaborate process, two things are certain – the origination and end points are generally known and relate to a business entity, perhaps a customer, opportunity, order, shipping location, product or otherwise. Imagine the benefits if an organization's key business systems supported a social fabric, provided continuous context and extended the lifecycle around the collaborative decision making to include output into back office systems of record.   The technical hurdle to embracing optimal social collaboration would fall away, leaving the company with an opportunity to focus on and refine how processes were approached.  Time and resources previously required could then be reallocated to focusing on innovation to support competitive differentiation unique to your business. How can you achieve optimal social collaboration? Oracle Social Network enables business users to collaborate with each other using a broad range of collaboration styles and integrates data from a variety of sources and business applications -- allowing you to achieve optimal social collaboration. Looking to learn more? Read John's white paper, where he discusses in further detail the three principals to optimize social collaboration within an enterprise. 

    Read the article

  • Visual Studio 2010 Best Practices

    - by Etienne Tremblay
    I’d like to thank Packt for providing me with a review version of Visual Studio 2010 Best Practices eBook. In fairness I also know the author Peter having seen him speak at DevTeach on many occasions.  I started by looking at the table of content to see what this book was about, knowing that “best practices” is a real misnomer I wanted to see what they were.  I really like the fact that he starts the book by really saying they are not really best practices but actually recommend practices.  As a Team Foundation Server user I found that chapter 2 was more for the open source crowd and I really skimmed it.  The portion on Branching was well documented, although I’m not a fan of the testing branch myself, but the rest was right on. The section on merge remote changes (bring the outside to you) paradigm is really important and was touched on. Chapter 3 has good solid practices on low level constructs like generics and exceptions. Chapter 4 dives into architectural practices like decoupling, distributed architecture and data based architecture.  DTOs and ORMs are touched on briefly as is NoSQL. Chapter 5 is about deployment and is really a great primer on all the “packaging” technologies like Visual Studio Setup and Deployment (depreciated in 2012), Click Once and WIX the major player outside of commercial solutions.  This is a nice section on how to move from VSSD to WIX this is going to be important in the coming years due to the fact that VS 2012 doesn’t support VSSD. In chapter 6 we dive into automated testing practices, including test coverage, mocking, TDD, SpecDD and Continuous Testing.  Peter covers all those concepts really nicely albeit succinctly. Being a book on recommended practices I find this is really good. I really enjoyed chapter 7 that gave me a lot of great tips to enhance my Visual Studio “experience”.  Tips on organizing projects where good.  Also even though I knew about configurations I like that he put that in there so you can move all your settings to another machine, a lot of people don’t know about that. Quick find and Resharper are also briefly covered.  He touches on macros (depreciated in 2012).  Finally he touches on Continuous Integration a very important concept in today’s ALM landscape. Chapter 8 is all about Parallelization, threads, Async, division of labor, reactive extensions.  All those concepts are touched on and again generalized approaches to those modern problems are giving.       Chapter 9 goes into distributed apps, the most used and accepted practice in the industry for .NET projects the chapter tackles concepts like Scalability, Messaging and Cloud (the flavor of the month of distributed apps, although I think this will stick ;-)).  He also looks a protocols TCP/UDP and how to debug distributed apps.  He touches on logging and health monitoring. Chapter 10 tackles recommended practices for web services starting with implementing WCF services, which goes into all sort of goodness like how to host in IIS or self-host.  How to manual test WCF services, also a section on authentication and authorization.  ASP.NET Web services are also touched on in that chapter All in all a good read, nice tips and accepted practices.  I like the conciseness of the subjects and Peter touches on a lot of things in this book and uses a lot of the current technologies flavors to explain the concepts.   Cheers, ET

    Read the article

  • JDeveloper 11g R1 (11.1.1.4.0) - New Features on ADF Desktop Integration Explained

    - by juan.ruiz
    One of the areas that introduced many new features on the latest release (11.1.1.4.0)  of JDeveloper 11g R1 is ADF Desktop integration - in this article I’ll provide an overview of these new features. New ADF Desktop Integration Ribbon in Excel - After installing the ADF desktop integration add-in and depending on the mode in which you open the desktop integration workbook, the ADF Desktop integration ribbon for design time and runtime are displayed as a separate tab within Excel. In previous version the ADF Desktop integration environment used to be placed inside the add-ins tab. Above you can see both, design time ribbon as well as runtime ribbon. On the design time ribbon you can manage the workbook and worksheet properties, worksheet component properties, diagnostics, execution and publication of the workbook. The runtime version of the ribbon is totally customizable and represents what it used to be the runtime menu on the spreadsheet, in this ribbon you can include all the operations and actions that could be executed by the end user while working with the spreadsheet data. Diagnostics - A very important aspect for developers is how to debug or verify the interactions of the client with the server, for that ADF desktop integration has provided since day one a series of diagnostics tools. In this release the diagnostics tools are more visible and are really easy to configure. You can access the client console while testing the workbook, or you can simple dump all the messages to a log file – having the ability of setting the output level for both. Security - There are a number of enhancements on security but the one with more impact for developers is tha security now is optional when using ADF Desktop Integration. Until this version every time that you wanted to work with ADFdi it was a must that the application was previously secured. In this release security is optional which means that if you have previously defined security on your application, then you must secure the ADFdi servlet as explained in one of my previous (ADD LINK) posts. In the other hand, if but the time that you start working with ADFdi you have not defined security, you can test and publish your workbooks without adding security. Support for Continuous Integration - In this release we have added tooling for continuous integration building. in the ADF desktop integration space, the concept translates to adding functionality that developers can use to publish ADFdi workbooks as part of their entire application build. For that purpose, we have a publish tool that can be easily invoke from an ANT task such that all the design time workbooks are re-published into the latest version of the application building process. Key Column - At runtime, on any worksheet containing editable tables you will notice a new additional column called the key column. The purpose of this column is to make the end user aware that all rows on the table need to be selected at the time of sorting. The users cannot alter the value of this column. From the developers points of view there are no steps required in order to have the key column included into the worksheets. Installation and Creation of New Workbooks - Both use cases can be executed now directly from JDeveloper. As part of the Tools menu options the developer can install the ADF desktop integration designer. Also, creating new workbooks that previously was done through that convert tool shipped with JDeveloper is now automatic done from the New Gallery. Creating a new ADFdi workbook adds metadata information information to the Excel workbook so you can work in design time. Other Enhancements Support for Excel 2010 and the ADF components ready-only enabled don’t allow to change its value – the cell in Excel is automatically protected, this could cause confusion among customers of previous releases.

    Read the article

  • Visual Studio 2012 and .NET 4.5 now Live!

    - by Tarun Arora
    Today was the formal launch event for Visual Studio 2012 and .NET 4.5, a state-of-the-art development solution for building modern applications that span connected devices and continuous services, from the client to the cloud. The event was streamed live from http://visualstudiolaunch.com, S.Somasegar corporate vice president of the Developer Division opened the key note, Jason Zander dived deeper into how to leverage Visual Studio 2012 and .NET 4.5 to build modern application. Brian Harry all the awesome features in Visual Studio 2012 to improve the application lifecycle management.   I. Summary of the announcements made today 1. Visual Studio Updates coming this fall –  VS Update will better support agile teams, enable continuous quality, elevate SharePoint development with application lifecycle management (ALM) tools, and expand Visual Studio 2012 Windows development capabilities. It will be available as a community technology preview (CTP) later this month and in final release later this calendar year. A comprehensive list of what will be on offer can be found here. 2. Visual Studio Express 2012 for Windows Desktop – Visual Studio Express 2012 for Windows Desktop brings the newest desktop development capabilities in Visual Studio 2012 to Express users, too. You would be excited to know that the express SKU will support Integration with TFS among some of the other cool features I would like to mention Unit Testing, Unit Testing, Code Analysis, dependency management with NuGet a full list and download links can be found here. 3. F# tools for Visual Studio Express 2012 for web –  This F# Tools release adds in F# 3.0 components, such as the F# 3.0 compiler, F# Interactive, IDE support, and new F# features such as type providers and query expressions to your Visual Studio 2012 express for web. More details and download links can be found here. 4. Visual Studio TFS 2012 Power Tools – The TFS 2012 Power tools brings the goodness of Best Practice Analyzer, Process Template Editor, Storyboard Shapes, Team Explorer enhancements, TFPT command line, TFS Server Backups, etc via to your TFS 2012 installation. It can be downloaded right away from here. II. Road shows There will be many more community road shows this month packaged with hours of demos and discussions. The Visual Studio UK Team has just announced that there will be four UK launch events, face to face session including a product group speaker and partner sessions: Edinburgh, 1st October Manchester, 3rd October London, 4th October Reading, 5th October III. Get Started Download Visual Studio 2012 and the additional supporting software's from here. The Visual Studio development team has put together over 60 videos to help you learn about the new Visual Studio 2012 capabilities in more detail, and all of these will be available for watching here. IV. What’s Next A lot more exciting stuff lined up… Windows 8 Anticipated release: Oct. 26 (UPDATED 9/12) Windows Server 2012 Released (UPDATED 9/4) System Center 2012 Released (UPDATED 9/11) SQL Server 2012 Released (UPDATED 4/2) Internet Explorer 10 Anticipated release: Between Q3 2012 and early 2013 (UPDATED 5/3   Office 2013 Anticipated release: Q4 2012 or Q1 2013(UPDATED 9/12) Exchange 2013 Anticipated release: Q4 2012 (UPDATED 7/26) Visual Studio 2012 Released (UPDATED 9/12) Kinect for Windows Released (UPDATED 9/4) Windows Phone "Tango" and 8 "Tango": Released; Anticipated "Windows Phone 8" release: Q4 2012 (UPDATED 9/5) Dynamics ERP Online Anticipated release: September or October 2012 (UPDATED 7/20) Office 365 Anticipated update schedule: "Almost weekly"(UPDATED 9/12) Windows Azure Rumored CTP release: Spring 2012 (UPDATED 9/7) SharePoint 2013 Anticipated release: Q4 2012 (UPDATED 8/21) Enjoy

    Read the article

  • Mastering snow and Java development at jDays in Gothenburg

    - by JavaCecilia
    Last weekend, I took the train from Stockholm to Gothenburg to attend and present at the new Java developer conference jDays. It was professionally arranged in the Swedish exhibition hall close to the amusement park Liseberg and we got a great deal out of the top-level presenters and hallway discussions. Understanding and Improving Your Java Process Our main purpose was to spread information on JVM and our monitoring tools for Java processes, so I held a crash course in the most important terms and concepts if you want to affect the performance of your Java process. From the beginning - the JVM specification to interpretation of heap usage graphs. For correct analysis, you also need to understand something about process memory - you need space for the Java heap (-Xms for initial size and -Xmx for max heap size), but the process memory also contain the thread stacks (to a size of -Xss), JVM internal data structures used for keeping track of Java objects on the heap, method compilation/optimization, native libraries, etc. If you get long pause times, make sure to monitor your application, see the allocation rate and frequency of pause times.My colleague Klara Ward then held a presentation on the Java Mission Control product, the profiling and diagnostics tools suite for HotSpot, coming soon. The room was packed and very appreciated, Klara demonstrated four different scenarios, e.g. how to diagnose and fix latencies due to lock contention for logging.My German colleague, OpenJDK ambassador Dalibor Topic travelled to Sweden to do the second keynote on "Make the Future Java". He let us in on the coming features and roadmaps of Java, now delivering major versions on a two-year schedule (Java 7 2011, Java 8 2013, etc). Also letting us in on where to download early versions of 8, to report problems early on. Software Development in teams Being a scout leader, I'm drilled in different team building and workshop techniques, creating strong groups - of course, I had to attend Henrik Berglund's session on building successful teams. He spoke about the importance of clear goals, autonomy and agreed processes. Thomas Sundberg ended the conference by doing live remote pair programming with Alex in Rumania and a concrete tips for people wanting to try it out (for local collaboration, remember to wash and change clothes). Memory Master Keynote The conference keynote was delivered by the Swedish memory master Mattias Ribbing, showing off by remembering the order of a deck of cards he'd seen once. He made it interactive by forcing the audience to learn a memory mastering technique of remembering ten ordered things by heart, asking us to shout out the order backwards and we made it! I desperately need this - bought the book, will get back on the subject. Continuous Delivery The most impressive presenter was Axel Fontaine on Continuous Delivery. Very well prepared slides with key images of his message and moved about the stage like a rock star. The topic is of course highly interesting, how to create an infrastructure enabling immediate feedback to developers and ability to release your product several times per day. Tomek Kaczanowski delivered a funny and useful presentation on good and bad tests, providing comic relief with poorly written tests and the useful rules of thumb how to rewrite them. To conclude, we had a great time and hope to see you at jDays next year :)

    Read the article

  • Find the "largest" dense sub matrix in a large sparse matrix

    - by BCS
    Given a large sparse matrix (say 10k+ by 1M+) I need to find a subset, not necessarily continuous, of the rows and columns that form a dense matrix (all non-zero elements). I want this sub matrix to be as large as possible (not the largest sum, but the largest number of elements) within some aspect ratio constraints. Are there any known exact or aproxamate solutions to this problem? A quick scan on Google seems to give a lot of close-but-not-exactly results. What terms should I be looking for? edit: Just to clarify; the sub matrix need not be continuous. In fact the row and column order is completely arbitrary so adjacency is completely irrelevant. A thought based on Chad Okere's idea Order the rows from largest count to smallest count (not necessary but might help perf) Select two rows that have a "large" overlap Add all other rows that won't reduce the overlap Record that set Add whatever row reduces the overlap by the least Repeat at #3 until the result gets to small Start over at #2 with a different starting pair Continue until you decide the result is good enough

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Timer a usage in msp430 in high compiler optimization mode

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code, //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • My timer code is failing when IAR is configured to do max optimization

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code [Code] //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled [/code] Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • What guidelines should be followed when using an unstable/testing/stable branching scheme?

    - by Elliot
    My team is currently using feature branches while doing development. For each user story in our sprint, we create a branch and work it in isolation. Hence, according to Martin Fowler, we practice Continuous Building, not Continuous Integration. I am interested in promoting an unstable/testing/stable scheme, similar to that of Debian, so that code is promoted from unstable = testing = stable. Our definition of done, I'd recommend, is when unit tests pass (TDD always), minimal documentation is complete, automated functional tests pass, and feature has been demo'd and accepted by PO. Once accepted by the PO, the story will be merged into the testing branch. Our test developers spend most of their time in this branch banging on the software and continuously running our automated tests. This scares me, however, because commits from another incomplete story may now make it into the testing branch. Perhaps I'm missing something because this seems like an undesired consequence. So, if moving to a code promotion strategy to solve our problems with feature branches, what strategy/guidelines do you recommend? Thanks.

    Read the article

  • Scheme homework help

    - by John
    Okay so I have started a new language in class. We are learning Scheme and i'm not sure on how to do it. When I say learning a new language, I mean thrown a homework and told to figure it out. A couple of them have got me stumped. My first problem is: Write a Scheme function that returns true (the Boolean constant #t) ifthe parameter is a list containing n a's followed by n b's. and false otherwise. Here's what I have right now: (define aequalb (lamda (list) (let ((head (car list)) (tail(cdr list))) (if(= 'a head) ((let ((count (count + 1))) (let (( newTail (aequalb tail)))) #f (if(= 'b head) ((let ((count (count - 1))) (let (( newTail (aequalb tail)))) #f (if(null? tail) (if(= count 0) #t #f))))))))))) I know this is completely wrong, but I've been trying so please take it easy on me. Any help would be much appreciated.

    Read the article

  • Good projects to learn OCaml and F#

    - by Yin Zhu
    After learning the basic syntax, reading some non-trivial code is a fast way to learn a language. We can also learn how to design a library/software during reading others' code. I have following lists. A Chess program in OCaml by Tomek Czajka. Hal Daumé has written several machine learning libraries in Ocaml. Including decision trees, logistic regression and SVM. All of them are near-production-quality code. A Chess Game Analysis program in F# in Microsoft Research. The above three are my favorites. Will you suggest some other sources? General purpose open source software are good, specialized open source like the three I list here are even more welcome.

    Read the article

  • Getting Started with UDK

    - by Sean Edwards
    I've been trying for a couple of days now to learn UDK, but I seem to be stuck at making that leap to understanding how everything works together. I understand the syntax, that's all well and good, and I pretty much get how classes and .ini files interact. As for the API, I have the entire reference as pretty decent Doxygen-style HTML output. What I'm looking for is a sort of intermediate tutorial on game creation from scratch (as opposed to modding UT3 itself), more advanced than just learning language syntax, but not yet to the level of going through the API step by step. I'm looking for some guide to the structure of the internals - how GameInfo and PlayerController interact, where Pawn comes in, etc. - a way to visualize the big picture. Does anyone have a particular favorite intermediate-level tutorials (or set of tutorials) that they used when first learning UDK?

    Read the article

  • C# Winforms vs WPF

    - by m0s
    Hi pros, I am a student and I do freelance here and there when I have opportunity. I believe my strongest language is C#. I don't really know what is going on in real programming world, so I was wondering if WPF did take over WinForms? I know the differences between two and how two can be used simultaneously but, I just don't want to invest my time in learning dying technologies, I hope you understand. So, for windows desktop programming what would you recommend to master WinForms, WPF or maybe both? I also get a lot that desktop programming is dead already and one should only care about learning web programming. Thanks for attention, any comments are greatly appreciated.

    Read the article

  • Python web devlopment framework for python 3.1 user

    - by iama
    I have been learning python for some time now. While starting this "learning python" endeavor I decided to learn the latest and greatest 3.1 version of python. I regret this decision now because I wanted to try my hands on some of the python web development frameworks & it looks like many of them does not support 3.1 yet & it looks like it might take them years to support the new version of Python especially Django and TurboGears. This is really disappointing. Therefore, SO users, do you have any recommendation for a web framework for me that runs on 3.1 and supports some of the modern (I guess I will never learn ;-)) web framework features like MVC/ORM/URL Routing/Caching etc. Many thanks for your response.

    Read the article

  • trying to decide between asp.net and jsp

    - by Amir
    Hey Guys, I am wondering if anyone can shed some lights on the situation. I am about to start a project and trying to figure out what solution is best to go with asp.net or java jsp pages I have personally worked alot with .net and am really happy with the framework and Visual studio as IDE I find it easy to work with and there is a massive community support behind .net, i can get alot done quickly I have not every written anything use java jsp, there will be a learning curve here , so my experience is limited here. however after seeing jira i am very impressed with its capabilities, it has changed alot since the old days ( java 1.2 ) that i used to work with, and the fact that it runs under linux is a huge plus, so i am trying to decide is the learning curve, worth the price ? so given the situation above what would you recommended? Thanks, Amir

    Read the article

  • Good websites and/or books to learn game algorithms?

    - by Moshe
    I'm interested in learning video game algorithms. (For iPhone particularly, but generally as well. I assume certain concepts are the same.) I am best off (personally) learning from a book but websites are useful too. What has helped you learn game programming algorithms and concepts? EDIT: As per request, I'll clarify the types of algorithms... I was looking for any algorithms really, but I guess I was interested in (top-down view) platformer algorithms, but, now that you mention it, Seth, I do wonder about chess...

    Read the article

  • Easiest/Best Way to Learn the x86 Instruction Set?

    - by mudge
    I would like to learn the x86 Instruction Set Architecture. I don't meaning learning an assembly for x86. I want to understand the machine code baby. The reason is that I would like to write an assembler for x86. Then I want to write a compiler that compiles to that assembly. I know that there are the Intel manuals and AMD manuals that cover the x86 instruction set. But those are very large and dense. I'm wondering if there is a more approachable (possibly tutorial) approach to learning the x86 instruction set architecture.

    Read the article

  • Lock-free multi-threading is for real threading experts...

    - by vdhant
    I was reading through an answer that Jon Skeet gave to a question and in it he mentioned this: As far as I'm concerned, lock-free multi-threading is for real threading experts, of which I'm not one. Its not the first time that I have heard this, but I find very few people talking about how you actually do it if you are interested in learning how to write lock-free multi-threading code. So my question is besides learning all you can about threading, etc where do you start trying to learn to specifically write lock-free multi-threading code and what are some good resources. Cheers

    Read the article

  • How to Insert a sub string to each line in perl

    - by Nano HE
    Hi, My code as below, How to remove the blank after add hello. to each lines. #!C:\Perl\bin\perl.exe use strict; use warnings; use Data::Dumper; my $fh = \*DATA; #my($line) = $_; while(my $line = <$fh>) { print "Hello.".$line; chomp($line); } __DATA__ Member Information id = 0 name = "tom" age = "20" Output: D:\learning\perl>test.pl Hello.Member Information Hello. id = 0 # i want to remove the blank between Hello. and id Hello. name = "tom" # same as above Hello. age = "20" # same D:\learning\perl>

    Read the article

  • What should I learn after HTML and CSS?

    - by Ryan B
    I am 5 days into learning how to make my website, flying through my HTML & CSS book and having fun. I’m starting to consider what to order next. I’m not sure what to study next, so please give me some advice if you can. My end goal is to create a site that has a lot of the functionality that www.edufire.com and similar sites have, just for example. I think I’m learning well with the Head First Series, and the style will probably serve me well as an intro to programming. However, I don't think the books dive too deeply into any 1 subject. I could order: A: Head First Programming: A Learner’s Guide to Programming Using the Python Language B: Head First Javascript C: Head First PHP & MySQL D: a different programming book or E: another CSS or design book to solidify my basic HTML & CSS skills Any guidance would be appreciated. Thanks!

    Read the article

< Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >